>gb|AC136729.7| Mus musculus chromosome 3, clone RP23-175I24, complete sequence
          Length = 216602

 Score = 40.1 bits (20), Expect = 0.92
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 44     ctgactgccagttcccatcc 63
              ||||||||||||||||||||
Sbjct: 101012 ctgactgccagttcccatcc 101031

>ref|XM_415585.1| PREDICTED: Gallus gallus similar to dynein, axonemal, heavy polypeptide
             9 isoform 2; dynein, axonemal, light intermediate chain 1;
             dynein, axonemal, heavy polypeptide 17-like; ciliary
             dynein heavy chain (LOC417314), mRNA
          Length = 16433

 Score = 38.2 bits (19), Expect = 3.6
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 51    ccagttcccatcctgcagg 69
             |||||||||||||||||||
Sbjct: 10761 ccagttcccatcctgcagg 10779

>emb|CR962133.1| Medicago truncatula chromosome 5 clone mth2-17h8, COMPLETE SEQUENCE
          Length = 114811

 Score = 38.2 bits (19), Expect = 3.6
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 9     aaaggaaaagcacttcata 27
             |||||||||||||||||||
Sbjct: 72053 aaaggaaaagcacttcata 72035

>gb|BC034599.1| Mus musculus zinc finger, CCCH-type with G patch domain, mRNA (cDNA
            clone IMAGE:5364834), **** WARNING: chimeric clone ****
          Length = 3709

 Score = 38.2 bits (19), Expect = 3.6
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                               
Query: 56   tcccatcctgcaggttcag 74
            |||||||||||||||||||
Sbjct: 3380 tcccatcctgcaggttcag 3362

>gb|AF115339.1| Mus musculus Lck-interacting transmembrane adaptor protein LIME mRNA,
            complete cds
          Length = 1987

 Score = 38.2 bits (19), Expect = 3.6
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                               
Query: 56   tcccatcctgcaggttcag 74
            |||||||||||||||||||
Sbjct: 1673 tcccatcctgcaggttcag 1655

>gb|AC122876.4| Mus musculus BAC clone RP23-113K14 from 3, complete sequence
          Length = 190123

 Score = 38.2 bits (19), Expect = 3.6
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                               
Query: 31   tagtgaaaggtgactgact 49
            |||||||||||||||||||
Sbjct: 1611 tagtgaaaggtgactgact 1593

>gb|AC084384.1| Mus musculus BAC clone RP23-24F24 from 15, complete sequence
          Length = 208833

 Score = 38.2 bits (19), Expect = 3.6
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 16     aagcacttcatatgttagt 34
              |||||||||||||||||||
Sbjct: 123913 aagcacttcatatgttagt 123931

>gb|AC107611.6| Rattus norvegicus 10 BAC CH230-195I24 (Children's Hospital Oakland
              Research Institute) complete sequence
          Length = 211076

 Score = 38.2 bits (19), Expect = 3.6
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 50     gccagttcccatcctgcag 68
              |||||||||||||||||||
Sbjct: 163602 gccagttcccatcctgcag 163620

>emb|BX957269.5| Zebrafish DNA sequence from clone CH211-12C22 in linkage group 6,
             complete sequence
          Length = 174814

 Score = 38.2 bits (19), Expect = 3.6
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 32    agtgaaaggtgactgactg 50
             |||||||||||||||||||
Sbjct: 89269 agtgaaaggtgactgactg 89251

>emb|BX000688.11| Human DNA sequence from clone DAQB-36F16 on chromosome 6 Contains the
             GPR53P pseudogene for G protein-coupled receptor 53, the
             OR2I1P pseudogene for olfactory receptor, family 2,
             subfamily I, member 1, the UBD gene for ubiquitin D, the
             OR2H5P pseudogene for olfactory receptor, family 2,
             subfamily H, member 5, the RPL13AP pseudogene for
             ribosomal protein L13a, the OR2H2 gene for olfactory
             receptor, family 2, subfamily H, member 2, the GABBR1 gene
             for gamma-aminobutyric acid (GABA) B receptor, 1, and 3
             CpG islands, complete sequence
          Length = 102684

 Score = 38.2 bits (19), Expect = 3.6
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 5     ggggaaaggaaaagcactt 23
             |||||||||||||||||||
Sbjct: 27329 ggggaaaggaaaagcactt 27311

