>gb|BT016209.1| Zea mays clone Contig42 mRNA sequence
          Length = 1401

 Score = 85.7 bits (43), Expect = 1e-13
 Identities = 67/75 (89%)
 Strand = Plus / Minus

                                                                        
Query: 305  tgcttcctcaccactttgaatgttgactgcagcttggatagagcgacggggcactctccc 364
            |||||| |||||||||||||||||||||||||||||  |||  | |||||||| ||||||
Sbjct: 1305 tgcttcttcaccactttgaatgttgactgcagcttgcctagctcaacggggcattctccc 1246

                           
Query: 365  ttctcgtcatactca 379
            ||||| |||||||||
Sbjct: 1245 ttctcatcatactca 1231

>gb|AY104166.1| Zea mays PCO075332 mRNA sequence
          Length = 992

 Score = 85.7 bits (43), Expect = 1e-13
 Identities = 67/75 (89%)
 Strand = Plus / Minus

                                                                       
Query: 305 tgcttcctcaccactttgaatgttgactgcagcttggatagagcgacggggcactctccc 364
           |||||| |||||||||||||||||||||||||||||  |||  | |||||||| ||||||
Sbjct: 655 tgcttcttcaccactttgaatgttgactgcagcttgcctagctcaacggggcattctccc 596

                          
Query: 365 ttctcgtcatactca 379
           ||||| |||||||||
Sbjct: 595 ttctcatcatactca 581

>gb|DQ175835.1| Hordeum vulgare clone DsB38 Ds insertion site flanking region
           genomic sequence
          Length = 546

 Score = 52.0 bits (26), Expect = 0.001
 Identities = 26/26 (100%)
 Strand = Plus / Minus

                                     
Query: 97  aaagtttcctaacaggaggctacatc 122
           ||||||||||||||||||||||||||
Sbjct: 546 aaagtttcctaacaggaggctacatc 521

>gb|AC111046.28| Mus musculus chromosome 10, clone RP23-479A12, complete sequence
          Length = 231134

 Score = 46.1 bits (23), Expect = 0.084
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                    
Query: 17    ttcagccacataaatttatgatc 39
             |||||||||||||||||||||||
Sbjct: 77857 ttcagccacataaatttatgatc 77835

>gb|AC102483.8| Mus musculus chromosome 1, clone RP24-450F12, complete sequence
          Length = 167656

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 246   gtttgaagagcccaggagaaa 266
             |||||||||||||||||||||
Sbjct: 94685 gtttgaagagcccaggagaaa 94665

>gb|AC104235.3| Homo sapiens chromosome 11, clone RP11-12N12, complete sequence
          Length = 162139

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 1     aagaaaaaagacaaacttcag 21
             |||||||||||||||||||||
Sbjct: 52831 aagaaaaaagacaaacttcag 52811

>ref|NM_000273.1| Homo sapiens G protein-coupled receptor 143 (GPR143), mRNA
          Length = 1607

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 292  cccatgaaaaccctgcttcc 311
            ||||||||||||||||||||
Sbjct: 1100 cccatgaaaaccctgcttcc 1119

>gb|AC138341.9| Mus musculus chromosome 5, clone RP23-37N15, complete sequence
          Length = 176410

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 324   atgttgactgcagcttggat 343
             ||||||||||||||||||||
Sbjct: 92504 atgttgactgcagcttggat 92485

>gb|BC068977.1| Homo sapiens G protein-coupled receptor 143, mRNA (cDNA clone
            MGC:75119 IMAGE:6162826), complete cds
          Length = 1722

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 292  cccatgaaaaccctgcttcc 311
            ||||||||||||||||||||
Sbjct: 1188 cccatgaaaaccctgcttcc 1207

>gb|AC024957.9| Mus musculus chromosome 16, clone RP23-178A24, complete sequence
          Length = 229563

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 224    tttatacatctctgactcaagtgt 247
              |||| |||||||||||||||||||
Sbjct: 173618 tttaaacatctctgactcaagtgt 173595

>gb|AC129319.4| Mus musculus BAC clone RP24-127J16 from chromosome 8, complete sequence
          Length = 169835

