Clone Name | rbastl25h07 |
---|---|
Clone Library Name | barley_pub |
>gb|AC007504.3| Arabidopsis thaliana chromosome I BAC F13F21 genomic sequence, complete sequence Length = 125021 Score = 42.1 bits (21), Expect = 0.93 Identities = 21/21 (100%) Strand = Plus / Plus Query: 181 ccaccaaagtgaaaatcacac 201 ||||||||||||||||||||| Sbjct: 72646 ccaccaaagtgaaaatcacac 72666
>emb|AL353013.1|ATT24H18 Arabidopsis thaliana DNA chromosome 5, BAC clone T24H18 (ESSA project) Length = 90020 Score = 42.1 bits (21), Expect = 0.93 Identities = 21/21 (100%) Strand = Plus / Minus Query: 181 ccaccaaagtgaaaatcacac 201 ||||||||||||||||||||| Sbjct: 49042 ccaccaaagtgaaaatcacac 49022
>gb|AC147234.3| Mus musculus BAC clone RP24-500F11 from chromosome 18, complete sequence Length = 189846 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 10 aaagcttttttctttaagaa 29 |||||||||||||||||||| Sbjct: 57204 aaagcttttttctttaagaa 57185
>gb|AC161056.5| Mus musculus BAC clone RP23-241J7 from chromosome 3, complete sequence Length = 226878 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 73 acagccagccagtacagtag 92 |||||||||||||||||||| Sbjct: 195786 acagccagccagtacagtag 195805
>ref|XR_003254.1| PREDICTED: Mus musculus similar to 40S ribosomal protein SA (p40) (34/67 kDa laminin receptor) (LOC436243), mRNA Length = 1023 Score = 40.1 bits (20), Expect = 3.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 206 catcaagaagttgacaacgaataa 229 ||||||||||||||| |||||||| Sbjct: 102 catcaagaagttgaccacgaataa 79
>gb|AC122211.4| Mus musculus BAC clone RP23-97F18 from chromosome 18, complete sequence Length = 186451 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 10 aaagcttttttctttaagaa 29 |||||||||||||||||||| Sbjct: 60253 aaagcttttttctttaagaa 60272
>emb|Z81505.2|CEF16A11 Caenorhabditis elegans Cosmid F16A11, complete sequence Length = 30626 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 153 tcttcttcttcctccgaccg 172 |||||||||||||||||||| Sbjct: 8392 tcttcttcttcctccgaccg 8411
>gb|AC008071.2| Homo sapiens BAC clone RP11-388L11 from 7, complete sequence Length = 129938 Score = 40.1 bits (20), Expect = 3.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 258 atcttctgctactgttgaaagaaa 281 ||||| |||||||||||||||||| Sbjct: 11232 atcttttgctactgttgaaagaaa 11255
>emb|AL158048.35| Human DNA sequence from clone RP5-963K15 on chromosome 1p36.21-36.33 Contains the SLC2A5 gene for solute carrier family 2 (facilitated glucose/fructose transporter) member 5, two novel genes and two CpG islands, complete sequence Length = 139111 Score = 40.1 bits (20), Expect = 3.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 25 aagaaagacacccaaagggcatct 48 ||||||||||| |||||||||||| Sbjct: 24663 aagaaagacacacaaagggcatct 24640
>emb|Y16773.1|LEAPX Lycopersicaon esculentum APX gene, complete CDS Length = 4460 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 227 taaattttcaattttggcct 246 |||||||||||||||||||| Sbjct: 1886 taaattttcaattttggcct 1905
>gb|AF510489.1| Brassica nigra isolate 173ET COL1 protein (COL1) gene, complete cds Length = 1291 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 143 atcatactagtcttcttctt 162 |||||||||||||||||||| Sbjct: 36 atcatactagtcttcttctt 17
>gb|AF510488.1| Brassica nigra isolate 176ET COL1 protein (COL1) gene, complete cds Length = 1291 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 143 atcatactagtcttcttctt 162 |||||||||||||||||||| Sbjct: 36 atcatactagtcttcttctt 17
>gb|AF510487.1| Brassica nigra isolate 179ET COL1 protein (COL1) gene, complete cds Length = 1291 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 143 atcatactagtcttcttctt 162 |||||||||||||||||||| Sbjct: 36 atcatactagtcttcttctt 17
>gb|AF510486.1| Brassica nigra isolate 180ET COL1 protein (COL1) gene, complete cds Length = 1291 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 143 atcatactagtcttcttctt 162 |||||||||||||||||||| Sbjct: 36 atcatactagtcttcttctt 17
