ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbastl25f03
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1gb|DQ355219.1| Thinopyrum bessarabicum plastid acetyl-CoA carbox... 54 4e-04
2ref|NM_190637.1| Oryza sativa (japonica cultivar-group), predic... 44 0.36
3emb|AL929211.19| Mouse DNA sequence from clone RP23-323P11 on ch... 44 0.36
4dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic D... 44 0.36
5dbj|AP004072.2| Oryza sativa (japonica cultivar-group) genomic D... 44 0.36
6dbj|AP003279.2| Oryza sativa (japonica cultivar-group) genomic D... 44 0.36
7gb|AC115011.27| Mus musculus chromosome 1, clone RP24-192A11, co... 42 1.4
8gb|BC061635.1| Mus musculus serine/threonine kinase 11 interacti... 42 1.4
9gb|BC035530.1| Mus musculus serine/threonine kinase 11 interacti... 42 1.4
10gb|BC042403.1| Mus musculus serine/threonine kinase 11 interacti... 42 1.4
11gb|AC127226.3| Mus musculus BAC clone RP24-500I10 from chromosom... 42 1.4
12dbj|AK156122.1| Mus musculus activated spleen cDNA, RIKEN full-l... 42 1.4
13ref|NM_027886.2| Mus musculus serine/threonine kinase 11 interac... 42 1.4
14dbj|AK171989.1| Mus musculus activated spleen cDNA, RIKEN full-l... 42 1.4
15dbj|AK165911.1| Mus musculus lung RCB-0558 LLC cDNA, RIKEN full-... 42 1.4
16dbj|AK004757.2| Mus musculus adult male lung cDNA, RIKEN full-le... 42 1.4
17dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic D... 42 1.4
18dbj|AP006454.3| Oryza sativa (japonica cultivar-group) genomic D... 42 1.4
19gb|AC102751.14| Mus musculus chromosome 19, clone RP24-531N3, co... 40 5.6
20gb|AC126549.4| Mus musculus BAC clone RP24-326I12 from chromosom... 40 5.6
21emb|Z78205.1|BHT1UL Bovine herpesvirus type 1 UL22-35 genes 40 5.6
22emb|AJ004801.1|BHV1CGEN Bovine herpesvirus type 1.1 complete genome 40 5.6
23ref|XM_742671.1| Aspergillus fumigatus Af293 hypothetical protei... 40 5.6
24gb|AC018712.5| Homo sapiens BAC clone RP11-343H10 from 2, comple... 40 5.6
25gb|AC122836.4| Mus musculus BAC clone RP23-188B13 from 7, comple... 40 5.6
26ref|XM_758622.1| Theileria parva strain Muguga chromosome 4 hypo... 40 5.6
27emb|AL645608.30| Human DNA sequence from clone RP11-54O7 on chro... 40 5.6
28emb|AL390719.47| Human DNA sequence from clone RP11-465B22 on ch... 40 5.6
29gb|CP000270.1| Burkholderia xenovorans LB400 chromosome 1, compl... 40 5.6
30emb|AL031003.1|HS422G23 Human DNA sequence from clone RP3-422G23... 40 5.6
31emb|AL022148.1|HS435A7 Human DNA sequence from clone RP3-435A7 o... 40 5.6
32emb|X82596.1|RLAAPJQMP R.leguminosarum aapJ, Q, M, P genes and ORF5 40 5.6
33emb|AJ849797.1| Drosophila madeirensis partial abd-A gene for ab... 40 5.6
34emb|AJ849796.1| Drosophila subobscura partial abd-A gene for abd... 40 5.6
35emb|AJ849795.1| Drosophila subobscura partial abd-A gene for abd... 40 5.6
