ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbastl25b12
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1emb|AL031534.1|SPBC4F6 S.pombe chromosome II cosmid c4F6 40 0.40
2gb|AC118596.7| Mus musculus chromosome 1, clone RP24-199M24, com... 40 0.40
3gb|CP000117.1| Anabaena variabilis ATCC 29413 chromosome, comple... 38 1.6
4dbj|BA000019.2| Nostoc sp. PCC 7120 DNA, complete genome 38 1.6
5gb|CP000102.1| Methanosphaera stadtmanae DSM 3091, complete genome 38 1.6
6ref|XM_629370.1| Dictyostelium discoideum hypothetical protein (... 36 6.2
7gb|AF482483.1| Morone saxatilis microsatellite Msa5-71 sequence 36 6.2
8gb|DQ498586.1| Homo sapiens clone EIAV 320 genomic sequence 36 6.2
9gb|AC118025.18| Mus musculus chromosome 6, clone RP23-461L9, com... 36 6.2
10ref|XM_978497.1| PREDICTED: Mus musculus RIKEN cDNA 4932429P05 g... 36 6.2
11ref|XM_141917.6| PREDICTED: Mus musculus RIKEN cDNA 4932429P05 g... 36 6.2
12ref|XM_907581.2| PREDICTED: Mus musculus RIKEN cDNA 4932429P05 g... 36 6.2
13gb|AC146144.2| Pan troglodytes BAC clone RP43-37J17 from 7, comp... 36 6.2
14gb|AC146041.2| Pan troglodytes BAC clone RP43-98A7 from 7, compl... 36 6.2
15gb|AC146378.2| Pan troglodytes BAC clone RP43-93I8 from 7, compl... 36 6.2
16gb|AY366501.1| Homo sapiens clone BAC44d21 BCSC-1 (LOH11CR2A) ge... 36 6.2
17gb|AC164003.2| Mus musculus chromosome 18, clone RP23-480F11, co... 36 6.2
18emb|AL355605.10| Human DNA sequence from clone RP11-456P14 on ch... 36 6.2
19gb|AC003075.2| Homo sapiens PAC clone RP4-658N5 from 7p21, compl... 36 6.2
20gb|AC022029.7| Homo sapiens chromosome 10 clone RP11-93L14, comp... 36 6.2
21dbj|AK133287.1| Mus musculus adult male testis cDNA, RIKEN full-... 36 6.2
22gb|AC026708.6| Homo sapiens chromosome 5 clone CTD-2078B5, compl... 36 6.2
23dbj|AP008215.1| Oryza sativa (japonica cultivar-group) genomic D... 36 6.2
24gb|AC010705.15|AC010705 Drosophila melanogaster, chromosome X, r... 36 6.2
25dbj|AP004011.3| Oryza sativa (japonica cultivar-group) genomic D... 36 6.2
26dbj|AP005569.2| Oryza sativa (japonica cultivar-group) genomic D... 36 6.2
27gb|AC005993.2|AC005993 Homo sapiens PAC clone RP6-114E22 from 14... 36 6.2
28gb|AC137743.3| Mus musculus BAC clone RP24-469M15 from 6, comple... 36 6.2
29gb|AE003494.4| Drosophila melanogaster chromosome X, section 46 ... 36 6.2
30dbj|AP000818.4| Homo sapiens genomic DNA, chromosome 11q clone:C... 36 6.2
31gb|AC102550.9| Mus musculus chromosome 18, clone RP23-153A8, com... 36 6.2
32gb|AC131775.4| Mus musculus BAC clone RP24-313O6 from 6, complet... 36 6.2
33emb|AL670771.6| Mouse DNA sequence from clone RP23-256C8 on chro... 36 6.2

>emb|AL031534.1|SPBC4F6 S.pombe chromosome II cosmid c4F6
          Length = 44778

 Score = 40.1 bits (20), Expect = 0.40
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 14    aaaatatattgcatatgccg 33
             ||||||||||||||||||||
Sbjct: 37560 aaaatatattgcatatgccg 37541



to top

>gb|AC118596.7| Mus musculus chromosome 1, clone RP24-199M24, complete sequence
          Length = 149611

