ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbastl24c11
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1gb|M36658.1|MZEH3A Corn histone H3 (H3C3) gene, complete cds 440 e-120
2gb|BT017805.1| Zea mays clone EL01N0506E02.c mRNA sequence 432 e-118
3gb|AC134048.3| Oryza sativa (japonica cultivar-group) chromosome... 424 e-115
4gb|AC112209.4| Oryza sativa (japonica cultivar-group) chromosome... 424 e-115
5emb|X13680.1|OSHIS321 Oryza sativa H3 histone H3R-21 clone RH3-2 424 e-115
6dbj|AP008217.1| Oryza sativa (japonica cultivar-group) genomic D... 424 e-115
7gb|DP000010.1| Oryza sativa (japonica cultivar-group) chromosome... 424 e-115
8gb|U77296.1|OSU77296 Oryza sativa histone 3 mRNA, complete cds 424 e-115
9ref|NM_185612.1| Oryza sativa (japonica cultivar-group), predic... 418 e-114
10dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic D... 418 e-114
11dbj|AP005828.2| Oryza sativa (japonica cultivar-group) genomic D... 418 e-114
12dbj|AB026295.2| Oryza sativa (japonica cultivar-group) genomic D... 418 e-114
13ref|NM_185609.1| Oryza sativa (japonica cultivar-group), predic... 410 e-111
14emb|X13679.1|OSHIS3PS Oryza sativa H3 histone pseudogene H3R-12 410 e-111
15emb|X13678.1|OSHIS311 Oryza sativa H3 histone gene H3R-11 400 e-108
16emb|X00937.1|TAHI02 Wheat histone H3 gene 400 e-108
17ref|NM_185607.1| Oryza sativa (japonica cultivar-group), predic... 398 e-108
18gb|U25664.1|OSU25664 Oryza sativa histone H3 gene, complete cds 394 e-107
19gb|M15664.1|RICHIS3 Rice histone 3 gene, complete cds 394 e-107
20ref|XM_475315.1| Oryza sativa (japonica cultivar-group), predic... 392 e-106
21gb|AC134930.2| Oryza sativa (japonica cultivar-group) chromosome... 392 e-106
22dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic D... 392 e-106
23dbj|AK120955.1| Oryza sativa (japonica cultivar-group) cDNA clon... 392 e-106
24ref|NM_185613.1| Oryza sativa (japonica cultivar-group), predic... 391 e-105
25gb|M35388.1|MZEHISH3A Zea mays histone H3 gene, complete cds 389 e-105
26gb|M13378.1|MZEH3C2 Maize (Zea mays) histone H3 gene (H3C2), com... 389 e-105
27dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic D... 379 e-102
28dbj|AP003270.4| Oryza sativa (japonica cultivar-group) genomic D... 379 e-102
29dbj|AK108078.1| Oryza sativa (japonica cultivar-group) cDNA clon... 379 e-102
30ref|NM_190750.1| Oryza sativa (japonica cultivar-group), predic... 377 e-101
31ref|XM_493701.1| Oryza sativa (japonica cultivar-group), mRNA 375 e-101
32dbj|AP000559.1| Oryza sativa (japonica cultivar-group) genomic D... 375 e-101
33gb|AF093633.1|AF093633 Oryza sativa histone H3 mRNA, complete cds 375 e-101
34dbj|AB205017.1| Lolium multiflorum gene for replacement histone ... 369 5e-99
35ref|XM_472456.1| Oryza sativa (japonica cultivar-group), predic... 365 8e-98
36emb|X79714.1|LTMRHIS3 L.temulentum mRNA for histone H3 365 8e-98
37dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic D... 365 8e-98
38emb|AL606618.4|OSJN00062 Oryza sativa genomic DNA, chromosome 4,... 365 8e-98
39gb|BT018930.1| Zea mays clone Contig60.F mRNA sequence 353 3e-94
40emb|X84377.1|ZMHIS3DNA Z.mays histone H3 gene 353 3e-94
41gb|M13379.1|MZEH3C4 Maize (Zea mays) histone H3 gene (H3C4), com... 341 1e-90
42gb|BT018950.1| Zea mays clone Contig110.F mRNA sequence 335 7e-89
43gb|BT018179.1| Zea mays clone EL01N0557G06.c mRNA sequence 333 3e-88
44emb|Y08528.1|OSHISTON3 Oryza sativa mRNA for histone 3 333 3e-88
45gb|M34928.1|BLYHISH3PA Barley histone H3 mRNA, 3' end 329 4e-87
46gb|BT016934.1| Zea mays clone E04912703G10.c mRNA sequence 323 3e-85
47ref|XM_425464.1| PREDICTED: Gallus gallus similar to histone pro... 299 4e-78
48ref|XM_416198.1| PREDICTED: Gallus gallus similar to GLP_39_8822... 299 4e-78
49ref|XM_416190.1| PREDICTED: Gallus gallus similar to GLP_39_8822... 299 4e-78
50gb|U37579.1|GGU37579 Gallus gallus histone H3-VIII gene, complet... 299 4e-78
51gb|U37577.1|GGU37577 Gallus gallus histone H3-VI gene, complete cds 299 4e-78
52gb|BT017332.1| Zea mays clone EL01N0320H03.c mRNA sequence 297 1e-77
53emb|X02218.1|GGHIS1 Chicken duplicated genes for histone H2A, H4... 293 2e-76
