ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbastl24h07
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1gb|AC101854.8| Mus musculus chromosome 1, clone RP23-298H18, com... 42 1.00
2ref|XM_643491.1| Entamoeba histolytica HM-1:IMSS coatomer beta s... 42 1.00
3ref|XM_649421.1| Entamoeba histolytica HM-1:IMSS coatmer beta su... 42 1.00
4gb|AC141923.27| Medicago truncatula clone mth2-7f19, complete se... 42 1.00
5emb|AL049831.2|CNS00008 Human chromosome 14 DNA sequence BAC R-3... 42 1.00
6ref|XM_529495.1| PREDICTED: Pan troglodytes LOC451954 (LOC451954... 40 3.9
7gb|AC151815.1| Solanum demissum chromosome 5 clone PGEC472P22 ma... 40 3.9
8gb|AC149290.1| Solanum demissum chromosome 5 clone PGEC093P17 ma... 40 3.9
9gb|AC149301.1| Solanum demissum chromosome 5 clone PGEC517A09 ma... 40 3.9
10gb|AY730340.1| Solanum tuberosum strain P6/210 clone BAC BA87d17... 40 3.9
11gb|AY730336.1| Solanum tuberosum strain P6/210 clone BAC BA213c1... 40 3.9
12gb|AF025467.1| Caenorhabditis elegans cosmid R148, complete sequ... 40 3.9
13gb|AC118627.6| Mus musculus chromosome 15, clone RP24-91E8, comp... 40 3.9
14gb|AE017334.2| Bacillus anthracis str. 'Ames Ancestor', complete... 40 3.9
15gb|AE017225.1| Bacillus anthracis str. Sterne, complete genome 40 3.9
16gb|AC122172.30| Medicago truncatula clone mth2-27e7, complete se... 40 3.9
17emb|AL672187.12| Human DNA sequence from clone RP11-592B15 on ch... 40 3.9
18emb|AL611942.12| Human DNA sequence from clone RP11-125H17 on ch... 40 3.9
19emb|AL589943.26| Human DNA sequence from clone RP11-44D23 on chr... 40 3.9
20emb|AL450342.16| Human DNA sequence from clone RP11-481A12 on ch... 40 3.9
21emb|CR380954.1| Candida glabrata strain CBS138 chromosome H comp... 40 3.9
22emb|BX294098.11| Zebrafish DNA sequence from clone CH211-254P12 ... 40 3.9
23gb|AF526145.1| Peromyscus maniculatus microsatellite BW4-245 seq... 40 3.9
24gb|AC074044.8| Homo sapiens 3q BAC RP11-484K9 (Roswell Park Canc... 40 3.9
25gb|AC078778.34| Homo sapiens 12 BAC RP11-968A15 (Roswell Park Ca... 40 3.9
26gb|AC034099.16| Mus Musculus Strain C57BL6/J Chromosome 7 BAC, R... 40 3.9
27gb|AC119253.7| Mus musculus chromosome 15, clone RP24-279A15, co... 40 3.9
28gb|AE016879.1| Bacillus anthracis str. Ames, complete genome 40 3.9
29emb|AL731864.25| Mouse DNA sequence from clone RP23-342F20 on ch... 40 3.9
30gb|AC092957.6| Homo sapiens 3 BAC RP11-635I10 (Roswell Park Canc... 40 3.9

>gb|AC101854.8| Mus musculus chromosome 1, clone RP23-298H18, complete sequence
          Length = 190474

 Score = 42.1 bits (21), Expect = 1.00
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 26     tattttcataaagaaatagca 46
              |||||||||||||||||||||
Sbjct: 136403 tattttcataaagaaatagca 136423



to top

>ref|XM_643491.1| Entamoeba histolytica HM-1:IMSS coatomer beta subunit (427.t00002)
           partial mRNA
          Length = 2079

 Score = 42.1 bits (21), Expect = 1.00
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 88  caatagctaaactagaaataa 108
           |||||||||||||||||||||
Sbjct: 961 caatagctaaactagaaataa 941



to top

>ref|XM_649421.1| Entamoeba histolytica HM-1:IMSS coatmer beta subunit (51.t00032)
            partial mRNA
          Length = 2733

 Score = 42.1 bits (21), Expect = 1.00
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 88   caatagctaaactagaaataa 108
            |||||||||||||||||||||
Sbjct: 1615 caatagctaaactagaaataa 1595



to top

>gb|AC141923.27| Medicago truncatula clone mth2-7f19, complete sequence
          Length = 116685

 Score = 42.1 bits (21), Expect = 1.00
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                       
Query: 22     gagatattttcataaagaaatagca 46
              |||||||||| ||||||||||||||
Sbjct: 111642 gagatattttaataaagaaatagca 111618



to top

>emb|AL049831.2|CNS00008 Human chromosome 14 DNA sequence BAC R-330O19 of library RPCI-11 from
             chromosome 14 of Homo sapiens (Human), complete sequence
          Length = 218956