>emb|AL662826.11| Human DNA sequence from clone XXbac-101I20 on chromosome 6 contains a
             MAS1 oncogene pseudogene, a olfactory receptor, family 2,
             subfamily I, member 1 pseudogene (OR2I1P, HS6M1-14P), the
             UBD gene for ubiquitin D (FAT10), a olfactory receptor,
             family 2, subfamily H, member 5 pseudogene (OR2H5P,
             HS6M1-13P), a 60S ribosomal protein L13A (RPL13A)
             pseudogene, the OR2H2 gene for olfactory receptor, family
             2, subfamily H, member 2 (HS6M1-12), the GABBR1 gene for
             gamma-aminobutryic acid (GABA) B receptor, 1 (GPRC3A,
             GABABR1), the 5' end of the MOG gene for myelin
             oligodendrocyte protein and three CpG islands, complete
             sequence
          Length = 145431

 Score = 38.2 bits (19), Expect = 3.6
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 5     ggggaaaggaaaagcactt 23
             |||||||||||||||||||
Sbjct: 33763 ggggaaaggaaaagcactt 33745

>emb|AL645936.5| Human DNA sequence from clone XXbac-126D10 on chromosome 6 contains the
             OR2H2 gene for olfactory receptor, family 2, subfamily H,
             member 2, the OR2I1P and OR2H5P pseudogenes for olfactory
             receptor, family 2, subfamily I, member 1 and subfamily H,
             member 5, the UBD gene for ubiquitin D, a 60S ribosomal
             protein L13A (RPL13A) pseudogene, the GABBR1 gene for
             gamma-aminobutyric acid (GABA) B receptor, 1, a SMT3
             suppressor of mif two 3 homolog 1 (SMT3H1) pseudogene, the
             MOG gene for myelin oligodendrocyte glycoprotein, the gene
             for a novel KRAB box-containing C2H2 type zinc finger
             protein and four CpG islands, complete sequence
          Length = 155874

 Score = 38.2 bits (19), Expect = 3.6
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 5     ggggaaaggaaaagcactt 23
             |||||||||||||||||||
Sbjct: 10634 ggggaaaggaaaagcactt 10616

>ref|NM_023684.1| Mus musculus Lck interacting transmembrane adaptor 1 (Lime1), mRNA
          Length = 1987

 Score = 38.2 bits (19), Expect = 3.6
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                               
Query: 56   tcccatcctgcaggttcag 74
            |||||||||||||||||||
Sbjct: 1673 tcccatcctgcaggttcag 1655

>emb|AL596095.18| Mouse DNA sequence from clone RP23-188H3 on chromosome 11 Contains the
             3' end of the Il4 gene for interleukin 4, the Kif3a gene
             for kinesin family member 3A, a novel gene, the Sept8 gene
             for septin 8, a ribosomal protein L9 (RPL9) pseudogene,
             three novel genes (A830006N08) (1300007L22Rik) and six CpG
             islands, complete sequence
          Length = 170943

 Score = 38.2 bits (19), Expect = 3.6
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                    
Query: 46    gactgccagttcccatcctgcag 68
             ||||| |||||||||||||||||
Sbjct: 29337 gactggcagttcccatcctgcag 29315

>emb|CR759770.3| Human DNA sequence from clone DADB-115L1 on chromosome 6, complete
             sequence
          Length = 52550

 Score = 38.2 bits (19), Expect = 3.6
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 5     ggggaaaggaaaagcactt 23
             |||||||||||||||||||
Sbjct: 33030 ggggaaaggaaaagcactt 33012

>emb|AL928965.35| Mouse DNA sequence from clone RP23-60M5 on chromosome 2, complete
             sequence
          Length = 92250

 Score = 38.2 bits (19), Expect = 3.6
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 56    tcccatcctgcaggttcag 74
             |||||||||||||||||||
Sbjct: 77576 tcccatcctgcaggttcag 77558

>emb|CR759766.5| Human DNA sequence from clone DAMA-BMC177C8 on chromosome 6, complete
            sequence
          Length = 127280

 Score = 38.2 bits (19), Expect = 3.6
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                               
Query: 5    ggggaaaggaaaagcactt 23
            |||||||||||||||||||
Sbjct: 5669 ggggaaaggaaaagcactt 5651