 Score = 40.1 bits (20), Expect = 0.40
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 13    gaaaatatattgcatatgcc 32
             ||||||||||||||||||||
Sbjct: 18665 gaaaatatattgcatatgcc 18646



to top

>gb|CP000117.1| Anabaena variabilis ATCC 29413 chromosome, complete sequence
          Length = 6365727

 Score = 38.2 bits (19), Expect = 1.6
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                  
Query: 5       agaacagcgaaaatatatt 23
               |||||||||||||||||||
Sbjct: 1680074 agaacagcgaaaatatatt 1680092



to top

>dbj|BA000019.2| Nostoc sp. PCC 7120 DNA, complete genome
          Length = 6413771

 Score = 38.2 bits (19), Expect = 1.6
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                  
Query: 5       agaacagcgaaaatatatt 23
               |||||||||||||||||||
Sbjct: 5321311 agaacagcgaaaatatatt 5321329



to top

>gb|CP000102.1| Methanosphaera stadtmanae DSM 3091, complete genome
          Length = 1767403

 Score = 38.2 bits (19), Expect = 1.6
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 13     gaaaatatattgcatatgc 31
              |||||||||||||||||||
Sbjct: 424888 gaaaatatattgcatatgc 424870



to top

>ref|XM_629370.1| Dictyostelium discoideum hypothetical protein (DDB0219794), partial
            mRNA
          Length = 2274

 Score = 36.2 bits (18), Expect = 6.2
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                              
Query: 14   aaaatatattgcatatgc 31
            ||||||||||||||||||
Sbjct: 1701 aaaatatattgcatatgc 1718



to top

>gb|AF482483.1| Morone saxatilis microsatellite Msa5-71 sequence
          Length = 304

 Score = 36.2 bits (18), Expect = 6.2
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                            
Query: 4  aagaacagcgaaaatata 21
          ||||||||||||||||||
Sbjct: 41 aagaacagcgaaaatata 58



to top

>gb|DQ498586.1| Homo sapiens clone EIAV 320 genomic sequence
          Length = 348

 Score = 36.2 bits (18), Expect = 6.2
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                             
Query: 14  aaaatatattgcatatgc 31
           ||||||||||||||||||
Sbjct: 249 aaaatatattgcatatgc 232



to top

>gb|AC118025.18| Mus musculus chromosome 6, clone RP23-461L9, complete sequence
          Length = 198895

 Score = 36.2 bits (18), Expect = 6.2
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                              
Query: 13   gaaaatatattgcatatg 30
            ||||||||||||||||||
Sbjct: 7498 gaaaatatattgcatatg 7515



to top

>ref|XM_978497.1| PREDICTED: Mus musculus RIKEN cDNA 4932429P05 gene (4932429P05Rik),
            mRNA
          Length = 3093

 Score = 36.2 bits (18), Expect = 6.2
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                              
Query: 13   gaaaatatattgcatatg 30
            ||||||||||||||||||
Sbjct: 2136 gaaaatatattgcatatg 2153



to top

>ref|XM_141917.6| PREDICTED: Mus musculus RIKEN cDNA 4932429P05 gene (4932429P05Rik),
            mRNA
          Length = 3093

 Score = 36.2 bits (18), Expect = 6.2
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                              
Query: 13   gaaaatatattgcatatg 30
            ||||||||||||||||||
Sbjct: 2136 gaaaatatattgcatatg 2153



to top

>ref|XM_907581.2| PREDICTED: Mus musculus RIKEN cDNA 4932429P05 gene (4932429P05Rik),
            mRNA
          Length = 3093

 Score = 36.2 bits (18), Expect = 6.2
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                              
Query: 13   gaaaatatattgcatatg 30
            ||||||||||||||||||
Sbjct: 2136 gaaaatatattgcatatg 2153



to top

>gb|AC146144.2| Pan troglodytes BAC clone RP43-37J17 from 7, complete sequence
          Length = 206029

