ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbastl25h07
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1gb|AC007504.3| Arabidopsis thaliana chromosome I BAC F13F21 geno... 42 0.93
2emb|AL353013.1|ATT24H18 Arabidopsis thaliana DNA chromosome 5, B... 42 0.93
3gb|AC147234.3| Mus musculus BAC clone RP24-500F11 from chromosom... 40 3.7
4gb|AC161056.5| Mus musculus BAC clone RP23-241J7 from chromosome... 40 3.7
5ref|XR_003254.1| PREDICTED: Mus musculus similar to 40S ribosoma... 40 3.7
6gb|AC122211.4| Mus musculus BAC clone RP23-97F18 from chromosome... 40 3.7
7emb|Z81505.2|CEF16A11 Caenorhabditis elegans Cosmid F16A11, comp... 40 3.7
8gb|AC008071.2| Homo sapiens BAC clone RP11-388L11 from 7, comple... 40 3.7
9emb|AL158048.35| Human DNA sequence from clone RP5-963K15 on chr... 40 3.7
10emb|Y16773.1|LEAPX Lycopersicaon esculentum APX gene, complete CDS 40 3.7
11gb|AF510489.1| Brassica nigra isolate 173ET COL1 protein (COL1) ... 40 3.7
12gb|AF510488.1| Brassica nigra isolate 176ET COL1 protein (COL1) ... 40 3.7
13gb|AF510487.1| Brassica nigra isolate 179ET COL1 protein (COL1) ... 40 3.7
14gb|AF510486.1| Brassica nigra isolate 180ET COL1 protein (COL1) ... 40 3.7
15gb|AF510485.1| Brassica nigra isolate 182ET COL1 protein (COL1) ... 40 3.7
16gb|AF510484.1| Brassica nigra isolate 183ET COL1 protein (COL1) ... 40 3.7
17gb|AF510483.1| Brassica nigra isolate 185ET COL1 protein (COL1) ... 40 3.7
18gb|AF510482.1| Brassica nigra isolate 186ET COL1 protein (COL1) ... 40 3.7
19gb|AF510481.1| Brassica nigra isolate 54GE COL1 protein (COL1) g... 40 3.7
20gb|AF510480.1| Brassica nigra isolate 64GE COL1 protein (COL1) g... 40 3.7
21gb|AF510479.1| Brassica nigra isolate 68GE COL1 protein (COL1) g... 40 3.7
22gb|AF510478.1| Brassica nigra isolate 69GE COL1 protein (COL1) g... 40 3.7
23gb|AF510477.1| Brassica nigra isolate 70GE COL1 protein (COL1) g... 40 3.7
24gb|AF510475.1| Brassica nigra isolate 72GE COL1 protein (COL1) g... 40 3.7
25gb|AF510474.1| Brassica nigra isolate 272SI COL1 protein (COL1) ... 40 3.7
26gb|AF510473.1| Brassica nigra isolate 273SI COL1 protein (COL1) ... 40 3.7
27gb|AF510472.1| Brassica nigra isolate 274SI COL1 protein (COL1) ... 40 3.7
28gb|AF510471.1| Brassica nigra isolate 275SI COL1 protein (COL1) ... 40 3.7
29gb|AF510470.1| Brassica nigra isolate S1PO COL1 protein (COL1) g... 40 3.7
30gb|AF510469.1| Brassica nigra isolate 260SI COL1 protein (COL1) ... 40 3.7