>emb|CR788300.6| Human DNA sequence from clone DAAP-188P13 on chromosome 6, complete
             sequence
          Length = 78908

 Score = 38.2 bits (19), Expect = 3.6
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 5     ggggaaaggaaaagcactt 23
             |||||||||||||||||||
Sbjct: 31047 ggggaaaggaaaagcactt 31029

>emb|BX005430.14| Zebrafish DNA sequence from clone DKEY-19E4 in linkage group 6, complete
              sequence
          Length = 209866

 Score = 38.2 bits (19), Expect = 3.6
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 32     agtgaaaggtgactgactg 50
              |||||||||||||||||||
Sbjct: 143448 agtgaaaggtgactgactg 143466

>ref|XM_693698.1| PREDICTED: Danio rerio similar to plexin B1 (LOC570241), mRNA
          Length = 2877

 Score = 38.2 bits (19), Expect = 3.6
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 32  agtgaaaggtgactgactg 50
           |||||||||||||||||||
Sbjct: 591 agtgaaaggtgactgactg 573

>ref|XM_693617.1| PREDICTED: Danio rerio similar to plexin B1 (LOC570172), mRNA
          Length = 3255

 Score = 38.2 bits (19), Expect = 3.6
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 32  agtgaaaggtgactgactg 50
           |||||||||||||||||||
Sbjct: 969 agtgaaaggtgactgactg 951

>gb|AC006137.3|AC006137 Homo sapiens clone SCb-254N2 (UWGC:rg254N02) from 6p21, complete
             sequence
          Length = 129806

 Score = 38.2 bits (19), Expect = 3.6
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 5     ggggaaaggaaaagcactt 23
             |||||||||||||||||||
Sbjct: 97544 ggggaaaggaaaagcactt 97562

>emb|BX927223.9| Human DNA sequence from clone DAMA-380P17 on chromosome 6, complete
             sequence
          Length = 83649

 Score = 38.2 bits (19), Expect = 3.6
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 5     ggggaaaggaaaagcactt 23
             |||||||||||||||||||
Sbjct: 53638 ggggaaaggaaaagcactt 53620

>dbj|AK172632.1| Mus musculus activated spleen cDNA, RIKEN full-length enriched
           library, clone:F830221O09 product:Lck-interacting
           transmembrane adaptor protein LIME (RIKEN cDNA
           2810038K19 gene) homolog [Mus musculus], full insert
           sequence
          Length = 900

 Score = 38.2 bits (19), Expect = 3.6
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 56  tcccatcctgcaggttcag 74
           |||||||||||||||||||
Sbjct: 619 tcccatcctgcaggttcag 601

>dbj|AK012881.1| Mus musculus 10, 11 days embryo whole body cDNA, RIKEN full-length
           enriched library, clone:2810038K19
           product:LCK-INTERACTING TRANSMEMBRANE ADAPTOR PROTEIN
           LIME, full insert sequence
          Length = 1020

 Score = 38.2 bits (19), Expect = 3.6
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 56  tcccatcctgcaggttcag 74
           |||||||||||||||||||
Sbjct: 736 tcccatcctgcaggttcag 718

>gb|AC148689.1| Macaca mulatta Major Histocompatibility Complex BAC MMU222I18, complete
             sequence
          Length = 174202

 Score = 38.2 bits (19), Expect = 3.6
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 5     ggggaaaggaaaagcactt 23
             |||||||||||||||||||
Sbjct: 81030 ggggaaaggaaaagcactt 81012

>gb|BC023065.1| Mus musculus Lck interacting transmembrane adaptor 1, mRNA (cDNA
            clone MGC:35801 IMAGE:5357176), complete cds
          Length = 1317

 Score = 38.2 bits (19), Expect = 3.6
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                               
Query: 56   tcccatcctgcaggttcag 74
            |||||||||||||||||||
Sbjct: 1017 tcccatcctgcaggttcag 999

>dbj|AK173276.1| Mus musculus premature mRNA for mKIAA1847 protein
          Length = 4892

 Score = 38.2 bits (19), Expect = 3.6
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                               
Query: 56   tcccatcctgcaggttcag 74
            |||||||||||||||||||
Sbjct: 4608 tcccatcctgcaggttcag 4590

>emb|BX530067.4| Zebrafish DNA sequence from clone DKEY-194C21 in linkage group 19,
             complete sequence
          Length = 203882