 Score = 42.1 bits (21), Expect = 1.00
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 28    ttttcataaagaaatagcatg 48
             |||||||||||||||||||||
Sbjct: 31130 ttttcataaagaaatagcatg 31110



to top

>ref|XM_529495.1| PREDICTED: Pan troglodytes LOC451954 (LOC451954), mRNA
          Length = 973

 Score = 40.1 bits (20), Expect = 3.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 183 atccaaaaagaattgtgttt 202
           ||||||||||||||||||||
Sbjct: 519 atccaaaaagaattgtgttt 500



to top

>gb|AC151815.1| Solanum demissum chromosome 5 clone PGEC472P22 map MAP_LOC, complete
             sequence
          Length = 136150

 Score = 40.1 bits (20), Expect = 3.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 116   tgaaatataatagttccaaa 135
             ||||||||||||||||||||
Sbjct: 34616 tgaaatataatagttccaaa 34635



to top

>gb|AC149290.1| Solanum demissum chromosome 5 clone PGEC093P17 map MAP_LOC, complete
             sequence
          Length = 200238

 Score = 40.1 bits (20), Expect = 3.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 116   tgaaatataatagttccaaa 135
             ||||||||||||||||||||
Sbjct: 13530 tgaaatataatagttccaaa 13511



to top

>gb|AC149301.1| Solanum demissum chromosome 5 clone PGEC517A09 map MAP_LOC, complete
             sequence
          Length = 133983

 Score = 40.1 bits (20), Expect = 3.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 116   tgaaatataatagttccaaa 135
             ||||||||||||||||||||
Sbjct: 84044 tgaaatataatagttccaaa 84025



to top

>gb|AY730340.1| Solanum tuberosum strain P6/210 clone BAC BA87d17, complete sequence
          Length = 75612

 Score = 40.1 bits (20), Expect = 3.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 116   tgaaatataatagttccaaa 135
             ||||||||||||||||||||
Sbjct: 27303 tgaaatataatagttccaaa 27322



to top

>gb|AY730336.1| Solanum tuberosum strain P6/210 clone BAC BA213c14, complete sequence
          Length = 72352

 Score = 40.1 bits (20), Expect = 3.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 116  tgaaatataatagttccaaa 135
            ||||||||||||||||||||
Sbjct: 8917 tgaaatataatagttccaaa 8936



to top

>gb|AF025467.1| Caenorhabditis elegans cosmid R148, complete sequence
          Length = 37154

 Score = 40.1 bits (20), Expect = 3.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 14   aacgaacagagatattttca 33
            ||||||||||||||||||||
Sbjct: 2527 aacgaacagagatattttca 2508



to top

>gb|AC118627.6| Mus musculus chromosome 15, clone RP24-91E8, complete sequence
          Length = 256158

 Score = 40.1 bits (20), Expect = 3.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 21    agagatattttcataaagaa 40
             ||||||||||||||||||||
Sbjct: 60233 agagatattttcataaagaa 60214



to top

>gb|AE017334.2| Bacillus anthracis str. 'Ames Ancestor', complete genome
          Length = 5227419

 Score = 40.1 bits (20), Expect = 3.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 113     atatgaaatataatagttcc 132
               ||||||||||||||||||||
Sbjct: 4332462 atatgaaatataatagttcc 4332481



to top

>gb|AE017225.1| Bacillus anthracis str. Sterne, complete genome
          Length = 5228663

 Score = 40.1 bits (20), Expect = 3.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 113     atatgaaatataatagttcc 132
               ||||||||||||||||||||
Sbjct: 4332835 atatgaaatataatagttcc 4332854



to top

>gb|AC122172.30| Medicago truncatula clone mth2-27e7, complete sequence
          Length = 109532

 Score = 40.1 bits (20), Expect = 3.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 145   atgatgaaacaaaagactag 164
             ||||||||||||||||||||
Sbjct: 28183 atgatgaaacaaaagactag 28164



to top

>emb|AL672187.12| Human DNA sequence from clone RP11-592B15 on chromosome 10 Contains the
              gene for a novel protein similar to ARF GTPase-activating
              protein (MRIP2), a poly (ADP-ribose) glycohydrolase (PARG)
              pseudogene, a novel gene, gene LOC347774, a novel gene, a
              ribosomal protein L35a (RPL35A) pseudogene, the TIMM23B
              gene for translocase of inner mitochondrial membrane 23
              homolog B (yeast) and two CpG islands, complete sequence
          Length = 211435

 Score = 40.1 bits (20), Expect = 3.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 25     atattttcataaagaaatag 44
              ||||||||||||||||||||
Sbjct: 158311 atattttcataaagaaatag 158330



to top

>emb|AL611942.12| Human DNA sequence from clone RP11-125H17 on chromosome 1 Contains the
             PRPF3 gene for PRP3 pre-mRNA processing factor 3 homolog
             (yeast) and the 5' end of the gene for a novel protein
             (KIAA0460), complete sequence
          Length = 151182

 Score = 40.1 bits (20), Expect = 3.9
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 102   gaaataataggatatgaaatataa 125
             ||||||||| ||||||||||||||
Sbjct: 73626 gaaataataagatatgaaatataa 73649



to top

>emb|AL589943.26| Human DNA sequence from clone RP11-44D23 on chromosome 10, complete
             sequence
          Length = 139325