31gb|AF510468.1| Brassica nigra isolate S105SP COL1 protein (COL1)... 40 3.7
32gb|AF510467.1| Brassica nigra isolate S110SP COL1 protein (COL1)... 40 3.7
33gb|AF510466.1| Brassica nigra isolate S13PO COL1 protein (COL1) ... 40 3.7
34gb|AF510465.1| Brassica nigra isolate S158GE COL1 protein (COL1)... 40 3.7
35gb|AF510464.1| Brassica nigra isolate S170GE COL1 protein (COL1)... 40 3.7
36gb|AF510463.1| Brassica nigra isolate S209ET COL1 protein (COL1)... 40 3.7
37gb|AF510462.1| Brassica nigra isolate S210ET COL1 protein (COL1)... 40 3.7
38gb|AF510461.1| Brassica nigra isolate S215ET COL1 protein (COL1)... 40 3.7
39gb|AF510460.1| Brassica nigra isolate S216ET COL1 protein (COL1)... 40 3.7
40gb|AF510459.1| Brassica nigra isolate S6PO COL1 protein (COL1) g... 40 3.7
41gb|AF510458.1| Brassica nigra isolate S60SM COL1 protein (COL1) ... 40 3.7
42gb|AF510457.1| Brassica nigra isolate S67SM COL1 protein (COL1) ... 40 3.7
43gb|AF510456.1| Brassica nigra isolate 258SI COL1 protein (COL1) ... 40 3.7
44gb|AF510455.1| Brassica nigra isolate 24SPA COL1 protein (COL1) ... 40 3.7
45gb|AF510454.1| Brassica nigra isolate S182GE COL1 protein (COL1)... 40 3.7
46gb|AF510453.1| Brassica nigra isolate 27SPA COL1 protein (COL1) ... 40 3.7
47gb|AF510452.1| Brassica nigra isolate S53SM COL1 protein (COL1) ... 40 3.7
48gb|AF510451.1| Brassica nigra isolate 83GE COL1 protein (COL1) g... 40 3.7
49gb|AF510450.1| Brassica nigra isolate 38SPA COL1 protein (COL1) ... 40 3.7
50gb|AF510449.1| Brassica nigra isolate S178GE COL1 protein (COL1)... 40 3.7
51gb|AC022121.6| Homo sapiens chromosome 5 clone CTD-2007H13, comp... 40 3.7
52gb|AC008522.6| Homo sapiens chromosome 5 clone CTC-463N11, compl... 40 3.7
53gb|AF269128.1|AF269128 Brassica nigra constans-like protein gene... 40 3.7
54gb|AC009526.4|AC009526 Arabidopsis thaliana chromosome I BAC F2J... 40 3.7
55gb|AC006423.7|AC006423 Arabidopsis thaliana chromosome I BAC F28... 40 3.7
56dbj|AB025632.1| Arabidopsis thaliana genomic DNA, chromosome 5, ... 40 3.7
57gb|AC140070.3| Mus musculus BAC clone RP24-161L16 from 9, comple... 40 3.7
58gb|AC164373.4| Mus musculus chromosome 1, clone RP23-36O22, comp... 40 3.7
59gb|AE000657.1| Aquifex aeolicus VF5, complete genome 40 3.7
60gb|AC123878.4| Mus musculus BAC clone RP23-318I20 from 3, comple... 40 3.7
61emb|AL663068.12| Mouse DNA sequence from clone RP23-30J5 on chro... 40 3.7

