ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbastl24e02
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1gb|AC122771.10| Mus musculus chromosome 1, clone RP24-156G20, co... 44 0.22
2gb|AC115063.8| Mus musculus chromosome 1, clone RP24-400H18, com... 42 0.88
3gb|AC123860.4| Mus musculus BAC clone RP23-349N13 from chromosom... 42 0.88
4gb|AC099612.6| Mus musculus chromosome 14, clone RP23-381M16, co... 42 0.88
5gb|AC158765.4| Mus musculus chromosome 1, clone RP24-218I23, com... 42 0.88
6gb|AC102866.5| Mus musculus chromosome 7, clone RP24-576L9, comp... 40 3.5
7gb|CP000081.1| Leishmania major chromosome 35, complete sequence 40 3.5
8gb|AC163491.2| Mus musculus chromosome 7, clone RP24-176N8, comp... 40 3.5
9gb|AC161170.7| Mus musculus chromosome 1, clone RP23-307G23, com... 40 3.5
10emb|AL162377.10| Human DNA sequence from clone RP11-327P2 on chr... 40 3.5
11emb|AL118522.32|HSDJ781B1 Human DNA sequence from clone RP4-781B... 40 3.5
12emb|AL139117.11| Human DNA sequence from clone RP1-52N12 on chro... 40 3.5
13gb|AC160648.3| Pan troglodytes BAC clone CH251-568C23 from chrom... 40 3.5
14gb|AC093531.2| Homo sapiens chromosome 5 clone RP11-405L7, compl... 40 3.5
15gb|AC175823.2| Pan troglodytes BAC clone CH251-175P6 from chromo... 40 3.5
16gb|AC087393.7| Homo sapiens chromosome 17, clone RP11-746M1, com... 40 3.5
17gb|AC092601.3| Homo sapiens BAC clone RP11-125M15 from 2, comple... 40 3.5
18gb|AC078929.27| Homo sapiens 12 BAC RP11-797M17 (Roswell Park Ca... 40 3.5
19gb|AC011515.4|AC011515 Homo sapiens chromosome 19 clone LLNLF-13... 40 3.5
20gb|AC147556.3| Mus musculus BAC clone RP23-480N14 from 1, comple... 40 3.5
21gb|AC171313.5| Mus musculus chromosome 7, clone RP23-294D10, com... 40 3.5

>gb|AC122771.10| Mus musculus chromosome 1, clone RP24-156G20, complete sequence
          Length = 207446

 Score = 44.1 bits (22), Expect = 0.22
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 138   cgctgtctccaaaagggggaaa 159
             ||||||||||||||||||||||
Sbjct: 97855 cgctgtctccaaaagggggaaa 97876



to top

>gb|AC115063.8| Mus musculus chromosome 1, clone RP24-400H18, complete sequence
          Length = 192133

 Score = 42.1 bits (21), Expect = 0.88
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 157   aaagaagaggatgaatagaag 177
             |||||||||||||||||||||
Sbjct: 83014 aaagaagaggatgaatagaag 83034



to top

>gb|AC123860.4| Mus musculus BAC clone RP23-349N13 from chromosome 14, complete
             sequence
          Length = 191104

 Score = 42.1 bits (21), Expect = 0.88
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 164   aggatgaatagaagaagcaag 184
             |||||||||||||||||||||
Sbjct: 33851 aggatgaatagaagaagcaag 33871



to top

>gb|AC099612.6| Mus musculus chromosome 14, clone RP23-381M16, complete sequence
          Length = 229545

 Score = 42.1 bits (21), Expect = 0.88
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 164    aggatgaatagaagaagcaag 184
              |||||||||||||||||||||
Sbjct: 223947 aggatgaatagaagaagcaag 223967



to top

>gb|AC158765.4| Mus musculus chromosome 1, clone RP24-218I23, complete sequence
          Length = 130451

 Score = 42.1 bits (21), Expect = 0.88
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 157    aaagaagaggatgaatagaag 177
              |||||||||||||||||||||
Sbjct: 101990 aaagaagaggatgaatagaag 102010



to top

>gb|AC102866.5| Mus musculus chromosome 7, clone RP24-576L9, complete sequence
          Length = 157163

 Score = 40.1 bits (20), Expect = 3.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 150    aagggggaaagaagaggatg 169
              ||||||||||||||||||||
Sbjct: 141519 aagggggaaagaagaggatg 141500



to top

>gb|CP000081.1| Leishmania major chromosome 35, complete sequence
          Length = 2090491

 Score = 40.1 bits (20), Expect = 3.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 173    agaagaagcaaggacacatg 192
              ||||||||||||||||||||
Sbjct: 812351 agaagaagcaaggacacatg 812332



to top

>gb|AC163491.2| Mus musculus chromosome 7, clone RP24-176N8, complete sequence
          Length = 164417

 Score = 40.1 bits (20), Expect = 3.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 150    aagggggaaagaagaggatg 169
              ||||||||||||||||||||
Sbjct: 112599 aagggggaaagaagaggatg 112580



to top

>gb|AC161170.7| Mus musculus chromosome 1, clone RP23-307G23, complete sequence
          Length = 222820