36emb|AJ849794.1| Drosophila subobscura partial abd-A gene for abd... 40 5.6
37emb|AJ849793.1| Drosophila subobscura partial abd-A gene for abd... 40 5.6
38emb|AJ849792.1| Drosophila subobscura partial abd-A gene for abd... 40 5.6
39emb|AJ849791.1| Drosophila subobscura partial abd-A gene for abd... 40 5.6
40emb|AJ849790.1| Drosophila subobscura partial abd-A gene for abd... 40 5.6
41emb|AJ849789.1| Drosophila subobscura partial abd-A gene for abd... 40 5.6
42emb|AJ849788.1| Drosophila subobscura partial abd-A gene for abd... 40 5.6
43emb|AJ849787.1| Drosophila subobscura partial abd-A gene for abd... 40 5.6
44emb|AJ849786.1| Drosophila subobscura partial abd-A gene for abd... 40 5.6
45emb|AJ849785.1| Drosophila subobscura partial abd-A gene for abd... 40 5.6
46emb|AJ849784.1| Drosophila subobscura partial abd-A gene for abd... 40 5.6
47emb|AJ849783.1| Drosophila subobscura partial abd-A gene for abd... 40 5.6
48emb|AJ849782.1| Drosophila subobscura partial abd-A gene for abd... 40 5.6
49emb|AJ849780.1| Drosophila subobscura partial abd-A gene for abd... 40 5.6
50emb|AJ849779.1| Drosophila subobscura partial abd-A gene for abd... 40 5.6
51emb|AJ849778.1| Drosophila subobscura partial abd-A gene for abd... 40 5.6
52emb|AJ849777.1| Drosophila subobscura partial abd-A gene for abd... 40 5.6
53emb|AJ849776.1| Drosophila subobscura partial abd-A gene for abd... 40 5.6
54emb|AJ849775.1| Drosophila subobscura partial abd-A gene for abd... 40 5.6
55emb|AJ849774.1| Drosophila subobscura partial abd-A gene for abd... 40 5.6
56emb|AJ849773.1| Drosophila subobscura partial abd-A gene for abd... 40 5.6
57emb|AJ849772.1| Drosophila subobscura partial abd-A gene for abd... 40 5.6
58emb|AJ849771.1| Drosophila subobscura partial abd-A gene for abd... 40 5.6
59emb|AJ849769.1| Drosophila subobscura partial abd-A gene for abd... 40 5.6
60gb|AC102076.9| Mus musculus chromosome 7, clone RP23-401P12, com... 40 5.6
61gb|AY483521.1| HIV-1 isolate 98USP1Neca from USA envelope glycop... 40 5.6
62dbj|AP008229.1| Xanthomonas oryzae pv. oryzae MAFF 311018 DNA, c... 40 5.6
63dbj|AK080903.1| Mus musculus 4 days neonate male adipose cDNA, R... 40 5.6
64dbj|BA000030.2| Streptomyces avermitilis MA-4680 genomic DNA, co... 40 5.6
65dbj|AP002953.2| Oryza sativa (japonica cultivar-group) genomic D... 40 5.6
66emb|X94677.1|BHV1ULGNS Bovine herpesvirus type 1 genes for UL[27... 40 5.6
67emb|AJ272672.1|HIM272672 Human immunodeficiency virus type 1 pro... 40 5.6
68gb|AC154862.2| Mus musculus BAC clone RP23-8G7 from 13, complete... 40 5.6
69gb|AF487716.1| Aphis gossypii 18S ribosomal RNA gene, partial se... 40 5.6
70gb|CP000009.1| Gluconobacter oxydans 621H, complete genome 40 5.6
71dbj|AB209681.1| Homo sapiens mRNA for RAP guanine-nucleotide-exc... 40 5.6