>gb|AC007504.3| Arabidopsis thaliana chromosome I BAC F13F21 genomic sequence, complete
             sequence
          Length = 125021

 Score = 42.1 bits (21), Expect = 0.93
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 181   ccaccaaagtgaaaatcacac 201
             |||||||||||||||||||||
Sbjct: 72646 ccaccaaagtgaaaatcacac 72666



to top

>emb|AL353013.1|ATT24H18 Arabidopsis thaliana DNA chromosome 5, BAC clone T24H18 (ESSA project)
          Length = 90020

 Score = 42.1 bits (21), Expect = 0.93
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 181   ccaccaaagtgaaaatcacac 201
             |||||||||||||||||||||
Sbjct: 49042 ccaccaaagtgaaaatcacac 49022



to top

>gb|AC147234.3| Mus musculus BAC clone RP24-500F11 from chromosome 18, complete
             sequence
          Length = 189846

 Score = 40.1 bits (20), Expect = 3.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 10    aaagcttttttctttaagaa 29
             ||||||||||||||||||||
Sbjct: 57204 aaagcttttttctttaagaa 57185



to top

>gb|AC161056.5| Mus musculus BAC clone RP23-241J7 from chromosome 3, complete sequence
          Length = 226878

 Score = 40.1 bits (20), Expect = 3.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 73     acagccagccagtacagtag 92
              ||||||||||||||||||||
Sbjct: 195786 acagccagccagtacagtag 195805



to top

>ref|XR_003254.1| PREDICTED: Mus musculus similar to 40S ribosomal protein SA (p40)
           (34/67 kDa laminin receptor) (LOC436243), mRNA
          Length = 1023

 Score = 40.1 bits (20), Expect = 3.7
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 206 catcaagaagttgacaacgaataa 229
           ||||||||||||||| ||||||||
Sbjct: 102 catcaagaagttgaccacgaataa 79



to top

>gb|AC122211.4| Mus musculus BAC clone RP23-97F18 from chromosome 18, complete sequence
          Length = 186451

 Score = 40.1 bits (20), Expect = 3.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 10    aaagcttttttctttaagaa 29
             ||||||||||||||||||||
Sbjct: 60253 aaagcttttttctttaagaa 60272



to top

>emb|Z81505.2|CEF16A11 Caenorhabditis elegans Cosmid F16A11, complete sequence
          Length = 30626

 Score = 40.1 bits (20), Expect = 3.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 153  tcttcttcttcctccgaccg 172
            ||||||||||||||||||||
Sbjct: 8392 tcttcttcttcctccgaccg 8411



to top

>gb|AC008071.2| Homo sapiens BAC clone RP11-388L11 from 7, complete sequence
          Length = 129938

 Score = 40.1 bits (20), Expect = 3.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 258   atcttctgctactgttgaaagaaa 281
             ||||| ||||||||||||||||||
Sbjct: 11232 atcttttgctactgttgaaagaaa 11255



to top

>emb|AL158048.35| Human DNA sequence from clone RP5-963K15 on chromosome 1p36.21-36.33
             Contains the SLC2A5 gene for solute carrier family 2
             (facilitated glucose/fructose transporter) member 5, two
             novel genes and two CpG islands, complete sequence
          Length = 139111

 Score = 40.1 bits (20), Expect = 3.7
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 25    aagaaagacacccaaagggcatct 48
             ||||||||||| ||||||||||||
Sbjct: 24663 aagaaagacacacaaagggcatct 24640



to top

>emb|Y16773.1|LEAPX Lycopersicaon esculentum APX gene, complete CDS
          Length = 4460

 Score = 40.1 bits (20), Expect = 3.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 227  taaattttcaattttggcct 246
            ||||||||||||||||||||
Sbjct: 1886 taaattttcaattttggcct 1905



to top

>gb|AF510489.1| Brassica nigra isolate 173ET COL1 protein (COL1) gene, complete cds
          Length = 1291

 Score = 40.1 bits (20), Expect = 3.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 143 atcatactagtcttcttctt 162
           ||||||||||||||||||||
Sbjct: 36  atcatactagtcttcttctt 17



to top

>gb|AF510488.1| Brassica nigra isolate 176ET COL1 protein (COL1) gene, complete cds
          Length = 1291

 Score = 40.1 bits (20), Expect = 3.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 143 atcatactagtcttcttctt 162
           ||||||||||||||||||||
Sbjct: 36  atcatactagtcttcttctt 17



to top

>gb|AF510487.1| Brassica nigra isolate 179ET COL1 protein (COL1) gene, complete cds
          Length = 1291

 Score = 40.1 bits (20), Expect = 3.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 143 atcatactagtcttcttctt 162
           ||||||||||||||||||||
Sbjct: 36  atcatactagtcttcttctt 17



to top

>gb|AF510486.1| Brassica nigra isolate 180ET COL1 protein (COL1) gene, complete cds
          Length = 1291

 Score = 40.1 bits (20), Expect = 3.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 143 atcatactagtcttcttctt 162
           ||||||||||||||||||||
Sbjct: 36  atcatactagtcttcttctt 17



to top

>gb|AF510485.1| Brassica nigra isolate 182ET COL1 protein (COL1) gene, complete cds
          Length = 1291