 Score = 36.2 bits (18), Expect = 6.2
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                                
Query: 14     aaaatatattgcatatgc 31
              ||||||||||||||||||
Sbjct: 181770 aaaatatattgcatatgc 181787



to top

>gb|AC146041.2| Pan troglodytes BAC clone RP43-98A7 from 7, complete sequence
          Length = 120644

 Score = 36.2 bits (18), Expect = 6.2
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                               
Query: 14    aaaatatattgcatatgc 31
             ||||||||||||||||||
Sbjct: 76453 aaaatatattgcatatgc 76436



to top

>gb|AC146378.2| Pan troglodytes BAC clone RP43-93I8 from 7, complete sequence
          Length = 135955

 Score = 36.2 bits (18), Expect = 6.2
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                                
Query: 14     aaaatatattgcatatgc 31
              ||||||||||||||||||
Sbjct: 119489 aaaatatattgcatatgc 119472



to top

>gb|AY366501.1| Homo sapiens clone BAC44d21 BCSC-1 (LOH11CR2A) gene, complete cds;
             alternatively spliced isoforms
          Length = 219836

 Score = 36.2 bits (18), Expect = 6.2
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                               
Query: 3     aaagaacagcgaaaatat 20
             ||||||||||||||||||
Sbjct: 37670 aaagaacagcgaaaatat 37653



to top

>gb|AC164003.2| Mus musculus chromosome 18, clone RP23-480F11, complete sequence
          Length = 176015

 Score = 36.2 bits (18), Expect = 6.2
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                               
Query: 14    aaaatatattgcatatgc 31
             ||||||||||||||||||
Sbjct: 49129 aaaatatattgcatatgc 49112



to top

>emb|AL355605.10| Human DNA sequence from clone RP11-456P14 on chromosome 13, complete
             sequence
          Length = 55142

 Score = 36.2 bits (18), Expect = 6.2
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                               
Query: 14    aaaatatattgcatatgc 31
             ||||||||||||||||||
Sbjct: 46551 aaaatatattgcatatgc 46534



to top

>gb|AC003075.2| Homo sapiens PAC clone RP4-658N5 from 7p21, complete sequence
          Length = 123336

 Score = 36.2 bits (18), Expect = 6.2
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                              
Query: 14   aaaatatattgcatatgc 31
            ||||||||||||||||||
Sbjct: 7124 aaaatatattgcatatgc 7107



to top

>gb|AC022029.7| Homo sapiens chromosome 10 clone RP11-93L14, complete sequence
          Length = 140040

 Score = 36.2 bits (18), Expect = 6.2
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                               
Query: 13    gaaaatatattgcatatg 30
             ||||||||||||||||||
Sbjct: 25295 gaaaatatattgcatatg 25278



to top

>dbj|AK133287.1| Mus musculus adult male testis cDNA, RIKEN full-length enriched
            library, clone:4932429P05 product:weakly similar to
            Hypothetical Combined RanBP1/wasp domain (Fragment) [Mus
            musculus], full insert sequence
          Length = 3094

 Score = 36.2 bits (18), Expect = 6.2
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                              
Query: 13   gaaaatatattgcatatg 30
            ||||||||||||||||||
Sbjct: 2136 gaaaatatattgcatatg 2153



to top

>gb|AC026708.6| Homo sapiens chromosome 5 clone CTD-2078B5, complete sequence
          Length = 142047

 Score = 36.2 bits (18), Expect = 6.2
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                               
Query: 15    aaatatattgcatatgcc 32
             ||||||||||||||||||
Sbjct: 64422 aaatatattgcatatgcc 64405



to top

>dbj|AP008215.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, complete
               sequence
          Length = 22696651

 Score = 36.2 bits (18), Expect = 6.2
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                                 
Query: 13      gaaaatatattgcatatg 30
               ||||||||||||||||||
Sbjct: 7245047 gaaaatatattgcatatg 7245030