 Score = 40.1 bits (20), Expect = 3.5
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 148    aaaagggggaaagaagaggatgaa 171
              ||||||||||||||| ||||||||
Sbjct: 124382 aaaagggggaaagaataggatgaa 124405



to top

>emb|AL162377.10| Human DNA sequence from clone RP11-327P2 on chromosome 13 Contains 3
              novel genes, a meningioma-expressed antigen 6/11 (MEA6)
              (MEA11) pseudogene and the 3' end of the ATP7B gene for
              ATPase, Cu++ transporting, beta polypeptide (Wilson
              disease), complete sequence
          Length = 169104

 Score = 40.1 bits (20), Expect = 3.5
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                          
Query: 156    gaaagaagaggatgaatagaagaagcaa 183
              ||||||| |||| |||||||||||||||
Sbjct: 147498 gaaagaaaaggaggaatagaagaagcaa 147525



to top

>emb|AL118522.32|HSDJ781B1 Human DNA sequence from clone RP4-781B1 on chromosome 20 Contains the
            5' end of a novel gene, the KCNK15 gene for potassium
            channel subfamily K member 15, a novel gene, the RIMS4
            gene for regulating synaptic membrane exocytosis 4 and
            three CpG islands, complete sequence
          Length = 107109

 Score = 40.1 bits (20), Expect = 3.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 16   ttcccctgctgtttatttgg 35
            ||||||||||||||||||||
Sbjct: 2657 ttcccctgctgtttatttgg 2638



to top

>emb|AL139117.11| Human DNA sequence from clone RP1-52N12 on chromosome 19, complete
              sequence
          Length = 148497

 Score = 40.1 bits (20), Expect = 3.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 153    ggggaaagaagaggatgaat 172
              ||||||||||||||||||||
Sbjct: 106819 ggggaaagaagaggatgaat 106800



to top

>gb|AC160648.3| Pan troglodytes BAC clone CH251-568C23 from chromosome unknown, complete
              sequence
          Length = 205923

 Score = 40.1 bits (20), Expect = 3.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 153    ggggaaagaagaggatgaat 172
              ||||||||||||||||||||
Sbjct: 126008 ggggaaagaagaggatgaat 125989



to top

>gb|AC093531.2| Homo sapiens chromosome 5 clone RP11-405L7, complete sequence
          Length = 163803

 Score = 40.1 bits (20), Expect = 3.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 198   attgctcaggatgtgggagg 217
             ||||||||||||||||||||
Sbjct: 59729 attgctcaggatgtgggagg 59748



to top

>gb|AC175823.2| Pan troglodytes BAC clone CH251-175P6 from chromosome unknown, complete
              sequence
          Length = 176244

 Score = 40.1 bits (20), Expect = 3.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 153    ggggaaagaagaggatgaat 172
              ||||||||||||||||||||
Sbjct: 158417 ggggaaagaagaggatgaat 158398



to top

>gb|AC087393.7| Homo sapiens chromosome 17, clone RP11-746M1, complete sequence
          Length = 235968

 Score = 40.1 bits (20), Expect = 3.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 214    gagggacacacacttggacg 233
              ||||||||||||||||||||
Sbjct: 176124 gagggacacacacttggacg 176105



to top

>gb|AC092601.3| Homo sapiens BAC clone RP11-125M15 from 2, complete sequence
          Length = 198364

 Score = 40.1 bits (20), Expect = 3.5
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 159   agaagaggatgaatagaagaagca 182
             ||||||||||||||||||| ||||
Sbjct: 66975 agaagaggatgaatagaagtagca 66998



to top

>gb|AC078929.27| Homo sapiens 12 BAC RP11-797M17 (Roswell Park Cancer Institute Human
             BAC Library) complete sequence
          Length = 107895

 Score = 40.1 bits (20), Expect = 3.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 200   tgctcaggatgtgggaggga 219
             ||||||||||||||||||||
Sbjct: 91476 tgctcaggatgtgggaggga 91457



to top

>gb|AC011515.4|AC011515 Homo sapiens chromosome 19 clone LLNLF-139A9, complete sequence
          Length = 47084

 Score = 40.1 bits (20), Expect = 3.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 153   ggggaaagaagaggatgaat 172
             ||||||||||||||||||||
Sbjct: 29820 ggggaaagaagaggatgaat 29801



to top

>gb|AC147556.3| Mus musculus BAC clone RP23-480N14 from 1, complete sequence
          Length = 175641

 Score = 40.1 bits (20), Expect = 3.5
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 148    aaaagggggaaagaagaggatgaa 171
              ||||||||||||||| ||||||||
Sbjct: 155873 aaaagggggaaagaataggatgaa 155896



to top

>gb|AC171313.5| Mus musculus chromosome 7, clone RP23-294D10, complete sequence
          Length = 208997

 Score = 40.1 bits (20), Expect = 3.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 150   aagggggaaagaagaggatg 169
             ||||||||||||||||||||
Sbjct: 71169 aagggggaaagaagaggatg 71188


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 2,461,749
Number of Sequences: 3902068
Number of extensions: 2461749
Number of successful extensions: 46714
Number of sequences better than 10.0: 21
Number of HSP's better than 10.0 without gapping: 21
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 46670
Number of HSP's gapped (non-prelim): 44
length of query: 268
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 246
effective length of database: 17,147,199,772
effective search space: 4218211143912
effective search space used: 4218211143912
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top