 Score = 40.1 bits (20), Expect = 3.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 102   gaaataataggatatgaaat 121
             ||||||||||||||||||||
Sbjct: 36491 gaaataataggatatgaaat 36510



to top

>emb|AL450342.16| Human DNA sequence from clone RP11-481A12 on chromosome 10 Contains a
              pseudogene similar to part of ral guanine nucleotide
              dissociation stimulator (RALGDS), the MSMB gene for
              microseminoprotein beta, the NCOA4 gene for nuclear
              receptor coactivator 4, the TIMM23 gene for translocase of
              inner mitochondrial membrane 23, a  poly (ADP-ribose)
              glycohydrolase (PARG) pseudogene, a ribosomal protein L35a
              (RPL35A) pseudogene and three CpG islands, complete
              sequence
          Length = 190015

 Score = 40.1 bits (20), Expect = 3.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 25     atattttcataaagaaatag 44
              ||||||||||||||||||||
Sbjct: 116022 atattttcataaagaaatag 116003



to top

>emb|CR380954.1| Candida glabrata strain CBS138 chromosome H complete sequence
          Length = 1050361

 Score = 40.1 bits (20), Expect = 3.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 89     aatagctaaactagaaataa 108
              ||||||||||||||||||||
Sbjct: 353940 aatagctaaactagaaataa 353959



to top

>emb|BX294098.11| Zebrafish DNA sequence from clone CH211-254P12 in linkage group 24,
             complete sequence
          Length = 152545

 Score = 40.1 bits (20), Expect = 3.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 131   ccaaagttaacctaatgatg 150
             ||||||||||||||||||||
Sbjct: 76189 ccaaagttaacctaatgatg 76170



to top

>gb|AF526145.1| Peromyscus maniculatus microsatellite BW4-245 sequence
          Length = 472

 Score = 40.1 bits (20), Expect = 3.9
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 235 atgacatttcacagcccatgaaac 258
           ||||||||||||| ||||||||||
Sbjct: 191 atgacatttcacaacccatgaaac 214



to top

>gb|AC074044.8| Homo sapiens 3q BAC RP11-484K9 (Roswell Park Cancer Institute Human BAC
              Library) complete sequence
          Length = 194006

 Score = 40.1 bits (20), Expect = 3.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 25     atattttcataaagaaatag 44
              ||||||||||||||||||||
Sbjct: 182253 atattttcataaagaaatag 182234



to top

>gb|AC078778.34| Homo sapiens 12 BAC RP11-968A15 (Roswell Park Cancer Institute Human
             BAC Library) complete sequence
          Length = 141003

 Score = 40.1 bits (20), Expect = 3.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 183   atccaaaaagaattgtgttt 202
             ||||||||||||||||||||
Sbjct: 95901 atccaaaaagaattgtgttt 95882



to top

>gb|AC034099.16| Mus Musculus Strain C57BL6/J Chromosome 7 BAC, RP23-145I16, complete
              sequence
          Length = 229553

 Score = 40.1 bits (20), Expect = 3.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 103    aaataataggatatgaaata 122
              ||||||||||||||||||||
Sbjct: 140476 aaataataggatatgaaata 140495



to top

>gb|AC119253.7| Mus musculus chromosome 15, clone RP24-279A15, complete sequence
          Length = 163503

 Score = 40.1 bits (20), Expect = 3.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 21   agagatattttcataaagaa 40
            ||||||||||||||||||||
Sbjct: 4913 agagatattttcataaagaa 4932



to top

>gb|AE016879.1| Bacillus anthracis str. Ames, complete genome
          Length = 5227293

 Score = 40.1 bits (20), Expect = 3.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 113     atatgaaatataatagttcc 132
               ||||||||||||||||||||
Sbjct: 4332335 atatgaaatataatagttcc 4332354



to top

>emb|AL731864.25| Mouse DNA sequence from clone RP23-342F20 on chromosome 7, complete
             sequence
          Length = 148047

 Score = 40.1 bits (20), Expect = 3.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 103   aaataataggatatgaaata 122
             ||||||||||||||||||||
Sbjct: 90824 aaataataggatatgaaata 90805



to top

>gb|AC092957.6| Homo sapiens 3 BAC RP11-635I10 (Roswell Park Cancer Institute Human BAC
              Library) complete sequence
          Length = 161585

 Score = 40.1 bits (20), Expect = 3.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 150    gaaacaaaagactaggtaga 169
              ||||||||||||||||||||
Sbjct: 103999 gaaacaaaagactaggtaga 103980


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 3,638,698
Number of Sequences: 3902068
Number of extensions: 3638698
Number of successful extensions: 75512
Number of sequences better than 10.0: 30
Number of HSP's better than 10.0 without gapping: 30
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 75373
Number of HSP's gapped (non-prelim): 139
length of query: 301
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 279
effective length of database: 17,147,199,772
effective search space: 4784068736388
effective search space used: 4784068736388
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top