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 127   caagcttaaccaatttcatg 146
             ||||||||||||||||||||
Sbjct: 74041 caagcttaaccaatttcatg 74060

>emb|AL391867.5| Human DNA sequence from clone RP11-402M4 on chromosome 9, complete
             sequence
          Length = 164444

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 1     aagaaaaaagacaaacttca 20
             ||||||||||||||||||||
Sbjct: 30055 aagaaaaaagacaaacttca 30074

>emb|AL158049.11| Human DNA sequence from clone RP3-482C21 on chromosome 6 Contains the
             3' end of the gene for a novel protein similar to integral
             inner nuclear membrane protein (MAN1) and the 3' end of
             the MLN gene for motilin and a CpG island, complete
             sequence
          Length = 51881

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 137   caatttcatggcaaatccac 156
             ||||||||||||||||||||
Sbjct: 43809 caatttcatggcaaatccac 43828

>gb|AC006081.4| Arabidopsis thaliana chromosome 2 clone T2G17 map mi148, complete
             sequence
          Length = 97814

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 180   acaaatacgaaatcaacatc 199
             ||||||||||||||||||||
Sbjct: 59027 acaaatacgaaatcaacatc 59046

>gb|AC102625.8| Mus musculus chromosome 8, clone RP23-453E3, complete sequence
          Length = 167288

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 127    caagcttaaccaatttcatg 146
              ||||||||||||||||||||
Sbjct: 159565 caagcttaaccaatttcatg 159584

>gb|AC003036.1|AC003036 Homo sapiens Xp22 PAC RPCI1-108M6 (Roswell Park Cancer Center PAC
             library) complete sequence
          Length = 123203

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 292   cccatgaaaaccctgcttcc 311
             ||||||||||||||||||||
Sbjct: 16574 cccatgaaaaccctgcttcc 16593

>gb|AF466200.2| Sorghum bicolor putative protein kinase gene, partial cds; putative Cf-2,
              fertilization-independent endosperm proteins, hypothetical
              protein, putative non-LTR retroelement reverse
              transcriptase, OCL5 protein, tryptophan synthase
              beta-subunit, hypothetical proteins, putative AP
              endonuclease, putative RNA polymerase II complex component
              SRB7, putative beta-1,3-glucanase, hypothetical protein,
              TNP2-like protein, hypothetical protein, putative
              phosphate/phosphoenolpyruvate translocator, putative
              protein, hypothetical proteins, putative
              galactosyltransferase family, hypothetical protein,
              putative cytochrome P450 family, putative lipid transfer
              protein, putative photoreceptor-interacting protein, and
              hypothetical protein genes, complete cds; and hypothetical
              protein gene, partial cds
          Length = 202197

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 2      agaaaaaagacaaacttcag 21
              ||||||||||||||||||||
Sbjct: 192429 agaaaaaagacaaacttcag 192410

>emb|CT009632.14| Mouse DNA sequence from clone RP23-5G10 on chromosome 16, complete
              sequence
          Length = 208600

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 224    tttatacatctctgactcaagtgt 247
              |||| |||||||||||||||||||
Sbjct: 129784 tttaaacatctctgactcaagtgt 129761

>gb|BC015657.2| Homo sapiens cDNA clone IMAGE:4841294, containing frame-shift errors
          Length = 1720

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 292  cccatgaaaaccctgcttcc 311
            ||||||||||||||||||||
Sbjct: 1179 cccatgaaaaccctgcttcc 1198

>emb|Z48804.1|HSOA1MRNA H.sapiens mRNA (ocular albinism type 1 related)
          Length = 1607

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 292  cccatgaaaaccctgcttcc 311
            ||||||||||||||||||||
Sbjct: 1100 cccatgaaaaccctgcttcc 1119


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 3,911,294
Number of Sequences: 3902068
Number of extensions: 3911294
Number of successful extensions: 83819
Number of sequences better than 10.0: 20
Number of HSP's better than 10.0 without gapping: 20
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 83772
Number of HSP's gapped (non-prelim): 47
length of query: 388
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 366
effective length of database: 17,147,199,772
effective search space: 6275875116552
effective search space used: 6275875116552
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)