>gb|AC174721.1| Gasterosteus aculeatus clone VMRC28-84C14, complete sequence
          Length = 125967

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 30/33 (90%)
 Strand = Plus / Minus

                                              
Query: 14    ctgcccgcttatttagacgtgactgaggtgtta 46
             |||||||||||||  || |||||||||||||||
Sbjct: 85764 ctgcccgcttattgtgatgtgactgaggtgtta 85732

>emb|AL365179.30| Human DNA sequence from clone RP13-34C21 on chromosome Xq24-25 Contains a
              chromobox homolog 1 (HP1 beta homolog Drosophila) (CBX1)
              pseudogene and a CpG island, complete sequence
          Length = 180851

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 291    agcaggactccctatggccg 310
              ||||||||||||||||||||
Sbjct: 113769 agcaggactccctatggccg 113788

>gb|CP000135.1| Rhizobium etli CFN 42 plasmid p42b, complete sequence
          Length = 184338

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 305    tggccgccgcaggggagggg 324
              ||||||||||||||||||||
Sbjct: 110637 tggccgccgcaggggagggg 110618

>gb|AC017076.14| Homo sapiens BAC clone RP11-439M11 from 2, complete sequence
          Length = 118808

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 355  agcgaggaggaagggaagag 374
            ||||||||||||||||||||
Sbjct: 8263 agcgaggaggaagggaagag 8282

>dbj|BA000041.2| Pan troglodytes DNA, major histocompatibility complex class I region
          Length = 1750601

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 259    tttgcaccagggagctctgc 278
              ||||||||||||||||||||
Sbjct: 205763 tttgcaccagggagctctgc 205782

>ref|XM_315264.2| Anopheles gambiae str. PEST ENSANGP00000022301
           (ENSANGG00000019812), partial mRNA
          Length = 1572

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 349 gcgtgcagcgaggaggaagggaag 372
           ||||||||||||||||||| ||||
Sbjct: 487 gcgtgcagcgaggaggaagcgaag 510

>ref|XM_307212.2| Anopheles gambiae str. PEST ENSANGP00000014562
           (ENSANGG00000012073), partial mRNA
          Length = 1206

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 349 gcgtgcagcgaggaggaagggaag 372
           ||||||||||||||||||| ||||
Sbjct: 487 gcgtgcagcgaggaggaagcgaag 510

>gb|AC159324.2| Mus musculus BAC clone RP23-9D1 from chromosome 12, complete sequence
          Length = 207280

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 302   ctatggccgccgcaggggagggga 325
             ||||||| ||||||||||||||||
Sbjct: 78047 ctatggcagccgcaggggagggga 78024

>emb|CR974568.14| Mouse DNA sequence from clone RP23-39N20 on chromosome 12, complete
             sequence
          Length = 251037

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 302   ctatggccgccgcaggggagggga 325
             ||||||| ||||||||||||||||
Sbjct: 43829 ctatggcagccgcaggggagggga 43852


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 2,689,616
Number of Sequences: 3902068
Number of extensions: 2689616
Number of successful extensions: 52234
Number of sequences better than 10.0: 9
Number of HSP's better than 10.0 without gapping: 9
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 52213
Number of HSP's gapped (non-prelim): 21
length of query: 397
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 375
effective length of database: 17,147,199,772
effective search space: 6430199914500
effective search space used: 6430199914500
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)