>gb|AC010563.6| Drosophila melanogaster 3L BAC RP98-9M20 (Roswell Park Cancer Institute
             Drosophila BAC Library) complete sequence
          Length = 185497

 Score = 44.1 bits (22), Expect = 0.31
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 256   atgttcagattgtaattgtgtt 277
             ||||||||||||||||||||||
Sbjct: 35820 atgttcagattgtaattgtgtt 35799

>gb|AC087821.5| Homo sapiens chromosome 8, clone RP11-108A14, complete sequence
          Length = 167949

 Score = 44.1 bits (22), Expect = 0.31
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                       
Query: 78    tctatcatgcagatggctagtaggta 103
             ||||||| ||||||||||||||||||
Sbjct: 70066 tctatcaggcagatggctagtaggta 70091

>gb|AE003519.3| Drosophila melanogaster chromosome 3L, section 66 of 83 of the complete
              sequence
          Length = 294542

 Score = 44.1 bits (22), Expect = 0.31
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 256    atgttcagattgtaattgtgtt 277
              ||||||||||||||||||||||
Sbjct: 286347 atgttcagattgtaattgtgtt 286326

>emb|CR522870.1| Desulfotalea psychrophila LSv54 chromosome
          Length = 3523383

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                    
Query: 316     tcctgaatattgtcttcagtc 336
               |||||||||||||||||||||
Sbjct: 3158977 tcctgaatattgtcttcagtc 3158957

>gb|AC160823.2| Xenopus tropicalis BMP4 gene, complete cds, complete sequence
          Length = 67072

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 256   atgttcagattgtaattgtgt 276
             |||||||||||||||||||||
Sbjct: 31689 atgttcagattgtaattgtgt 31669

>gb|AC107302.4| Homo sapiens 3 BAC RP11-564P9 (Roswell Park Cancer Institute Human BAC
             Library) complete sequence
          Length = 194234

 Score = 40.1 bits (20), Expect = 4.9
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 88    agatggctagtaggtagattaata 111
             ||||||||||||||| ||||||||
Sbjct: 14767 agatggctagtaggttgattaata 14790

>gb|AC099049.2| Homo sapiens chromosome 3 clone RP11-291P10, complete sequence
          Length = 180339

 Score = 40.1 bits (20), Expect = 4.9
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 88    agatggctagtaggtagattaata 111
             ||||||||||||||| ||||||||
Sbjct: 76544 agatggctagtaggttgattaata 76521

>dbj|BA000011.4| Thermoplasma volcanium GSS1 DNA, complete genome
          Length = 1584804

 Score = 40.1 bits (20), Expect = 4.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 158    aataaaagtatacgttacaa 177
              ||||||||||||||||||||
Sbjct: 708282 aataaaagtatacgttacaa 708263

>gb|AE016831.1| Enterococcus faecalis V583 plasmid pTEF2, complete sequence
          Length = 57660

 Score = 40.1 bits (20), Expect = 4.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 293   tgttcagattgtaatgaatt 312
             ||||||||||||||||||||
Sbjct: 49076 tgttcagattgtaatgaatt 49095


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 2,795,709
Number of Sequences: 3902068
Number of extensions: 2795709
Number of successful extensions: 51369
Number of sequences better than 10.0: 9
Number of HSP's better than 10.0 without gapping: 9
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 51342
Number of HSP's gapped (non-prelim): 27
length of query: 366
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 344
effective length of database: 17,147,199,772
effective search space: 5898636721568
effective search space used: 5898636721568
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)