 Score = 40.1 bits (20), Expect = 3.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 143 atcatactagtcttcttctt 162
           ||||||||||||||||||||
Sbjct: 36  atcatactagtcttcttctt 17



to top

>gb|AF510484.1| Brassica nigra isolate 183ET COL1 protein (COL1) gene, complete cds
          Length = 1291

 Score = 40.1 bits (20), Expect = 3.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 143 atcatactagtcttcttctt 162
           ||||||||||||||||||||
Sbjct: 36  atcatactagtcttcttctt 17



to top

>gb|AF510483.1| Brassica nigra isolate 185ET COL1 protein (COL1) gene, complete cds
          Length = 1291

 Score = 40.1 bits (20), Expect = 3.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 143 atcatactagtcttcttctt 162
           ||||||||||||||||||||
Sbjct: 36  atcatactagtcttcttctt 17



to top

>gb|AF510482.1| Brassica nigra isolate 186ET COL1 protein (COL1) gene, complete cds
          Length = 1291

 Score = 40.1 bits (20), Expect = 3.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 143 atcatactagtcttcttctt 162
           ||||||||||||||||||||
Sbjct: 36  atcatactagtcttcttctt 17



to top

>gb|AF510481.1| Brassica nigra isolate 54GE COL1 protein (COL1) gene, complete cds
          Length = 1282

 Score = 40.1 bits (20), Expect = 3.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 143 atcatactagtcttcttctt 162
           ||||||||||||||||||||
Sbjct: 36  atcatactagtcttcttctt 17



to top

>gb|AF510480.1| Brassica nigra isolate 64GE COL1 protein (COL1) gene, complete cds
          Length = 1282

 Score = 40.1 bits (20), Expect = 3.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 143 atcatactagtcttcttctt 162
           ||||||||||||||||||||
Sbjct: 36  atcatactagtcttcttctt 17



to top

>gb|AF510479.1| Brassica nigra isolate 68GE COL1 protein (COL1) gene, complete cds
          Length = 1282

 Score = 40.1 bits (20), Expect = 3.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 143 atcatactagtcttcttctt 162
           ||||||||||||||||||||
Sbjct: 36  atcatactagtcttcttctt 17



to top

>gb|AF510478.1| Brassica nigra isolate 69GE COL1 protein (COL1) gene, complete cds
          Length = 1282

 Score = 40.1 bits (20), Expect = 3.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 143 atcatactagtcttcttctt 162
           ||||||||||||||||||||
Sbjct: 36  atcatactagtcttcttctt 17



to top

>gb|AF510477.1| Brassica nigra isolate 70GE COL1 protein (COL1) gene, complete cds
          Length = 1282

 Score = 40.1 bits (20), Expect = 3.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 143 atcatactagtcttcttctt 162
           ||||||||||||||||||||
Sbjct: 36  atcatactagtcttcttctt 17



to top

>gb|AF510475.1| Brassica nigra isolate 72GE COL1 protein (COL1) gene, complete cds
          Length = 1282

 Score = 40.1 bits (20), Expect = 3.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 143 atcatactagtcttcttctt 162
           ||||||||||||||||||||
Sbjct: 36  atcatactagtcttcttctt 17



to top

>gb|AF510474.1| Brassica nigra isolate 272SI COL1 protein (COL1) gene, complete cds
          Length = 1282

 Score = 40.1 bits (20), Expect = 3.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 143 atcatactagtcttcttctt 162
           ||||||||||||||||||||
Sbjct: 36  atcatactagtcttcttctt 17



to top

>gb|AF510473.1| Brassica nigra isolate 273SI COL1 protein (COL1) gene, complete cds
          Length = 1282

 Score = 40.1 bits (20), Expect = 3.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 143 atcatactagtcttcttctt 162
           ||||||||||||||||||||
Sbjct: 36  atcatactagtcttcttctt 17



to top

>gb|AF510472.1| Brassica nigra isolate 274SI COL1 protein (COL1) gene, complete cds
          Length = 1288