>gb|DQ355219.1| Thinopyrum bessarabicum plastid acetyl-CoA carboxylase gene,
           partial cds; nuclear gene for plastid product
          Length = 1542

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 33/35 (94%)
 Strand = Plus / Plus

                                              
Query: 81  gtttgagcgacggttatttctgaacggaggtagta 115
           ||||||||||| |||||||||| ||||||||||||
Sbjct: 133 gtttgagcgacagttatttctggacggaggtagta 167



to top

>ref|NM_190637.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 345

 Score = 44.1 bits (22), Expect = 0.36
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 285 ggcggcggacacggccgagacg 306
           ||||||||||||||||||||||
Sbjct: 18  ggcggcggacacggccgagacg 39



to top

>emb|AL929211.19| Mouse DNA sequence from clone RP23-323P11 on chromosome 2, complete
             sequence
          Length = 65494

 Score = 44.1 bits (22), Expect = 0.36
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                       
Query: 27    atatgtacatatcctcaaatacacac 52
             |||||||||||| |||||||||||||
Sbjct: 13916 atatgtacatatactcaaatacacac 13941



to top

>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete
                sequence
          Length = 43261740

 Score = 44.1 bits (22), Expect = 0.36
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                      
Query: 285      ggcggcggacacggccgagacg 306
                ||||||||||||||||||||||
Sbjct: 36684954 ggcggcggacacggccgagacg 36684975



 Score = 40.1 bits (20), Expect = 5.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                    
Query: 103      aacggaggtagtacttggaa 122
                ||||||||||||||||||||
Sbjct: 12295180 aacggaggtagtacttggaa 12295161



to top

>dbj|AP004072.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC
              clone:P0529H11
          Length = 165969

 Score = 44.1 bits (22), Expect = 0.36
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 285    ggcggcggacacggccgagacg 306
              ||||||||||||||||||||||
Sbjct: 158220 ggcggcggacacggccgagacg 158241



to top

>dbj|AP003279.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC
             clone:P0529E05
          Length = 134982

 Score = 44.1 bits (22), Expect = 0.36
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 285   ggcggcggacacggccgagacg 306
             ||||||||||||||||||||||
Sbjct: 11269 ggcggcggacacggccgagacg 11290



to top

>gb|AC115011.27| Mus musculus chromosome 1, clone RP24-192A11, complete sequence
          Length = 173802

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 315   gctccagcccaccctggccat 335
             |||||||||||||||||||||
Sbjct: 50559 gctccagcccaccctggccat 50539



to top

>gb|BC061635.1| Mus musculus serine/threonine kinase 11 interacting protein, mRNA
            (cDNA clone MGC:67731 IMAGE:6530178), complete cds
          Length = 4481

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 315  gctccagcccaccctggccat 335
            |||||||||||||||||||||
Sbjct: 2630 gctccagcccaccctggccat 2650



to top

>gb|BC035530.1| Mus musculus serine/threonine kinase 11 interacting protein, mRNA
            (cDNA clone IMAGE:5366096), with apparent retained intron
          Length = 3250

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 315  gctccagcccaccctggccat 335
            |||||||||||||||||||||
Sbjct: 1687 gctccagcccaccctggccat 1707



to top

>gb|BC042403.1| Mus musculus serine/threonine kinase 11 interacting protein, mRNA
            (cDNA clone IMAGE:3156629)
          Length = 4168

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 315  gctccagcccaccctggccat 335
            |||||||||||||||||||||
Sbjct: 2684 gctccagcccaccctggccat 2704



to top

>gb|AC127226.3| Mus musculus BAC clone RP24-500I10 from chromosome 6, complete sequence
          Length = 166743

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 28    tatgtacatatcctcaaatacacac 52
             |||||||||||||||||| ||||||
Sbjct: 76218 tatgtacatatcctcaaacacacac 76242



to top

>dbj|AK156122.1| Mus musculus activated spleen cDNA, RIKEN full-length enriched
            library, clone:F830008I10 product:serine/threonine kinase
            11 interacting protein, full insert sequence
          Length = 4144

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 315  gctccagcccaccctggccat 335
            |||||||||||||||||||||
Sbjct: 2735 gctccagcccaccctggccat 2755



to top

>ref|NM_027886.2| Mus musculus serine/threonine kinase 11 interacting protein
            (Stk11ip), mRNA
          Length = 4481