54ref|XM_416186.1| PREDICTED: Gallus gallus similar to GLP_39_8822... 291 9e-76
55emb|CR390239.1| Gallus gallus finished cDNA, clone ChEST932d15 291 9e-76
56emb|X62291.1|GGHISH3IV G.gallus gene for histone H3-IV 291 9e-76
57emb|X62292.1|GGHISH3V G.gallus gene for histone H3-V 291 9e-76
58gb|U37578.1|GGU37578 Gallus gallus histone H3-VII gene, complete... 291 9e-76
59gb|M61155.1|CHKH3AB Chicken histone H3 gene, complete cds 291 9e-76
60gb|M61154.1|CHKH3AA Chicken histone H3 gene, complete cds 291 9e-76
61ref|XM_416193.1| PREDICTED: Gallus gallus similar to histone pro... 285 6e-74
62gb|U38422.1|TAU38422 Triticum aestivum histone H3 gene, partial ... 283 2e-73
63gb|AF140033.1|AF140033 Phreatamoeba balamuthi histone H3 mRNA, c... 281 9e-73
64emb|X14732.1|CMHIST34 Duck H3 and H4 histone genes 276 5e-71
65gb|U38423.1|TAU38423 Triticum aestivum histone H3 gene, partial ... 276 5e-71
66gb|AY125231.1| Melanoplus sp. OR18 histone 3 gene, partial cds 272 8e-70
67ref|XM_849194.1| PREDICTED: Canis familiaris similar to histone ... 270 3e-69
68ref|XM_545420.2| PREDICTED: Canis familiaris similar to histone ... 270 3e-69
69ref|XM_545399.1| PREDICTED: Canis familiaris similar to histone ... 270 3e-69
70ref|XM_545397.2| PREDICTED: Canis familiaris similar to histone ... 270 3e-69
71ref|XM_848810.1| PREDICTED: Canis familiaris similar to histone ... 270 3e-69
72ref|XM_848782.1| PREDICTED: Canis familiaris similar to histone ... 270 3e-69
73ref|XM_545429.1| PREDICTED: Canis familiaris similar to histone ... 270 3e-69
74ref|XM_545385.1| PREDICTED: Canis familiaris similar to histone ... 270 3e-69
75ref|XM_854155.1| PREDICTED: Canis familiaris similar to histone ... 270 3e-69
76ref|XM_537880.2| PREDICTED: Canis familiaris similar to histone ... 270 3e-69
77ref|XM_545428.1| PREDICTED: Canis familiaris similar to histone ... 268 1e-68
78gb|AC146538.2| Gasterosteus aculeatus clone CH213-118G22, comple... 266 5e-68
79ref|XM_845651.1| PREDICTED: Canis familiaris similar to CG31613-... 264 2e-67
80gb|U38420.1|HVU38420 Hordeum vulgare histone H3 gene, partial cd... 258 1e-65
81ref|XM_540290.1| PREDICTED: Canis familiaris similar to H3 histo... 250 3e-63
82ref|XM_540285.1| PREDICTED: Canis familiaris similar to H3 histo... 250 3e-63
83gb|AY125229.1| Argia vivida histone 3 gene, partial cds 248 1e-62
84gb|AY749755.1| Griseargiolestes albescens histone H3 (H3) gene, ... 248 1e-62
85gb|AY749753.1| Diphlebia coerulescens histone H3 (H3) gene, part... 248 1e-62
86gb|DQ393956.1| Cydia pomonella clone Cp4.140 microsatellite sequ... 246 5e-62
87gb|DQ393939.1| Cydia pomonella clone Cp4.P microsatellite sequence 246 5e-62
88gb|DQ393935.1| Cydia pomonella clone Cp4.118 microsatellite sequ... 246 5e-62
89gb|DQ393934.1| Cydia pomonella clone Cp4.100 microsatellite sequ... 246 5e-62
90ref|XM_782287.1| PREDICTED: Strongylocentrotus purpuratus simila... 242 8e-61
91ref|XM_780065.1| PREDICTED: Strongylocentrotus purpuratus simila... 242 8e-61
92gb|AY125232.1| Pterophylla camellifolia histone 3 gene, partial cds 240 3e-60
93ref|XM_599846.2| PREDICTED: Bos taurus similar to histone 1, H2a... 238 1e-59
94ref|XM_848995.1| PREDICTED: Canis familiaris similar to histone ... 238 1e-59
95gb|DQ393931.1| Cydia pomonella clone Cp4.61 microsatellite sequence 238 1e-59
96gb|AF517884.1| Griffithsia japonica isolate Gj475 histone H3.3 p... 234 2e-58
97gb|AY749705.1| Choroterpes sp. EP024 histone H3 (H3) gene, parti... 232 7e-58
98gb|AY749702.1| Thraulodes sp. EP014 histone H3 (H3) gene, partia... 232 7e-58
99gb|AY521721.1| Gryllotalpidae sp. BYU_ACOR020 histone H3 (H3) ge... 230 3e-57
100gb|AY521718.1| Romalea sp. BYU_ACOR015 histone H3 (H3) gene, par... 230 3e-57
101ref|NM_178216.1| Mus musculus histone 2, H3c1 (Hist2h3c1), trans... 226 5e-56
102gb|BC080809.1| Mus musculus cDNA clone IMAGE:6466339 226 5e-56
103ref|XM_886396.1| PREDICTED: Mus musculus histone 2, H3c1 (Hist2h... 226 5e-56
104emb|X80330.1|CLH2A232 C.longicaudatus genes for histones H2a.2 a... 226 5e-56
105dbj|AK134918.1| Mus musculus adult male olfactory brain cDNA, RI... 226 5e-56