 Score = 40.1 bits (20), Expect = 3.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 143 atcatactagtcttcttctt 162
           ||||||||||||||||||||
Sbjct: 36  atcatactagtcttcttctt 17



to top

>gb|AF510471.1| Brassica nigra isolate 275SI COL1 protein (COL1) gene, complete cds
          Length = 1282

 Score = 40.1 bits (20), Expect = 3.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 143 atcatactagtcttcttctt 162
           ||||||||||||||||||||
Sbjct: 36  atcatactagtcttcttctt 17



to top

>gb|AF510470.1| Brassica nigra isolate S1PO COL1 protein (COL1) gene, complete cds
          Length = 1282

 Score = 40.1 bits (20), Expect = 3.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 143 atcatactagtcttcttctt 162
           ||||||||||||||||||||
Sbjct: 36  atcatactagtcttcttctt 17



to top

>gb|AF510469.1| Brassica nigra isolate 260SI COL1 protein (COL1) gene, complete cds
          Length = 1300

 Score = 40.1 bits (20), Expect = 3.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 143 atcatactagtcttcttctt 162
           ||||||||||||||||||||
Sbjct: 36  atcatactagtcttcttctt 17



to top

>gb|AF510468.1| Brassica nigra isolate S105SP COL1 protein (COL1) gene, complete
           cds
          Length = 1300

 Score = 40.1 bits (20), Expect = 3.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 143 atcatactagtcttcttctt 162
           ||||||||||||||||||||
Sbjct: 36  atcatactagtcttcttctt 17



to top

>gb|AF510467.1| Brassica nigra isolate S110SP COL1 protein (COL1) gene, complete
           cds
          Length = 1291

 Score = 40.1 bits (20), Expect = 3.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 143 atcatactagtcttcttctt 162
           ||||||||||||||||||||
Sbjct: 36  atcatactagtcttcttctt 17



to top

>gb|AF510466.1| Brassica nigra isolate S13PO COL1 protein (COL1) gene, complete cds
          Length = 1282

 Score = 40.1 bits (20), Expect = 3.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 143 atcatactagtcttcttctt 162
           ||||||||||||||||||||
Sbjct: 36  atcatactagtcttcttctt 17



to top

>gb|AF510465.1| Brassica nigra isolate S158GE COL1 protein (COL1) gene, complete
           cds
          Length = 1282

 Score = 40.1 bits (20), Expect = 3.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 143 atcatactagtcttcttctt 162
           ||||||||||||||||||||
Sbjct: 36  atcatactagtcttcttctt 17



to top

>gb|AF510464.1| Brassica nigra isolate S170GE COL1 protein (COL1) gene, complete
           cds
          Length = 1282

 Score = 40.1 bits (20), Expect = 3.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 143 atcatactagtcttcttctt 162
           ||||||||||||||||||||
Sbjct: 36  atcatactagtcttcttctt 17



to top

>gb|AF510463.1| Brassica nigra isolate S209ET COL1 protein (COL1) gene, complete
           cds
          Length = 1291

 Score = 40.1 bits (20), Expect = 3.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 143 atcatactagtcttcttctt 162
           ||||||||||||||||||||
Sbjct: 36  atcatactagtcttcttctt 17



to top

>gb|AF510462.1| Brassica nigra isolate S210ET COL1 protein (COL1) gene, complete
           cds
          Length = 1291

 Score = 40.1 bits (20), Expect = 3.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 143 atcatactagtcttcttctt 162
           ||||||||||||||||||||
Sbjct: 36  atcatactagtcttcttctt 17



to top

>gb|AF510461.1| Brassica nigra isolate S215ET COL1 protein (COL1) gene, complete
           cds
          Length = 1291

 Score = 40.1 bits (20), Expect = 3.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 143 atcatactagtcttcttctt 162
           ||||||||||||||||||||
Sbjct: 36  atcatactagtcttcttctt 17



to top

>gb|AF510460.1| Brassica nigra isolate S216ET COL1 protein (COL1) gene, complete
           cds
          Length = 1291