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 315  gctccagcccaccctggccat 335
            |||||||||||||||||||||
Sbjct: 2630 gctccagcccaccctggccat 2650



to top

>dbj|AK171989.1| Mus musculus activated spleen cDNA, RIKEN full-length enriched
            library, clone:F830028A08 product:serine/threonine kinase
            11 interacting protein, full insert sequence
          Length = 3481

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 315  gctccagcccaccctggccat 335
            |||||||||||||||||||||
Sbjct: 2509 gctccagcccaccctggccat 2529



to top

>dbj|AK165911.1| Mus musculus lung RCB-0558 LLC cDNA, RIKEN full-length enriched
            library, clone:G730018C07 product:serine/threonine kinase
            11 interacting protein, full insert sequence
          Length = 4475

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 315  gctccagcccaccctggccat 335
            |||||||||||||||||||||
Sbjct: 2640 gctccagcccaccctggccat 2660



to top

>dbj|AK004757.2| Mus musculus adult male lung cDNA, RIKEN full-length enriched
            library, clone:1200014D22 product:similar to
            LKB1-INTERACTING PROTEIN 1 [Homo sapiens], full insert
            sequence
          Length = 4010

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 315  gctccagcccaccctggccat 335
            |||||||||||||||||||||
Sbjct: 2600 gctccagcccaccctggccat 2620



to top

>dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, complete
                sequence
          Length = 30731886

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                     
Query: 187      ctctagctacgagctaactgc 207
                |||||||||||||||||||||
Sbjct: 27580384 ctctagctacgagctaactgc 27580364



to top

>dbj|AP006454.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, BAC
             clone:B1472F02
          Length = 55065

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 187   ctctagctacgagctaactgc 207
             |||||||||||||||||||||
Sbjct: 22078 ctctagctacgagctaactgc 22058



to top

>gb|AC102751.14| Mus musculus chromosome 19, clone RP24-531N3, complete sequence
          Length = 178150

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 335   tcagcaatggctcctccctt 354
             ||||||||||||||||||||
Sbjct: 27152 tcagcaatggctcctccctt 27133



to top

>gb|AC126549.4| Mus musculus BAC clone RP24-326I12 from chromosome 13, complete
             sequence
          Length = 189739

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 324   caccctggccatcagcaatggctc 347
             ||||||||| ||||||||||||||
Sbjct: 47077 caccctggctatcagcaatggctc 47054



to top

>emb|Z78205.1|BHT1UL Bovine herpesvirus type 1 UL22-35 genes
          Length = 37000

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 282   gatggcggcggacacggccg 301
             ||||||||||||||||||||
Sbjct: 19392 gatggcggcggacacggccg 19411



to top

>emb|AJ004801.1|BHV1CGEN Bovine herpesvirus type 1.1 complete genome
          Length = 135301

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 282   gatggcggcggacacggccg 301
             ||||||||||||||||||||
Sbjct: 50192 gatggcggcggacacggccg 50211



to top

>ref|XM_742671.1| Aspergillus fumigatus Af293 hypothetical protein (Afu6g03120)
           partial mRNA
          Length = 795

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 325 accctggccatcagcaatgg 344
           ||||||||||||||||||||
Sbjct: 31  accctggccatcagcaatgg 50



to top

>gb|AC018712.5| Homo sapiens BAC clone RP11-343H10 from 2, complete sequence
          Length = 156833

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 206   gcgggggcggaggcgcaggc 225
             ||||||||||||||||||||
Sbjct: 16702 gcgggggcggaggcgcaggc 16683



to top

>gb|AC122836.4| Mus musculus BAC clone RP23-188B13 from 7, complete sequence
          Length = 222390

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 322    cccaccctggccatcagcaa 341
              ||||||||||||||||||||
Sbjct: 196402 cccaccctggccatcagcaa 196421



to top

>ref|XM_758622.1| Theileria parva strain Muguga chromosome 4 hypothetical protein
           (TP04_0080) partial mRNA
          Length = 2358