106gb|U62675.1|MMU62675 Mus musculus histone H3.2-616 (H3-616), and... 226 5e-56
107gb|U62674.1|MMU62674 Mus musculus histone H2a.2-615 (H2a-615), ... 226 5e-56
108ref|NG_002616.1| Homo sapiens histone 2, H3b (HIST2H3B) pseudoge... 226 5e-56
109gb|BC094041.1| Mus musculus histone 2, H3c1, mRNA (cDNA clone MG... 226 5e-56
110gb|AF531306.1| Homo sapiens histone H3 (HIST2H3B) pseudogene, co... 226 5e-56
111ref|XM_227461.2| PREDICTED: Rattus norvegicus similar to histone... 226 5e-56
112gb|AY158955.1| Mus musculus histone protein Hist2h3b gene, compl... 226 5e-56
113gb|AY158954.1| Mus musculus histone protein Hist2h3c1 gene, comp... 226 5e-56
114gb|AY158941.1| Mus musculus histone protein Hist2h2bb gene, comp... 226 5e-56
115gb|AC093350.15| Mus musculus chromosome 3, clone RP23-16G3, comp... 226 5e-56
116gb|AC125099.3| Mus musculus BAC clone RP24-201C14 from 3, comple... 226 5e-56
117ref|NM_178215.1| Mus musculus histone 2, H3b (Hist2h3b), mRNA 226 5e-56
118gb|M32461.1|MUSHIS3C Mouse histone H3 (H3.2-614) gene, complete cds 226 5e-56
119gb|J01175.1|SULHISL34 Sea urchin (L.pictus) late-stage histone H... 226 5e-56
120ref|NM_178206.2| Mus musculus histone 1, H3h (Hist1h3h), mRNA 224 2e-55
121ref|XM_781054.1| PREDICTED: Strongylocentrotus purpuratus simila... 224 2e-55
122emb|AL589651.8| Mouse DNA sequence from clone RP23-138F20 on chr... 224 2e-55
123ref|XM_227460.3| PREDICTED: Rattus norvegicus histone 2, H3c2 (p... 224 2e-55
124gb|AY158944.1| Mus musculus histone protein Hist1h3h gene, compl... 224 2e-55
125gb|AY338635.1| Chaquihua sp. EP080 histone 3 gene, partial cds 224 2e-55
126gb|AY338626.1| Coloburiscus humeralis histone 3 gene, partial cds 224 2e-55
127gb|AY749744.1| Dipteromimus sp. EP150 histone H3 (H3) gene, part... 224 2e-55
128gb|AY749709.1| Mystaxiops venatoris histone H3 (H3) gene, partia... 224 2e-55
129gb|M32462.1|MUSHIS3D Mouse histone H3 (H3.1-291) gene, complete cds 224 2e-55
130emb|X00593.1|LPH3H4 Lytechinus pictus H3 and H4 gene 222 7e-55
131dbj|AB185072.1| Conocephalum conicum H3 gene for histone 3, comp... 220 3e-54
132gb|BC015270.1| Mus musculus histone 2, H3c2, mRNA (cDNA clone MG... 218 1e-53
133ref|NM_054045.2| Mus musculus histone 2, H3c2 (Hist2h3c2), mRNA 218 1e-53
134emb|X80327.1|MPMP323 M.pahari genes mpH323 and mph2a23 218 1e-53
135gb|AY749738.1| Jubabaetis sp. EP139 histone H3 (H3) gene, partia... 218 1e-53
136ref|NM_145073.2| Mus musculus histone 1, H3g (Hist1h3g), mRNA 216 4e-53
137gb|AC034285.6| Mus musculus chromosome 13, clone RP23-220G21, co... 216 4e-53
138gb|AY181030.1| Toxoplasma gondii histone H3 mRNA, complete cds 216 4e-53
139emb|AL592149.8| Mouse DNA sequence from clone RP23-283N14 on chr... 216 4e-53
140gb|AY158946.1| Mus musculus histone protein Hist1h3g gene, compl... 216 4e-53
141emb|X01684.1|MMHISH31 Mouse gene (H3.1) for histone H3 216 4e-53
142gb|AY749746.1| Proboscidoplocia sp. EP162 histone H3 (H3) gene, ... 216 4e-53
143gb|AY749737.1| Platybaetis probus histone H3 (H3) gene, partial cds 216 4e-53
144gb|AY749708.1| Baetis tricaudatus histone H3 (H3) gene, partial cds 216 4e-53
145gb|M32460.1|MUSHIS3B Mouse histone H3 (H3.1-221) gene, complete cds 216 4e-53
146ref|XM_868935.1| PREDICTED: Bos taurus similar to histone 1, H2a... 214 2e-52
147gb|AY338636.1| Calopteryx aequabilis histone 3 gene, partial cds 214 2e-52
148gb|AY338628.1| Isonychia sp. EP017 histone 3 gene, partial cds 214 2e-52
149gb|BC107285.1| Mus musculus histone 1, H3a, mRNA (cDNA clone IMA... 212 7e-52
150ref|NM_178205.1| Mus musculus histone 1, H3e (Hist1h3e), mRNA 212 7e-52
151gb|DQ284377.1| Rana guentheri histone H3a gene, partial cds 212 7e-52
152gb|DQ284287.1| Rana guentheri histone H3a gene, partial cds 212 7e-52
153gb|DQ284223.1| Rana aurora histone H3a gene, partial cds 212 7e-52
154gb|DQ284219.1| Rana clamitans histone H3a gene, partial cds 212 7e-52
155gb|DQ284180.1| Staurois tuberilinguis histone H3a gene, partial cds 212 7e-52
156gb|DQ284168.1| Pseudoamolops sauteri histone H3a gene, partial cds 212 7e-52
157gb|U62671.1|MMU62671 Mus musculus histone H3.2-B (H3-B) gene, co... 212 7e-52
158dbj|AB185075.1| Conocephalum conicum H3 gene for histone 3, comp... 212 7e-52