>gb|AF510485.1| Brassica nigra isolate 182ET COL1 protein (COL1) gene, complete cds Length = 1291 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 143 atcatactagtcttcttctt 162 |||||||||||||||||||| Sbjct: 36 atcatactagtcttcttctt 17
>gb|AF510484.1| Brassica nigra isolate 183ET COL1 protein (COL1) gene, complete cds Length = 1291 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 143 atcatactagtcttcttctt 162 |||||||||||||||||||| Sbjct: 36 atcatactagtcttcttctt 17
>gb|AF510483.1| Brassica nigra isolate 185ET COL1 protein (COL1) gene, complete cds Length = 1291 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 143 atcatactagtcttcttctt 162 |||||||||||||||||||| Sbjct: 36 atcatactagtcttcttctt 17
>gb|AF510482.1| Brassica nigra isolate 186ET COL1 protein (COL1) gene, complete cds Length = 1291 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 143 atcatactagtcttcttctt 162 |||||||||||||||||||| Sbjct: 36 atcatactagtcttcttctt 17
>gb|AF510481.1| Brassica nigra isolate 54GE COL1 protein (COL1) gene, complete cds Length = 1282 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 143 atcatactagtcttcttctt 162 |||||||||||||||||||| Sbjct: 36 atcatactagtcttcttctt 17
>gb|AF510480.1| Brassica nigra isolate 64GE COL1 protein (COL1) gene, complete cds Length = 1282 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 143 atcatactagtcttcttctt 162 |||||||||||||||||||| Sbjct: 36 atcatactagtcttcttctt 17
>gb|AF510479.1| Brassica nigra isolate 68GE COL1 protein (COL1) gene, complete cds Length = 1282 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 143 atcatactagtcttcttctt 162 |||||||||||||||||||| Sbjct: 36 atcatactagtcttcttctt 17
>gb|AF510478.1| Brassica nigra isolate 69GE COL1 protein (COL1) gene, complete cds Length = 1282 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 143 atcatactagtcttcttctt 162 |||||||||||||||||||| Sbjct: 36 atcatactagtcttcttctt 17
>gb|AF510477.1| Brassica nigra isolate 70GE COL1 protein (COL1) gene, complete cds Length = 1282 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 143 atcatactagtcttcttctt 162 |||||||||||||||||||| Sbjct: 36 atcatactagtcttcttctt 17
>gb|AF510475.1| Brassica nigra isolate 72GE COL1 protein (COL1) gene, complete cds Length = 1282 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 143 atcatactagtcttcttctt 162 |||||||||||||||||||| Sbjct: 36 atcatactagtcttcttctt 17
>gb|AF510474.1| Brassica nigra isolate 272SI COL1 protein (COL1) gene, complete cds Length = 1282 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 143 atcatactagtcttcttctt 162 |||||||||||||||||||| Sbjct: 36 atcatactagtcttcttctt 17
>gb|AF510473.1| Brassica nigra isolate 273SI COL1 protein (COL1) gene, complete cds Length = 1282 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 143 atcatactagtcttcttctt 162 |||||||||||||||||||| Sbjct: 36 atcatactagtcttcttctt 17
>gb|AF510472.1| Brassica nigra isolate 274SI COL1 protein (COL1) gene, complete cds Length = 1288 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 143 atcatactagtcttcttctt 162 |||||||||||||||||||| Sbjct: 36 atcatactagtcttcttctt 17
>gb|AF510471.1| Brassica nigra isolate 275SI COL1 protein (COL1) gene, complete cds Length = 1282 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 143 atcatactagtcttcttctt 162 |||||||||||||||||||| Sbjct: 36 atcatactagtcttcttctt 17
>gb|AF510470.1| Brassica nigra isolate S1PO COL1 protein (COL1) gene, complete cds Length = 1282 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 143 atcatactagtcttcttctt 162 |||||||||||||||||||| Sbjct: 36 atcatactagtcttcttctt 17
>gb|AF510469.1| Brassica nigra isolate 260SI COL1 protein (COL1) gene, complete cds Length = 1300 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 143 atcatactagtcttcttctt 162 |||||||||||||||||||| Sbjct: 36 atcatactagtcttcttctt 17
>gb|AF510468.1| Brassica nigra isolate S105SP COL1 protein (COL1) gene, complete cds Length = 1300 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 143 atcatactagtcttcttctt 162 |||||||||||||||||||| Sbjct: 36 atcatactagtcttcttctt 17