 Score = 40.1 bits (20), Expect = 3.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 143 atcatactagtcttcttctt 162
           ||||||||||||||||||||
Sbjct: 36  atcatactagtcttcttctt 17



to top

>gb|AF510459.1| Brassica nigra isolate S6PO COL1 protein (COL1) gene, complete cds
          Length = 1284

 Score = 40.1 bits (20), Expect = 3.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 143 atcatactagtcttcttctt 162
           ||||||||||||||||||||
Sbjct: 36  atcatactagtcttcttctt 17



to top

>gb|AF510458.1| Brassica nigra isolate S60SM COL1 protein (COL1) gene, complete cds
          Length = 1282

 Score = 40.1 bits (20), Expect = 3.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 143 atcatactagtcttcttctt 162
           ||||||||||||||||||||
Sbjct: 36  atcatactagtcttcttctt 17



to top

>gb|AF510457.1| Brassica nigra isolate S67SM COL1 protein (COL1) gene, complete cds
          Length = 1284

 Score = 40.1 bits (20), Expect = 3.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 143 atcatactagtcttcttctt 162
           ||||||||||||||||||||
Sbjct: 36  atcatactagtcttcttctt 17



to top

>gb|AF510456.1| Brassica nigra isolate 258SI COL1 protein (COL1) gene, complete cds
          Length = 1282

 Score = 40.1 bits (20), Expect = 3.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 143 atcatactagtcttcttctt 162
           ||||||||||||||||||||
Sbjct: 36  atcatactagtcttcttctt 17



to top

>gb|AF510455.1| Brassica nigra isolate 24SPA COL1 protein (COL1) gene, complete cds
          Length = 1300

 Score = 40.1 bits (20), Expect = 3.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 143 atcatactagtcttcttctt 162
           ||||||||||||||||||||
Sbjct: 36  atcatactagtcttcttctt 17



to top

>gb|AF510454.1| Brassica nigra isolate S182GE COL1 protein (COL1) gene, complete
           cds
          Length = 1300

 Score = 40.1 bits (20), Expect = 3.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 143 atcatactagtcttcttctt 162
           ||||||||||||||||||||
Sbjct: 36  atcatactagtcttcttctt 17



to top

>gb|AF510453.1| Brassica nigra isolate 27SPA COL1 protein (COL1) gene, complete cds
          Length = 1300

 Score = 40.1 bits (20), Expect = 3.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 143 atcatactagtcttcttctt 162
           ||||||||||||||||||||
Sbjct: 36  atcatactagtcttcttctt 17



to top

>gb|AF510452.1| Brassica nigra isolate S53SM COL1 protein (COL1) gene, complete cds
          Length = 1300

 Score = 40.1 bits (20), Expect = 3.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 143 atcatactagtcttcttctt 162
           ||||||||||||||||||||
Sbjct: 36  atcatactagtcttcttctt 17



to top

>gb|AF510451.1| Brassica nigra isolate 83GE COL1 protein (COL1) gene, complete cds
          Length = 1300

 Score = 40.1 bits (20), Expect = 3.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 143 atcatactagtcttcttctt 162
           ||||||||||||||||||||
Sbjct: 36  atcatactagtcttcttctt 17



to top

>gb|AF510450.1| Brassica nigra isolate 38SPA COL1 protein (COL1) gene, complete cds
          Length = 1300

 Score = 40.1 bits (20), Expect = 3.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 143 atcatactagtcttcttctt 162
           ||||||||||||||||||||
Sbjct: 36  atcatactagtcttcttctt 17



to top

>gb|AF510449.1| Brassica nigra isolate S178GE COL1 protein (COL1) gene, complete
           cds
          Length = 1300

 Score = 40.1 bits (20), Expect = 3.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 143 atcatactagtcttcttctt 162
           ||||||||||||||||||||
Sbjct: 36  atcatactagtcttcttctt 17



to top

>gb|AC022121.6| Homo sapiens chromosome 5 clone CTD-2007H13, complete sequence
          Length = 219258