159gb|AY158948.1| Mus musculus histone protein Hist1h3e gene, compl... 212 7e-52
160gb|AY662892.1| Etroplus maculatus histone H3a gene, partial cds 212 7e-52
161ref|NM_019469.1| Mus musculus histone 2, H3c1 (Hist2h3c1), trans... 210 3e-51
162emb|X16148.1|MMHIS2A3 Mouse H2a and H3 histone genes 210 3e-51
163emb|X03952.1|SPHISH34 Sea urchin (S. purpuratus) late embryonic ... 210 3e-51
164gb|DQ284185.1| Chaperina fusca histone H3a gene, partial cds 210 3e-51
165ref|NM_214547.1| Strongylocentrotus purpuratus late embryonic hi... 210 3e-51
166ref|NM_178203.1| Mus musculus histone 1, H3b (Hist1h3b), mRNA 208 1e-50
167gb|AY788897.1| Mnais nawai histone 3 gene, partial cds 208 1e-50
168emb|Y12290.1|MMHIST431 M.musculus genes encoding histone H4, his... 208 1e-50
169emb|X80325.1|MPMPH315 M.pahari mpH315 gene 208 1e-50
170emb|AL590388.4| Mouse DNA sequence from clone RP23-480B19 on chr... 208 1e-50
171gb|DQ284352.1| Rana chapaensis histone H3a gene, partial cds 208 1e-50
172gb|DQ284224.1| Rana muscosa histone H3a gene, partial cds 208 1e-50
173gb|AF370817.1|AF370817 Locusta migratoria histone H3 gene, parti... 208 1e-50
174dbj|AK006742.1| Mus musculus adult male testis cDNA, RIKEN full-... 208 1e-50
175gb|U62672.1|MMU62672 Mus musculus histone H3.1-D (H3-D) and hist... 208 1e-50
176gb|AF404631.1| Lewia infectoria isolate CR31 histone gene, parti... 208 1e-50
177gb|AY158952.1| Mus musculus histone protein Hist1h3a gene, compl... 208 1e-50
178gb|AY158951.1| Mus musculus histone protein Hist1h3b gene, compl... 208 1e-50
179ref|XM_524859.1| PREDICTED: Pan troglodytes LOC469476 (LOC469476... 206 4e-50
180emb|AL591493.14| Human DNA sequence from clone RP11-196G18 on ch... 206 4e-50
181ref|XM_497711.2| PREDICTED: Homo sapiens similar to H3 histone, ... 206 4e-50
182gb|AY338619.1| Baetis sp. Eph11 histone 3 gene, partial cds 206 4e-50
183gb|AY749740.1| Isonychia sp. EP142 histone H3 (H3) gene, partial... 206 4e-50
184gb|M14396.1|CIIHISH3A Duck H3.4 variant histone gene 206 4e-50
185ref|NM_013548.2| Mus musculus histone 1, H3f (Hist1h3f), mRNA 204 2e-49
186gb|AC151366.3| Aotus nancymaae clone CH258-105B22, complete sequ... 204 2e-49
187ref|XM_950910.1| Neurospora crassa OR74A HISTONE H3 (NCU01635.1)... 204 2e-49
188ref|XM_328073.1| Neurospora crassa OR74A HISTONE H3 (NCU01635.1)... 204 2e-49
189gb|BC103549.1| Mus musculus histone 1, H3f, mRNA (cDNA clone MGC... 204 2e-49
190gb|DQ284309.1| Rana maculata histone H3a gene, partial cds 204 2e-49
191gb|DQ284280.1| Rana warszewitschii histone H3a gene, partial cds 204 2e-49
192gb|DQ284267.1| Rana grahami histone H3a gene, partial cds 204 2e-49
193gb|DQ284245.1| Rana johnsi histone H3a gene, partial cds 204 2e-49
194gb|DQ284242.1| Batrachylodes vertebralis histone H3a gene, parti... 204 2e-49
195gb|DQ284177.1| Rana japonica histone H3a gene, partial cds 204 2e-49
196dbj|AK010121.1| Mus musculus adult male tongue cDNA, RIKEN full-... 204 2e-49
197dbj|AB185074.1| Conocephalum conicum H3 gene for histone 3, comp... 204 2e-49
198gb|AY158947.1| Mus musculus histone protein Hist1h3f gene, compl... 204 2e-49
199gb|AY662898.1| Paretroplus cf. kieneri 'Amboaboa' histone H3a ge... 204 2e-49
200gb|BC101955.1| Mus musculus histone 1, H3f, mRNA (cDNA clone MGC... 204 2e-49
201gb|BC101956.1| Mus musculus histone 1, H3f, mRNA (cDNA clone MGC... 204 2e-49
202gb|BC101954.1| Mus musculus histone 1, H3f, mRNA (cDNA clone MGC... 204 2e-49
203gb|M32459.1|MUSHIS3A Mouse histone H3 (H3.2-221) gene, complete cds 204 2e-49
204ref|NM_021059.2| Homo sapiens histone 2, H3c (HIST2H3C), mRNA 202 7e-49
205gb|AY648851.1| Homo sapiens histone H3/o gene, complete cds 202 7e-49
206gb|BC063540.1| Homo sapiens cDNA clone IMAGE:4523373, **** WARNI... 202 7e-49
207gb|BC015544.1| Homo sapiens histone 2, H3c, mRNA (cDNA clone IMA... 202 7e-49
208emb|X53330.1|PDHISTCL P.dumerilii histone gene cluster for core ... 202 7e-49
209gb|DQ284094.1| Synapturanus mirandaribeiroi histone H3a gene, pa... 202 7e-49
210gb|DQ284081.1| Leptobrachium chapaense histone H3a gene, partial... 202 7e-49