>gb|AF510467.1| Brassica nigra isolate S110SP COL1 protein (COL1) gene, complete cds Length = 1291 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 143 atcatactagtcttcttctt 162 |||||||||||||||||||| Sbjct: 36 atcatactagtcttcttctt 17
>gb|AF510466.1| Brassica nigra isolate S13PO COL1 protein (COL1) gene, complete cds Length = 1282 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 143 atcatactagtcttcttctt 162 |||||||||||||||||||| Sbjct: 36 atcatactagtcttcttctt 17
>gb|AF510465.1| Brassica nigra isolate S158GE COL1 protein (COL1) gene, complete cds Length = 1282 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 143 atcatactagtcttcttctt 162 |||||||||||||||||||| Sbjct: 36 atcatactagtcttcttctt 17
>gb|AF510464.1| Brassica nigra isolate S170GE COL1 protein (COL1) gene, complete cds Length = 1282 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 143 atcatactagtcttcttctt 162 |||||||||||||||||||| Sbjct: 36 atcatactagtcttcttctt 17
>gb|AF510463.1| Brassica nigra isolate S209ET COL1 protein (COL1) gene, complete cds Length = 1291 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 143 atcatactagtcttcttctt 162 |||||||||||||||||||| Sbjct: 36 atcatactagtcttcttctt 17
>gb|AF510462.1| Brassica nigra isolate S210ET COL1 protein (COL1) gene, complete cds Length = 1291 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 143 atcatactagtcttcttctt 162 |||||||||||||||||||| Sbjct: 36 atcatactagtcttcttctt 17
>gb|AF510461.1| Brassica nigra isolate S215ET COL1 protein (COL1) gene, complete cds Length = 1291 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 143 atcatactagtcttcttctt 162 |||||||||||||||||||| Sbjct: 36 atcatactagtcttcttctt 17
>gb|AF510460.1| Brassica nigra isolate S216ET COL1 protein (COL1) gene, complete cds Length = 1291 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 143 atcatactagtcttcttctt 162 |||||||||||||||||||| Sbjct: 36 atcatactagtcttcttctt 17
>gb|AF510459.1| Brassica nigra isolate S6PO COL1 protein (COL1) gene, complete cds Length = 1284 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 143 atcatactagtcttcttctt 162 |||||||||||||||||||| Sbjct: 36 atcatactagtcttcttctt 17
>gb|AF510458.1| Brassica nigra isolate S60SM COL1 protein (COL1) gene, complete cds Length = 1282 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 143 atcatactagtcttcttctt 162 |||||||||||||||||||| Sbjct: 36 atcatactagtcttcttctt 17
>gb|AF510457.1| Brassica nigra isolate S67SM COL1 protein (COL1) gene, complete cds Length = 1284 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 143 atcatactagtcttcttctt 162 |||||||||||||||||||| Sbjct: 36 atcatactagtcttcttctt 17
>gb|AF510456.1| Brassica nigra isolate 258SI COL1 protein (COL1) gene, complete cds Length = 1282 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 143 atcatactagtcttcttctt 162 |||||||||||||||||||| Sbjct: 36 atcatactagtcttcttctt 17
>gb|AF510455.1| Brassica nigra isolate 24SPA COL1 protein (COL1) gene, complete cds Length = 1300 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 143 atcatactagtcttcttctt 162 |||||||||||||||||||| Sbjct: 36 atcatactagtcttcttctt 17
>gb|AF510454.1| Brassica nigra isolate S182GE COL1 protein (COL1) gene, complete cds Length = 1300 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 143 atcatactagtcttcttctt 162 |||||||||||||||||||| Sbjct: 36 atcatactagtcttcttctt 17
>gb|AF510453.1| Brassica nigra isolate 27SPA COL1 protein (COL1) gene, complete cds Length = 1300 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 143 atcatactagtcttcttctt 162 |||||||||||||||||||| Sbjct: 36 atcatactagtcttcttctt 17
>gb|AF510452.1| Brassica nigra isolate S53SM COL1 protein (COL1) gene, complete cds Length = 1300 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 143 atcatactagtcttcttctt 162 |||||||||||||||||||| Sbjct: 36 atcatactagtcttcttctt 17
>gb|AF510451.1| Brassica nigra isolate 83GE COL1 protein (COL1) gene, complete cds Length = 1300 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 143 atcatactagtcttcttctt 162 |||||||||||||||||||| Sbjct: 36 atcatactagtcttcttctt 17