 Score = 38.2 bits (19), Expect = 3.6
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 63    ctgcaggttcaggtccaaa 81
             |||||||||||||||||||
Sbjct: 80906 ctgcaggttcaggtccaaa 80888

>gb|AC011013.17|AC011013 Mus musculus chromosome 11, clone RP23-218N2, complete sequence
          Length = 201728

 Score = 38.2 bits (19), Expect = 3.6
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                     
Query: 46     gactgccagttcccatcctgcag 68
              ||||| |||||||||||||||||
Sbjct: 191189 gactggcagttcccatcctgcag 191167

>gb|AC115062.13| Mus musculus chromosome 3, clone RP24-399B3, complete sequence
          Length = 198727

 Score = 38.2 bits (19), Expect = 3.6
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 31    tagtgaaaggtgactgact 49
             |||||||||||||||||||
Sbjct: 42700 tagtgaaaggtgactgact 42718

>dbj|AP006193.1| Homo sapiens genomic DNA, chromosome 3, clone:RP11-815I22, complete
             sequence
          Length = 205834

 Score = 38.2 bits (19), Expect = 3.6
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 48    ctgccagttcccatcctgc 66
             |||||||||||||||||||
Sbjct: 82756 ctgccagttcccatcctgc 82738

>emb|AL031983.2|HS271M21 Human DNA sequence from clone RP1-271M21 on chromosome 6p21.31-22.2
             Contains a MAS1 oncogene pseudogene, the OR2H2 gene for
             olfactory receptor 2H2, olfactory receptor 2I1 and 2H5
             pseudogenes OR2I1P and OR2H5P, the gene for diubiquitin,
             an RPL13A (60S Ribosomal Protein L13A) pseudogene, the
             GABBR1 gene for gamma-aminobutyric acid (GABA) B receptor
             1 and an SMT3H1 or SMT3H2 (SMT3 (suppressor of mif two 3,
             yeast) homolog) pseudogene and three CpG islands, complete
             sequence
          Length = 134292

 Score = 38.2 bits (19), Expect = 3.6
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 5     ggggaaaggaaaagcactt 23
             |||||||||||||||||||
Sbjct: 56046 ggggaaaggaaaagcactt 56028

>dbj|AB030447.1| Cyprinus carpio MRPb and MASPb genes for mannose-binding
           lectin-associated serine protease (MASP) and
           MASP-related protein, complete cds
          Length = 2753

 Score = 38.2 bits (19), Expect = 3.6
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 31  tagtgaaaggtgactgact 49
           |||||||||||||||||||
Sbjct: 720 tagtgaaaggtgactgact 702

>dbj|AB020780.1| Cyprinus carpio mRNA for truncated form of mannose-binding
            lectin-associated serine protease, complete cds
          Length = 1584

 Score = 38.2 bits (19), Expect = 3.6
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                               
Query: 31   tagtgaaaggtgactgact 49
            |||||||||||||||||||
Sbjct: 1204 tagtgaaaggtgactgact 1186

>dbj|AP000500.1| Homo sapiens genomic DNA, chromosome 3p21.3, clone:603 to 320,
             anti-oncogene region, section 3/3
          Length = 254437

 Score = 38.2 bits (19), Expect = 3.6
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 48    ctgccagttcccatcctgc 66
             |||||||||||||||||||
Sbjct: 32981 ctgccagttcccatcctgc 32999

>dbj|AB026898.1| Homo sapiens DNA, DLEC1 to ORCTL4 gene region, section 1/2 (DLEC1,
              ORCTL3, ORCTL4 genes, complete cds)
          Length = 270000

 Score = 38.2 bits (19), Expect = 3.6
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 48     ctgccagttcccatcctgc 66
              |||||||||||||||||||
Sbjct: 265652 ctgccagttcccatcctgc 265670


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 893,607
Number of Sequences: 3902068
Number of extensions: 893607
Number of successful extensions: 67928
Number of sequences better than 10.0: 37
Number of HSP's better than 10.0 without gapping: 37
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 67884
Number of HSP's gapped (non-prelim): 44
length of query: 86
length of database: 17,233,045,268
effective HSP length: 21
effective length of query: 65
effective length of database: 17,151,101,840
effective search space: 1114821619600
effective search space used: 1114821619600
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 19 (38.2 bits)