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 56  catactatttatactactac 75
           ||||||||||||||||||||
Sbjct: 187 catactatttatactactac 206



to top

>emb|AL645608.30| Human DNA sequence from clone RP11-54O7 on chromosome 1 Contains three
              novel genes, a novel gene (MGC45873), a novel gene
              (DKFZP564C186), a novel gene, a novel gene (DKFZP434H2010),
              a novel gene (MGC13275), the gene for bHLH factor Hes4
              (Hes4), a ribosomal protein L39 (RPL39) pseudogene, a novel
              gene, the G1P2 gene for interferon alpha-inducible protein
              (clone IFI-15K), the AGRN gene for agrin, two novel genes
              and fifteen CpG islands, complete sequence
          Length = 186759

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 315    gctccagcccaccctggcca 334
              ||||||||||||||||||||
Sbjct: 185295 gctccagcccaccctggcca 185276



to top

>emb|AL390719.47| Human DNA sequence from clone RP11-465B22 on chromosome 1 Contains
           a novel gene, a novel gene, a protein tyrosine
           phosphatase family pseudogene, a novel gene (FLJ20584),
           a novel gene, a novel gene, a novel gene (FLJ36119) and
           five CpG islands, complete sequence
          Length = 130979

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 315 gctccagcccaccctggcca 334
           ||||||||||||||||||||
Sbjct: 563 gctccagcccaccctggcca 544



to top

>gb|CP000270.1| Burkholderia xenovorans LB400 chromosome 1, complete sequence
          Length = 4895836

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                       
Query: 265     gcgaaacggtgtgcgccgatggcg 288
               |||||||||| |||||||||||||
Sbjct: 1162245 gcgaaacggtatgcgccgatggcg 1162268



to top

>emb|AL031003.1|HS422G23 Human DNA sequence from clone RP3-422G23 on chromosome 6q24 Contains
             the gene for KIAA1244 protein, a macrophage myristoylated
             alanine-rich C kinase substrate (MACMARCKS) pseudogene, a
             pseudogene similar to Mus musculus upregulated during
             skeletal muscle growth 5 (Usmg5), the gene for chromosome
             6 open reading frame 34 (C6orf34) (SOUL) and a CpG island,
             complete sequence
          Length = 159344

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 27    atatgtacatatcctcaaat 46
             ||||||||||||||||||||
Sbjct: 67213 atatgtacatatcctcaaat 67232



to top

>emb|AL022148.1|HS435A7 Human DNA sequence from clone RP3-435A7 on chromosome Xq22.1-22.3,
             complete sequence
          Length = 98067

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 365   caaactttgagtatatgacc 384
             ||||||||||||||||||||
Sbjct: 33305 caaactttgagtatatgacc 33286



to top

>emb|X82596.1|RLAAPJQMP R.leguminosarum aapJ, Q, M, P genes and ORF5
          Length = 5441

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 276 tgcgccgatggcggcggaca 295
           ||||||||||||||||||||
Sbjct: 747 tgcgccgatggcggcggaca 728



to top

>emb|AJ849797.1| Drosophila madeirensis partial abd-A gene for abdominal-A, exon 4,
           line P2-MAD
          Length = 1279

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 284 tggcggcggacacggccgag 303
           ||||||||||||||||||||
Sbjct: 83  tggcggcggacacggccgag 64



to top

>emb|AJ849796.1| Drosophila subobscura partial abd-A gene for abdominal-A, exon 4,
           line P2-O3+4-36
          Length = 2106

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 284 tggcggcggacacggccgag 303
           ||||||||||||||||||||
Sbjct: 83  tggcggcggacacggccgag 64



to top

>emb|AJ849795.1| Drosophila subobscura partial abd-A gene for abdominal-A, exon 4,
           line P2-O3+4-33
          Length = 2105