>gb|AF510450.1| Brassica nigra isolate 38SPA COL1 protein (COL1) gene, complete cds Length = 1300 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 143 atcatactagtcttcttctt 162 |||||||||||||||||||| Sbjct: 36 atcatactagtcttcttctt 17
>gb|AF510449.1| Brassica nigra isolate S178GE COL1 protein (COL1) gene, complete cds Length = 1300 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 143 atcatactagtcttcttctt 162 |||||||||||||||||||| Sbjct: 36 atcatactagtcttcttctt 17
>gb|AC022121.6| Homo sapiens chromosome 5 clone CTD-2007H13, complete sequence Length = 219258 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 11 aagcttttttctttaagaaa 30 |||||||||||||||||||| Sbjct: 16036 aagcttttttctttaagaaa 16017
>gb|AC008522.6| Homo sapiens chromosome 5 clone CTC-463N11, complete sequence Length = 164462 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 11 aagcttttttctttaagaaa 30 |||||||||||||||||||| Sbjct: 145105 aagcttttttctttaagaaa 145086
>gb|AF269128.1|AF269128 Brassica nigra constans-like protein gene, complete cds Length = 1387 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 143 atcatactagtcttcttctt 162 |||||||||||||||||||| Sbjct: 90 atcatactagtcttcttctt 71
>gb|AC009526.4|AC009526 Arabidopsis thaliana chromosome I BAC F2J6 genomic sequence, complete sequence Length = 108061 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 152 gtcttcttcttcctccgacc 171 |||||||||||||||||||| Sbjct: 106866 gtcttcttcttcctccgacc 106885
>gb|AC006423.7|AC006423 Arabidopsis thaliana chromosome I BAC F28H19 genomic sequence, complete sequence Length = 131692 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 152 gtcttcttcttcctccgacc 171 |||||||||||||||||||| Sbjct: 24827 gtcttcttcttcctccgacc 24846
>dbj|AB025632.1| Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MQJ2 Length = 51440 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 ttttttctttaagaaagaca 34 |||||||||||||||||||| Sbjct: 4913 ttttttctttaagaaagaca 4932
>gb|AC140070.3| Mus musculus BAC clone RP24-161L16 from 9, complete sequence Length = 168604 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 200 actgaacatcaagaagttga 219 |||||||||||||||||||| Sbjct: 142345 actgaacatcaagaagttga 142364
>gb|AC164373.4| Mus musculus chromosome 1, clone RP23-36O22, complete sequence Length = 171278 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 26 agaaagacacccaaagggca 45 |||||||||||||||||||| Sbjct: 99571 agaaagacacccaaagggca 99552
>gb|AE000657.1| Aquifex aeolicus VF5, complete genome Length = 1551335 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 17 ttttctttaagaaagacacc 36 |||||||||||||||||||| Sbjct: 851852 ttttctttaagaaagacacc 851833
>gb|AC123878.4| Mus musculus BAC clone RP23-318I20 from 3, complete sequence Length = 215121 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 73 acagccagccagtacagtag 92 |||||||||||||||||||| Sbjct: 11444 acagccagccagtacagtag 11425
>emb|AL663068.12| Mouse DNA sequence from clone RP23-30J5 on chromosome X, complete sequence Length = 225435 Score = 40.1 bits (20), Expect = 3.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 206 catcaagaagttgacaacgaataa 229 ||||||||||||||| |||||||| Sbjct: 96525 catcaagaagttgaccacgaataa 96502 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 4,519,347 Number of Sequences: 3902068 Number of extensions: 4519347 Number of successful extensions: 105202 Number of sequences better than 10.0: 61 Number of HSP's better than 10.0 without gapping: 61 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 105104 Number of HSP's gapped (non-prelim): 98 length of query: 283 length of database: 17,233,045,268 effective HSP length: 22 effective length of query: 261 effective length of database: 17,147,199,772 effective search space: 4475419140492 effective search space used: 4475419140492 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)