211ref|XM_928391.1| PREDICTED: Homo sapiens similar to CG31613-PA (... 202 7e-49
212ref|NG_002617.1| Homo sapiens histone 2, H3a (HIST2H3A) pseudoge... 202 7e-49
213ref|NM_001005464.1| Homo sapiens histone H3/o (H3/o), mRNA 202 7e-49
214gb|BC074969.2| Homo sapiens histone H3/o, mRNA (cDNA clone IMAGE... 202 7e-49
215gb|AF531307.1| Homo sapiens histone H3 (HIST2H3C) gene, complete... 202 7e-49
216gb|AF531305.1| Homo sapiens histone H3 (HIST2H3A) pseudogene, co... 202 7e-49
217emb|CR760429.2| Xenopus tropicalis finished cDNA, clone TNeu057j11 202 7e-49
218ref|NM_013550.3| Mus musculus histone 1, H3a (Hist1h3a), mRNA 200 3e-48
219gb|BC107287.1| Mus musculus histone 1, H3a, mRNA (cDNA clone IMA... 200 3e-48
220emb|X80324.1|MPMPH3110 M.pahari mpH3110 gene 200 3e-48
221emb|X13675.1|MSHIS3C2 Medicago sativa mRNA for histone H3 clone ... 200 3e-48
222gb|AY521731.1| Hydropsyche sp. BYU_ACTR020 histone H3 (H3) gene,... 200 3e-48
223gb|DQ284356.1| Fejervarya limnocharis histone H3a gene, partial cds 200 3e-48
224gb|DQ284170.1| Rana temporaria histone H3a gene, partial cds 200 3e-48
225dbj|AK155722.1| Mus musculus B6-derived CD11 +ve dendritic cells... 200 3e-48
226gb|U62670.1|MMU62670 Mus musculus histone H3.1-I (H3-I) gene, co... 200 3e-48
227dbj|AK018952.1| Mus musculus adult male testis cDNA, RIKEN full-... 200 3e-48
228gb|AY158945.1| Mus musculus histone protein Hist1h3i gene, compl... 200 3e-48
229ref|XM_560604.1| Anopheles gambiae str. PEST ENSANGP00000025641 ... 200 3e-48
230ref|XM_318362.1| Anopheles gambiae str. PEST ENSANGP00000016005 ... 200 3e-48
231ref|XM_307081.1| Anopheles gambiae str. PEST ENSANGP00000001387 ... 200 3e-48
232ref|XM_305996.1| Anopheles gambiae str. PEST ENSANGP00000012784 ... 200 3e-48
233gb|AY662905.1| Paretroplus sp. 'Kamoro' histone H3a gene, partia... 200 3e-48
234ref|NM_178207.2| Mus musculus histone 1, H3i (Hist1h3i), mRNA 200 3e-48
235gb|AY749729.1| Edmundsius agilis histone H3 (H3) gene, partial cds 200 3e-48
236gb|AY749723.1| Siphlaenigma janae histone H3 (H3) gene, partial cds 200 3e-48
237gb|AY749718.1| Siphlonurus sp. EP084 histone H3 (H3) gene, parti... 200 3e-48
238gb|AY870292.1| Pantala flavescens histone H3 gene, partial cds 198 1e-47
239gb|AY338638.1| Hetaerina americana histone 3 gene, partial cds 198 1e-47
240gb|DQ284359.1| Rana maosonensis histone H3a gene, partial cds 196 4e-47
241gb|DQ284354.1| Amnirana albilabris histone H3a gene, partial cds 196 4e-47
242gb|DQ284187.1| Meristogenys orphnocnemis histone H3a gene, parti... 196 4e-47
243gb|DQ284178.1| Rana nigromaculata histone H3a gene, partial cds 196 4e-47
244gb|DQ284163.1| Rana adenopleura histone H3a gene, partial cds 196 4e-47
245gb|DQ275319.1| Graphoderus zonatus voucher BYU KBMGrzo66 histone... 196 4e-47
246gb|AY662897.1| Paretroplus cf. kieneri 'Ravelobe' histone H3a ge... 196 4e-47
247gb|AY662895.1| Paretroplus kieneri 'Kinkony' histone H3a gene, p... 196 4e-47
248gb|AY662890.1| Etroplus canarensis histone H3a gene, partial cds 196 4e-47
249emb|X01685.1|MMHISH32 Mouse gene (H3.2) for histone H3 196 4e-47
250emb|X80326.1|MPMPH312 M.pahari mpH312 gene 194 2e-46
251gb|DQ284414.1| Hamptophryne boliviana histone H3a gene, partial cds 194 2e-46
252gb|DQ284373.1| Rana sylvatica histone H3a gene, partial cds 194 2e-46
253gb|AF361949.1| Eimeria tenella histone 3 (H3) mRNA, complete cds 194 2e-46
254ref|XM_694088.1| PREDICTED: Danio rerio similar to CG31613-PA (L... 194 2e-46
255gb|AY749710.1| Centroptilum luteolum histone H3 (H3) gene, parti... 194 2e-46
256ref|NM_178204.1| Mus musculus histone1, H3d (Hist1h3d), mRNA 192 6e-46
257emb|X13674.1|MSHIS3C1 Medicago sativa mRNA for histone H3 clone ... 192 6e-46
258gb|DQ284333.1| Huia nasica histone H3a gene, partial cds 192 6e-46
259ref|XM_683134.1| PREDICTED: Danio rerio similar to CG31613-PA (L... 192 6e-46
260gb|BC069947.1| Mus musculus cDNA clone IMAGE:6494016 192 6e-46
261gb|BC055904.1| Mus musculus cDNA clone IMAGE:4913108 192 6e-46
262gb|U62669.1|MMU62669 Mus musculus histone H3.2-F (H3-F), histone... 192 6e-46
263gb|AF404641.1| Lewia infectoria isolate CR28 histone gene, parti... 192 6e-46