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 284 tggcggcggacacggccgag 303
           ||||||||||||||||||||
Sbjct: 83  tggcggcggacacggccgag 64



to top

>emb|AJ849794.1| Drosophila subobscura partial abd-A gene for abdominal-A, exon 4,
           line P2-O3+4-32
          Length = 2088

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 284 tggcggcggacacggccgag 303
           ||||||||||||||||||||
Sbjct: 83  tggcggcggacacggccgag 64



to top

>emb|AJ849793.1| Drosophila subobscura partial abd-A gene for abdominal-A, exon 4,
           line P2-O3+4-31
          Length = 2066

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 284 tggcggcggacacggccgag 303
           ||||||||||||||||||||
Sbjct: 83  tggcggcggacacggccgag 64



to top

>emb|AJ849792.1| Drosophila subobscura partial abd-A gene for abdominal-A, exon 4,
           line P2-O3+4-30
          Length = 2104

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 284 tggcggcggacacggccgag 303
           ||||||||||||||||||||
Sbjct: 83  tggcggcggacacggccgag 64



to top

>emb|AJ849791.1| Drosophila subobscura partial abd-A gene for abdominal-A, exon 4,
           line P2-O3+4-29
          Length = 2104

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 284 tggcggcggacacggccgag 303
           ||||||||||||||||||||
Sbjct: 83  tggcggcggacacggccgag 64



to top

>emb|AJ849790.1| Drosophila subobscura partial abd-A gene for abdominal-A, exon 4,
           line P2-O3+4-28
          Length = 2110

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 284 tggcggcggacacggccgag 303
           ||||||||||||||||||||
Sbjct: 83  tggcggcggacacggccgag 64



to top

>emb|AJ849789.1| Drosophila subobscura partial abd-A gene for abdominal-A, exon 4,
           line P2-O3+4-27
          Length = 2105

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 284 tggcggcggacacggccgag 303
           ||||||||||||||||||||
Sbjct: 83  tggcggcggacacggccgag 64



to top

>emb|AJ849788.1| Drosophila subobscura partial abd-A gene for abdominal-A, exon 4,
           line P2-O3+4-26
          Length = 2099

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 284 tggcggcggacacggccgag 303
           ||||||||||||||||||||
Sbjct: 83  tggcggcggacacggccgag 64



to top

>emb|AJ849787.1| Drosophila subobscura partial abd-A gene for abdominal-A, exon 4,
           line P2-O3+4-25
          Length = 2105

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 284 tggcggcggacacggccgag 303
           ||||||||||||||||||||
Sbjct: 83  tggcggcggacacggccgag 64



to top

>emb|AJ849786.1| Drosophila subobscura partial abd-A gene for abdominal-A, exon 4,
           line P2-O3+4-24
          Length = 2094

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 284 tggcggcggacacggccgag 303
           ||||||||||||||||||||
Sbjct: 83  tggcggcggacacggccgag 64



to top

>emb|AJ849785.1| Drosophila subobscura partial abd-A gene for abdominal-A, exon 4,
           line P2-O3+4-23
          Length = 2087

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 284 tggcggcggacacggccgag 303
           ||||||||||||||||||||
Sbjct: 83  tggcggcggacacggccgag 64



to top

>emb|AJ849784.1| Drosophila subobscura partial abd-A gene for abdominal-A, exon 4,
           line P2-O3+4-22
          Length = 2106

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 284 tggcggcggacacggccgag 303
           ||||||||||||||||||||
Sbjct: 83  tggcggcggacacggccgag 64



to top

>emb|AJ849783.1| Drosophila subobscura partial abd-A gene for abdominal-A, exon 4,
           line P2-O3+4-21
          Length = 2107

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 284 tggcggcggacacggccgag 303
           ||||||||||||||||||||
Sbjct: 83  tggcggcggacacggccgag 64



to top

>emb|AJ849782.1| Drosophila subobscura partial abd-A gene for abdominal-A, exon 4,
           line P2-Ost-14
          Length = 2115