 Score = 36.2 bits (18), Expect = 6.2
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                                 
Query: 13      gaaaatatattgcatatg 30
               ||||||||||||||||||
Sbjct: 1152062 gaaaatatattgcatatg 1152045



to top

>gb|AC010705.15|AC010705 Drosophila melanogaster, chromosome X, region 12D-12E, BAC clone
             BACR28F21, complete sequence
          Length = 163958

 Score = 36.2 bits (18), Expect = 6.2
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                               
Query: 10    agcgaaaatatattgcat 27
             ||||||||||||||||||
Sbjct: 51412 agcgaaaatatattgcat 51395



to top

>dbj|AP004011.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, BAC
             clone:OJ1381_H04
          Length = 130961

 Score = 36.2 bits (18), Expect = 6.2
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                               
Query: 13    gaaaatatattgcatatg 30
             ||||||||||||||||||
Sbjct: 97152 gaaaatatattgcatatg 97135



to top

>dbj|AP005569.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, BAC
             clone:OJ1310_F05
          Length = 107916

 Score = 36.2 bits (18), Expect = 6.2
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                               
Query: 13    gaaaatatattgcatatg 30
             ||||||||||||||||||
Sbjct: 40656 gaaaatatattgcatatg 40639



to top

>gb|AC005993.2|AC005993 Homo sapiens PAC clone RP6-114E22 from 14, complete sequence
          Length = 143943

 Score = 36.2 bits (18), Expect = 6.2
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                             
Query: 13  gaaaatatattgcatatg 30
           ||||||||||||||||||
Sbjct: 488 gaaaatatattgcatatg 505



to top

>gb|AC137743.3| Mus musculus BAC clone RP24-469M15 from 6, complete sequence
          Length = 170200

 Score = 36.2 bits (18), Expect = 6.2
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                               
Query: 13    gaaaatatattgcatatg 30
             ||||||||||||||||||
Sbjct: 53954 gaaaatatattgcatatg 53937



to top

>gb|AE003494.4| Drosophila melanogaster chromosome X, section 46 of 74 of the complete
             sequence
          Length = 310498

 Score = 36.2 bits (18), Expect = 6.2
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                               
Query: 10    agcgaaaatatattgcat 27
             ||||||||||||||||||
Sbjct: 15600 agcgaaaatatattgcat 15583



to top

>dbj|AP000818.4| Homo sapiens genomic DNA, chromosome 11q clone:CMB9-44A17, complete
             sequence
          Length = 134973

 Score = 36.2 bits (18), Expect = 6.2
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                               
Query: 3     aaagaacagcgaaaatat 20
             ||||||||||||||||||
Sbjct: 89615 aaagaacagcgaaaatat 89632



to top

>gb|AC102550.9| Mus musculus chromosome 18, clone RP23-153A8, complete sequence
          Length = 177220

 Score = 36.2 bits (18), Expect = 6.2
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                               
Query: 14    aaaatatattgcatatgc 31
             ||||||||||||||||||
Sbjct: 30473 aaaatatattgcatatgc 30490



to top

>gb|AC131775.4| Mus musculus BAC clone RP24-313O6 from 6, complete sequence
          Length = 171720

 Score = 36.2 bits (18), Expect = 6.2
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                               
Query: 14    aaaatatattgcatatgc 31
             ||||||||||||||||||
Sbjct: 48630 aaaatatattgcatatgc 48613



to top

>emb|AL670771.6| Mouse DNA sequence from clone RP23-256C8 on chromosome X, complete
             sequence
          Length = 219340

 Score = 36.2 bits (18), Expect = 6.2
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                               
Query: 13    gaaaatatattgcatatg 30
             ||||||||||||||||||
Sbjct: 60985 gaaaatatattgcatatg 61002


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 361,649
Number of Sequences: 3902068
Number of extensions: 361649
Number of successful extensions: 92939
Number of sequences better than 10.0: 33
Number of HSP's better than 10.0 without gapping: 34
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 92731
Number of HSP's gapped (non-prelim): 208
length of query: 48
length of database: 17,233,045,268
effective HSP length: 20
effective length of query: 28
effective length of database: 17,155,003,908
effective search space: 480340109424
effective search space used: 480340109424
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 18 (36.2 bits)
to top