264gb|AF404640.1| Alternaria alternata s.l. STE-U4267 isolate CR26 ... 192 6e-46
265gb|AF404634.1| Alternaria tenuissima isolate MA6 histone gene, p... 192 6e-46
266gb|AF404633.1| Alternaria tenuissima isolate MA1 histone gene, p... 192 6e-46
267gb|AF404624.1| Alternaria alternata s.l. STE-U4265 isolate CR24 ... 192 6e-46
268gb|AF404622.1| Alternaria tenuissima isolate CR27 histone gene, ... 192 6e-46
269gb|AF404617.1| Alternaria alternata s.l. STE-U4248 isolate CR7 h... 192 6e-46
270gb|AF404594.1| Alternaria alternata s.l. STE-U4343 isolate MA20 ... 192 6e-46
271gb|AY158949.1| Mus musculus histone protein Hist1h3d gene, compl... 192 6e-46
272ref|XM_307606.1| Anopheles gambiae str. PEST ENSANGP00000016172 ... 192 6e-46
273gb|AY662901.1| Paretroplus menarambo histone H3a gene, partial cds 192 6e-46
274emb|CR354435.20| Zebrafish DNA sequence from clone CH211-113A14 ... 192 6e-46
275gb|AY749743.1| Ichthybotus hudsoni histone H3 (H3) gene, partial... 192 6e-46
276gb|AY749724.1| Nesameletus ornatus histone H3 (H3) gene, partial... 192 6e-46
277gb|DQ284292.1| Rana yavapaiensis histone H3a gene, partial cds 190 2e-45
278gb|DQ284222.1| Bufo woodhousii histone H3a gene, partial cds 190 2e-45
279gb|DQ284196.1| Bufo terrestris histone H3a gene, partial cds 190 2e-45
280ref|XM_694120.1| PREDICTED: Danio rerio similar to CG31613-PA (L... 190 2e-45
281dbj|AB185056.1| Conocephalum conicum H3 gene for histone 3, comp... 190 2e-45
282dbj|AB185050.1| Conocephalum conicum H3 gene for histone 3, comp... 190 2e-45
283dbj|AB185049.1| Conocephalum conicum H3 gene for histone 3, comp... 190 2e-45
284dbj|AB185046.1| Conocephalum conicum H3 gene for histone 3, comp... 190 2e-45
285dbj|AB185035.1| Conocephalum supradecompositum H3 gene for histo... 190 2e-45
286gb|AY923964.1| Phenacolepas osculans isolate PHE1 histone H3 (H3... 190 2e-45
287gb|AY338631.1| Anthopotamus sp. EP022 histone 3 gene, partial cds 190 2e-45
288gb|AY338629.1| Heptagenia sp. EP018 histone 3 gene, partial cds 190 2e-45
289gb|AY655588.1| Menidia menidia histone H3a gene, partial cds 188 1e-44
290gb|DQ284411.1| Dyscophus guineti histone H3a gene, partial cds 188 1e-44
291gb|DQ284391.1| Scaphiophryne marmorata histone H3a gene, partial... 188 1e-44
292gb|DQ284369.1| Rana palmipes histone H3a gene, partial cds 188 1e-44
293gb|DQ284358.1| Amolops chapaensis histone H3a gene, partial cds 188 1e-44
294gb|DQ284337.1| Conraua robusta histone H3a gene, partial cds 188 1e-44
295gb|DQ284269.1| Rana temporaria histone H3a gene, partial cds 188 1e-44
296gb|DQ284237.1| Sphenophryne sp. 989 histone H3a gene, partial cds 188 1e-44
297gb|DQ284230.1| Ceratobatrachus guentheri histone H3a gene, parti... 188 1e-44
298gb|DQ284173.1| Conraua goliath histone H3a gene, partial cds 188 1e-44
299gb|DQ284167.1| Rana pipiens histone H3a gene, partial cds 188 1e-44
300gb|DQ284152.1| Rana forreri histone H3a gene, partial cds 188 1e-44
301dbj|AB226293.1| Aspergillus oryzae cDNA, contig sequence: AoEST3155 188 1e-44
302dbj|AP007161.1| Aspergillus oryzae RIB40 genomic DNA, SC012 188 1e-44
303dbj|AB185026.1| Conocephalum conicum H3 gene for histone 3, comp... 188 1e-44
304dbj|AB185023.1| Conocephalum conicum H3 gene for histone 3, comp... 188 1e-44
305gb|AY662931.1| Dicrossus sp. JSS-2004 histone H3a gene, partial cds 188 1e-44
306gb|AY662904.1| Paretroplus tsimoly histone H3a gene, partial cds 188 1e-44
307gb|AY662903.1| Paretroplus polyactis 'South' histone H3a gene, p... 188 1e-44
308gb|AY662902.1| Paretroplus nourissati histone H3a gene, partial cds 188 1e-44
309gb|AY539218.1| Hoplichthys citrinus histone H3 gene, partial cds 188 1e-44
310gb|AY749721.1| Coloburiscoides sp. EP094 histone H3 (H3) gene, p... 188 1e-44
311gb|AY749714.1| Meridialaris diguillina histone H3 (H3) gene, par... 188 1e-44
312gb|AY655583.1| Teramulus waterloti histone H3a gene, partial cds 186 4e-44
313gb|DQ028120.1| Leiognathus sp. L9 histone H3 gene, partial cds 186 4e-44
314gb|AY125217.1| Supella longipalpa histone 3 gene, partial cds 186 4e-44
315emb|AJ556872.1|XLA556872 Expression vector pET3-H3 H3 gene for X... 186 4e-44
316gb|DQ284420.1| Pleurodeles waltl histone H3a gene, partial cds 186 4e-44