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 284 tggcggcggacacggccgag 303
           ||||||||||||||||||||
Sbjct: 83  tggcggcggacacggccgag 64



to top

>emb|AJ849780.1| Drosophila subobscura partial abd-A gene for abdominal-A, exon 4,
           line P2-Ost-12
          Length = 2096

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 284 tggcggcggacacggccgag 303
           ||||||||||||||||||||
Sbjct: 83  tggcggcggacacggccgag 64



to top

>emb|AJ849779.1| Drosophila subobscura partial abd-A gene for abdominal-A, exon 4,
           line P2-Ost-11
          Length = 2095

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 284 tggcggcggacacggccgag 303
           ||||||||||||||||||||
Sbjct: 83  tggcggcggacacggccgag 64



to top

>emb|AJ849778.1| Drosophila subobscura partial abd-A gene for abdominal-A, exon 4,
           line P2-Ost-10
          Length = 2109

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 284 tggcggcggacacggccgag 303
           ||||||||||||||||||||
Sbjct: 83  tggcggcggacacggccgag 64



to top

>emb|AJ849777.1| Drosophila subobscura partial abd-A gene for abdominal-A, exon 4,
           line P2-Ost-09
          Length = 2103

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 284 tggcggcggacacggccgag 303
           ||||||||||||||||||||
Sbjct: 83  tggcggcggacacggccgag 64



to top

>emb|AJ849776.1| Drosophila subobscura partial abd-A gene for abdominal-A, exon 4,
           line P2-Ost-08
          Length = 2112

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 284 tggcggcggacacggccgag 303
           ||||||||||||||||||||
Sbjct: 83  tggcggcggacacggccgag 64



to top

>emb|AJ849775.1| Drosophila subobscura partial abd-A gene for abdominal-A, exon 4,
           line P2-Ost-07
          Length = 2106

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 284 tggcggcggacacggccgag 303
           ||||||||||||||||||||
Sbjct: 83  tggcggcggacacggccgag 64



to top

>emb|AJ849774.1| Drosophila subobscura partial abd-A gene for abdominal-A, exon 4,
           line P2-Ost-06
          Length = 2114

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 284 tggcggcggacacggccgag 303
           ||||||||||||||||||||
Sbjct: 83  tggcggcggacacggccgag 64



to top

>emb|AJ849773.1| Drosophila subobscura partial abd-A gene for abdominal-A, exon 4,
           line P2-Ost-05
          Length = 2123

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 284 tggcggcggacacggccgag 303
           ||||||||||||||||||||
Sbjct: 83  tggcggcggacacggccgag 64



to top

>emb|AJ849772.1| Drosophila subobscura partial abd-A gene for abdominal-A, exon 4,
           line P2-Ost-04
          Length = 2133

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 284 tggcggcggacacggccgag 303
           ||||||||||||||||||||
Sbjct: 83  tggcggcggacacggccgag 64



to top

>emb|AJ849771.1| Drosophila subobscura partial abd-A gene for abdominal-A, exon 4,
           line P2-Ost-03
          Length = 2115

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 284 tggcggcggacacggccgag 303
           ||||||||||||||||||||
Sbjct: 83  tggcggcggacacggccgag 64



to top

>emb|AJ849769.1| Drosophila subobscura partial abd-A gene for abdominal-A, exon 4,
           line P2-Ost-01
          Length = 2088

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 284 tggcggcggacacggccgag 303
           ||||||||||||||||||||
Sbjct: 83  tggcggcggacacggccgag 64



to top

>gb|AC102076.9| Mus musculus chromosome 7, clone RP23-401P12, complete sequence
          Length = 199219

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 322   cccaccctggccatcagcaa 341
             ||||||||||||||||||||
Sbjct: 92773 cccaccctggccatcagcaa 92754



to top

>gb|AY483521.1| HIV-1 isolate 98USP1Neca from USA envelope glycoprotein (env) gene,
           partial cds
          Length = 602

