>emb|AL732366.7| Human DNA sequence from clone RP11-393H10 on chromosome X Contains a
novel gene (FLJ14503), the EIF1A gene for eukaryotic
translation initiation factor 1A (EIF4C, EIF1AX, eIF-1A,
eIF-4C), the 3' end of the RPS6KA3 gene for ribosomal
protein S6 kinase, 90kDa, polypeptide 3 (RSK, HU-2, HU-3,
RSK2, MRX19, ISPK-1, MAPKAPK1B), a novel gene and three CpG
islands, complete sequence
Length = 187275
Score = 36.2 bits (18), Expect = 2.7
Identities = 18/18 (100%)
Strand = Plus / Minus
Query: 13 ttgttgcacatttttgca 30
||||||||||||||||||
Sbjct: 148336 ttgttgcacatttttgca 148319
>emb|AL360182.15| Human DNA sequence from clone RP11-549L6 on chromosome 10 Contains
the MXI1 gene for MAX interacting protein 1 (MAD2,MXD2),
a ribosomal protein L21 (RPL21) pseudogene, a novel gene,
the SPF30 gene for splicing factor 30, survival of motor
neuron-related (SMNR) and three CpG islands, complete
sequence
Length = 145256
Score = 36.2 bits (18), Expect = 2.7
Identities = 21/22 (95%)
Strand = Plus / Plus
Query: 11 atttgttgcacatttttgcagc 32
|||||||| |||||||||||||
Sbjct: 9139 atttgttgaacatttttgcagc 9160
>emb|BX901920.9| Zebrafish DNA sequence from clone CH211-184M19 in linkage group 20,
complete sequence
Length = 119227
Score = 36.2 bits (18), Expect = 2.7
Identities = 21/22 (95%)
Strand = Plus / Minus
Query: 11 atttgttgcacatttttgcagc 32
|||||||| |||||||||||||
Sbjct: 58117 atttgttgtacatttttgcagc 58096
Database: nt
Posted date: May 29, 2006 11:10 AM
Number of letters in database: 3,984,495,279
Number of sequences in database: 917,343
Database: /shigen/export/home/twatanab/db/nt/nt.01
Posted date: May 29, 2006 11:16 AM
Number of letters in database: 3,988,174,986
Number of sequences in database: 835,257
Database: /shigen/export/home/twatanab/db/nt/nt.02
Posted date: May 29, 2006 11:21 AM
Number of letters in database: 3,991,246,324
Number of sequences in database: 771,481
Database: /shigen/export/home/twatanab/db/nt/nt.03
Posted date: May 29, 2006 11:27 AM
Number of letters in database: 3,990,718,311
Number of sequences in database: 977,174
Database: /shigen/export/home/twatanab/db/nt/nt.04
Posted date: May 29, 2006 11:29 AM
Number of letters in database: 1,278,410,368
Number of sequences in database: 400,813
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 344,707
Number of Sequences: 3902068
Number of extensions: 344707
Number of successful extensions: 91703
Number of sequences better than 10.0: 25
Number of HSP's better than 10.0 without gapping: 25
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 91538
Number of HSP's gapped (non-prelim): 165
length of query: 32
length of database: 17,233,045,268
effective HSP length: 20
effective length of query: 12
effective length of database: 17,155,003,908
effective search space: 205860046896
effective search space used: 205860046896
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 18 (36.2 bits)