317gb|DQ284416.1| Salamandra salamandra histone H3a gene, partial cds 186 4e-44
318gb|DQ284398.1| Hoplophryne rogersi histone H3a gene, partial cds 186 4e-44
319gb|DQ284386.1| Elachistocleis ovalis histone H3a gene, partial cds 186 4e-44
320gb|DQ284260.1| Bufo andrewsi histone H3a gene, partial cds 186 4e-44
321dbj|AB193284.1| Scopelophila cataractae H3 gene for histone, par... 186 4e-44
322ref|XM_684297.1| PREDICTED: Danio rerio similar to CG31613-PA (L... 186 4e-44
323dbj|AB195975.1| Lilium longiflorum YAH3 mRNA for histone H3, com... 186 4e-44
324gb|AY662950.1| Pelvicachromis pulcher histone H3a gene, partial cds 186 4e-44
325gb|AY662883.1| Cetoscarus bicolor histone H3a gene, partial cds 186 4e-44
326gb|AY539268.1| Cirrhitus rivulatus histone H3 gene, partial cds 186 4e-44
327gb|AY655585.1| Atherinella panamensis histone H3a gene, partial cds 184 2e-43
328gb|AY125230.1| Stenopelmatus fuscus histone 3 gene, partial cds 184 2e-43
329emb|X13673.1|MSHIS311 Medicago sativa H3 histone gene ALH3-1.1 184 2e-43
330gb|DQ284182.1| Ingerana baluensis histone H3a gene, partial cds 184 2e-43
331ref|XM_684517.1| PREDICTED: Danio rerio similar to CG31613-PA (L... 184 2e-43
332ref|XM_693458.1| PREDICTED: Danio rerio similar to CG31613-PA (L... 184 2e-43
333dbj|AK020421.1| Mus musculus 12 days embryo embryonic body betwe... 184 2e-43
334gb|AF404639.1| Alternaria arborescens isolate CR3 histone gene, ... 184 2e-43
335gb|AF404638.1| Alternaria alternata s.l. STE-U4257 isolate CR16 ... 184 2e-43
336gb|AF404637.1| Alternaria alternata s.l. STE-U4258 isolate CR17 ... 184 2e-43
337gb|AF404636.1| Lewia infectoria isolate CR12 histone gene, parti... 184 2e-43
338gb|AF404635.1| Alternaria arborescens isolate MA22 histone gene,... 184 2e-43
339gb|AF404632.1| Alternaria alternata s.l. STE-U4262 isolate CR21 ... 184 2e-43
340gb|AF404630.1| Alternaria arborescens isolate CR5 histone gene, ... 184 2e-43
341gb|AF404629.1| Lewia infectoria isolate CR30 histone gene, parti... 184 2e-43
342gb|AF404628.1| Alternaria alternata s.l. STE-U4266 isolate CR25 ... 184 2e-43
343gb|AF404627.1| Alternaria alternata s.l. STE-U4263 isolate CR22 ... 184 2e-43
344gb|AF404626.1| Alternaria alternata s.l. STE-U4249 isolate CR8 h... 184 2e-43
345gb|AF404625.1| Alternaria alternata s.l. STE-U4259 isolate CR18 ... 184 2e-43
346gb|AF404623.1| Lewia infectoria isolate CR15 histone gene, parti... 184 2e-43
347gb|AF404621.1| Alternaria sp. STE-U4255 isolate CR14 histone gen... 184 2e-43
348gb|AF404620.1| Alternaria alternata s.l. STE-U4242 isolate CR1 h... 184 2e-43
349gb|AF404619.1| Alternaria sp. STE-U4264 isolate CR23 histone gen... 184 2e-43
350gb|AF404618.1| Alternaria sp. STE-U4247 isolate CR6 histone gene... 184 2e-43
351gb|AF404616.1| Alternaria alternata s.l. STE-U4260 isolate CR19 ... 184 2e-43
352gb|AF404615.1| Alternaria alternata s.l. STE-U4261 isolate CR20 ... 184 2e-43
353gb|AF404614.1| Alternaria alternata s.l. STE-U4349 isolate MA26 ... 184 2e-43
354gb|AF404613.1| Alternaria alternata s.l. STE-U4328 isolate MA5 h... 184 2e-43
355gb|AF404612.1| Alternaria alternata s.l. STE-U4327 isolate MA4 h... 184 2e-43
356gb|AF404611.1| Alternaria alternata s.l. STE-U4326 isolate MA3 h... 184 2e-43
357gb|AF404610.1| Alternaria alternata s.l. STE-U4325 isolate MA2 h... 184 2e-43
358gb|AF404609.1| Alternaria alternata s.l. STE-U4348 isolate MA25 ... 184 2e-43
359gb|AF404608.1| Alternaria alternata s.l. STE-U4344 isolate MA21 ... 184 2e-43
360gb|AF404607.1| Alternaria alternata s.l. STE-U4342 isolate MA19 ... 184 2e-43
361gb|AF404606.1| Alternaria alternata s.l. STE-U4341 isolate MA18 ... 184 2e-43
362gb|AF404605.1| Alternaria alternata s.l. STE-U4340 isolate MA17 ... 184 2e-43
363gb|AF404604.1| Alternaria alternata s.l. STE-U4339 isolate MA16 ... 184 2e-43
364gb|AF404603.1| Alternaria alternata s.l. STE-U4338 isolate MA15 ... 184 2e-43
365gb|AF404602.1| Alternaria alternata s.l. STE-U4337 isolate MA14 ... 184 2e-43
366gb|AF404601.1| Alternaria alternata s.l. STE-U4336 isolate MA13 ... 184 2e-43
367gb|AF404600.1| Alternaria alternata s.l. STE-U4332 isolate MA9 h... 184 2e-43