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 111 tagtacttggaagtatggtactaa 134
           ||||||||||||| ||||||||||
Sbjct: 373 tagtacttggaaggatggtactaa 396



to top

>dbj|AP008229.1| Xanthomonas oryzae pv. oryzae MAFF 311018 DNA, complete genome
          Length = 4940217

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 305     cgaccagcgcgctccagccc 324
               ||||||||||||||||||||
Sbjct: 4675622 cgaccagcgcgctccagccc 4675603



to top

>dbj|AK080903.1| Mus musculus 4 days neonate male adipose cDNA, RIKEN full-length
            enriched library, clone:B430203I24
            product:unclassifiable, full insert sequence
          Length = 3267

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 324  caccctggccatcagcaatggctc 347
            ||||||||| ||||||||||||||
Sbjct: 1228 caccctggctatcagcaatggctc 1251



to top

>dbj|BA000030.2| Streptomyces avermitilis MA-4680 genomic DNA, complete genome
          Length = 9025608

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 291     ggacacggccgagacgacca 310
               ||||||||||||||||||||
Sbjct: 1519659 ggacacggccgagacgacca 1519640



to top

>dbj|AP002953.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC
              clone:P0426D06
          Length = 162173

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 103    aacggaggtagtacttggaa 122
              ||||||||||||||||||||
Sbjct: 119806 aacggaggtagtacttggaa 119787



to top

>emb|X94677.1|BHV1ULGNS Bovine herpesvirus type 1 genes for UL[27,28,29,30,31]
          Length = 10500

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 282  gatggcggcggacacggccg 301
            ||||||||||||||||||||
Sbjct: 5116 gatggcggcggacacggccg 5135



to top

>emb|AJ272672.1|HIM272672 Human immunodeficiency virus type 1 proviral partial env gene for
           gp120, isolate 97SE-45HPD
          Length = 595

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 111 tagtacttggaagtatggtactaa 134
           ||||||||||||| ||||||||||
Sbjct: 357 tagtacttggaagaatggtactaa 380



to top

>gb|AC154862.2| Mus musculus BAC clone RP23-8G7 from 13, complete sequence
          Length = 205028

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 324   caccctggccatcagcaatggctc 347
             ||||||||| ||||||||||||||
Sbjct: 20818 caccctggctatcagcaatggctc 20841



to top

>gb|AF487716.1| Aphis gossypii 18S ribosomal RNA gene, partial sequence; internal
            transcribed spacer 1, 5.8S ribosomal RNA gene and
            internal transcribed spacer 2, complete sequence; and 28S
            ribosomal RNA gene, partial sequence
          Length = 2025

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                            
Query: 285  ggcggcggacacggccgagacgaccagcgcgc 316
            ||||||||  ||||||||| ||||||||||||
Sbjct: 1431 ggcggcggcgacggccgaggcgaccagcgcgc 1462



to top

>gb|CP000009.1| Gluconobacter oxydans 621H, complete genome
          Length = 2702173

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 207 cgggggcggaggcgcaggcgtcca 230
           ||||||||||||||| ||||||||
Sbjct: 215 cgggggcggaggcgctggcgtcca 192



to top

>dbj|AB209681.1| Homo sapiens mRNA for RAP guanine-nucleotide-exchange factor 4
           variant protein
          Length = 6400

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 206 gcgggggcggaggcgcaggc 225
           ||||||||||||||||||||
Sbjct: 43  gcgggggcggaggcgcaggc 62


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 3,114,215
Number of Sequences: 3902068
Number of extensions: 3114215
Number of successful extensions: 86995
Number of sequences better than 10.0: 71
Number of HSP's better than 10.0 without gapping: 72
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 86640
Number of HSP's gapped (non-prelim): 355
length of query: 421
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 399
effective length of database: 17,147,199,772
effective search space: 6841732709028
effective search space used: 6841732709028
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top