 Score = 40.1 bits (20), Expect = 3.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 11    aagcttttttctttaagaaa 30
             ||||||||||||||||||||
Sbjct: 16036 aagcttttttctttaagaaa 16017



to top

>gb|AC008522.6| Homo sapiens chromosome 5 clone CTC-463N11, complete sequence
          Length = 164462

 Score = 40.1 bits (20), Expect = 3.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 11     aagcttttttctttaagaaa 30
              ||||||||||||||||||||
Sbjct: 145105 aagcttttttctttaagaaa 145086



to top

>gb|AF269128.1|AF269128 Brassica nigra constans-like protein gene, complete cds
          Length = 1387

 Score = 40.1 bits (20), Expect = 3.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 143 atcatactagtcttcttctt 162
           ||||||||||||||||||||
Sbjct: 90  atcatactagtcttcttctt 71



to top

>gb|AC009526.4|AC009526 Arabidopsis thaliana chromosome I BAC F2J6 genomic sequence, complete
              sequence
          Length = 108061

 Score = 40.1 bits (20), Expect = 3.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 152    gtcttcttcttcctccgacc 171
              ||||||||||||||||||||
Sbjct: 106866 gtcttcttcttcctccgacc 106885



to top

>gb|AC006423.7|AC006423 Arabidopsis thaliana chromosome I BAC F28H19 genomic sequence, complete
             sequence
          Length = 131692

 Score = 40.1 bits (20), Expect = 3.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 152   gtcttcttcttcctccgacc 171
             ||||||||||||||||||||
Sbjct: 24827 gtcttcttcttcctccgacc 24846



to top

>dbj|AB025632.1| Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MQJ2
          Length = 51440

 Score = 40.1 bits (20), Expect = 3.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 15   ttttttctttaagaaagaca 34
            ||||||||||||||||||||
Sbjct: 4913 ttttttctttaagaaagaca 4932



to top

>gb|AC140070.3| Mus musculus BAC clone RP24-161L16 from 9, complete sequence
          Length = 168604

 Score = 40.1 bits (20), Expect = 3.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 200    actgaacatcaagaagttga 219
              ||||||||||||||||||||
Sbjct: 142345 actgaacatcaagaagttga 142364



to top

>gb|AC164373.4| Mus musculus chromosome 1, clone RP23-36O22, complete sequence
          Length = 171278

 Score = 40.1 bits (20), Expect = 3.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 26    agaaagacacccaaagggca 45
             ||||||||||||||||||||
Sbjct: 99571 agaaagacacccaaagggca 99552



to top

>gb|AE000657.1| Aquifex aeolicus VF5, complete genome
          Length = 1551335

 Score = 40.1 bits (20), Expect = 3.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 17     ttttctttaagaaagacacc 36
              ||||||||||||||||||||
Sbjct: 851852 ttttctttaagaaagacacc 851833



to top

>gb|AC123878.4| Mus musculus BAC clone RP23-318I20 from 3, complete sequence
          Length = 215121

 Score = 40.1 bits (20), Expect = 3.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 73    acagccagccagtacagtag 92
             ||||||||||||||||||||
Sbjct: 11444 acagccagccagtacagtag 11425



to top

>emb|AL663068.12| Mouse DNA sequence from clone RP23-30J5 on chromosome X, complete
             sequence
          Length = 225435

 Score = 40.1 bits (20), Expect = 3.7
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 206   catcaagaagttgacaacgaataa 229
             ||||||||||||||| ||||||||
Sbjct: 96525 catcaagaagttgaccacgaataa 96502


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 4,519,347
Number of Sequences: 3902068
Number of extensions: 4519347
Number of successful extensions: 105202
Number of sequences better than 10.0: 61
Number of HSP's better than 10.0 without gapping: 61
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 105104
Number of HSP's gapped (non-prelim): 98
length of query: 283
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 261
effective length of database: 17,147,199,772
effective search space: 4475419140492
effective search space used: 4475419140492
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top