368gb|AF404599.1| Alternaria alternata s.l. STE-U4346 isolate MA23 ... 184 2e-43
369gb|AF404598.1| Alternaria alternata s.l. STE-U4335 isolate MA12 ... 184 2e-43
370gb|AF404597.1| Alternaria alternata s.l. STE-U4333 isolate MA10 ... 184 2e-43
371gb|AF404596.1| Alternaria alternata s.l. STE-U4330 isolate MA7 h... 184 2e-43
372gb|AF404595.1| Alternaria alternata s.l. STE-U4347 isolate MA24 ... 184 2e-43
373gb|AF404593.1| Alternaria alternata s.l. STE-U4334 isolate MA11 ... 184 2e-43
374gb|AF404592.1| Alternaria alternata s.l. STE-U4331 isolate MA8 h... 184 2e-43
375gb|AY662932.1| Nandopsis ramsdeni histone H3a gene, partial cds 184 2e-43
376gb|AY662925.1| Apistogramma sp. JSS-2004 histone H3a gene, parti... 184 2e-43
377gb|AY662906.1| Paretroplus polyactis 'North' histone H3a gene, p... 184 2e-43
378gb|AY662899.1| Paretroplus maculatus histone H3a gene, partial cds 184 2e-43
379gb|AY539178.1| Menidia menidia histone H3 gene, partial cds 184 2e-43
380gb|AY749722.1| Adenophlebia peringueyella histone H3 (H3) gene, ... 184 2e-43
381gb|AY749707.1| Leptophlebiidae sp. EP030 histone H3 (H3) gene, p... 184 2e-43
382gb|AY749698.1| Drunella doddsi histone H3 (H3) gene, partial cds 184 2e-43
383gb|DQ028128.1| Leiognathus fasciatus histone H3 gene, partial cds 182 6e-43
384gb|DQ028126.1| Leiognathus fasciatus isolate L36 histone H3 gene... 182 6e-43
385gb|DQ028125.1| Leiognathus fasciatus isolate L16 histone H3 gene... 182 6e-43
386gb|DQ028124.1| Leiognathus equulus histone H3 gene, partial cds 182 6e-43
387gb|DQ028115.1| Leiognathus sp. L25 histone H3 gene, partial cds 182 6e-43
388gb|DQ028114.1| Leiognathus sp. Fiji histone H3 gene, partial cds 182 6e-43
389gb|DQ079694.1| Pachygrapsus marmoratus voucher KCpama histone H3... 182 6e-43
390gb|L19706.1| Rattus norvegicus H3 histone gene, complete cds 182 6e-43
391gb|AY669068.1| Chaetomium globosum histone H3 mRNA, complete cds 182 6e-43
392gb|AF520775.1| Hypocrea jecorina histone H3 gene, complete cds 182 6e-43
393gb|AF519295.1| Sipunculus sp. GG-2002 isolate DNA100246 histone ... 182 6e-43
394gb|AY521728.1| Aphanicerca capensis voucher BYU_ACPL028 histone ... 182 6e-43
395gb|AY521713.1| Tyrannophasma gladiator voucher BYU_ACMP002 histo... 182 6e-43
396gb|DQ284215.1| Bufo boreas histone H3a gene, partial cds 182 6e-43
397gb|DQ284198.1| Bufo punctatus histone H3a gene, partial cds 182 6e-43
398gb|DQ284197.1| Bufo cognatus histone H3a gene, partial cds 182 6e-43
399gb|DQ284192.1| Bufo quercicus histone H3a gene, partial cds 182 6e-43
400ref|NM_001013056.1| Rattus norvegicus histone 1, H2ai (predicted... 182 6e-43
401gb|AY662924.1| Acaronia nassa histone H3a gene, partial cds 182 6e-43
402gb|AY338633.1| Parameletus columbiae histone 3 gene, partial cds 182 6e-43
403gb|AY752255.1| Davidiella tassiana strain ATCC 66670 histone H3 ... 180 2e-42
404gb|AY655596.1| Atherinomorus sp. Karianga histone H3a gene, part... 180 2e-42
405ref|XM_871486.1| PREDICTED: Bos taurus similar to H3 histone, fa... 180 2e-42
406ref|XM_871460.1| PREDICTED: Bos taurus similar to H3 histone, fa... 180 2e-42
407ref|XM_866756.1| PREDICTED: Bos taurus similar to H3 histone, fa... 180 2e-42
408ref|XM_866686.1| PREDICTED: Bos taurus similar to H3 histone, fa... 180 2e-42
409gb|AF517876.1| Griffithsia japonica isolate Gj410 putative histo... 180 2e-42
410gb|DQ284409.1| Ceratobatrachus guentheri histone H3a gene, parti... 180 2e-42
411gb|DQ284290.1| Rana chiricahuensis histone H3a gene, partial cds 180 2e-42
412gb|DQ284241.1| Genyophryne thomsoni histone H3a gene, partial cds 180 2e-42
413gb|DQ284240.1| Copiula sp. AMS R124417 histone H3a gene, partial... 180 2e-42
414gb|DQ284232.1| Discodeles guppyi histone H3a gene, partial cds 180 2e-42
415gb|DQ284229.1| Platymantis weberi histone H3a gene, partial cds 180 2e-42
416gb|DQ284221.1| Rana capito histone H3a gene, partial cds 180 2e-42
417gb|DQ284220.1| Rana grylio histone H3a gene, partial cds 180 2e-42
418gb|DQ284204.1| Bufo coniferus histone H3a gene, partial cds 180 2e-42
419gb|DQ284174.1| Nyctixalus pictus histone H3a gene, partial cds 180 2e-42
420gb|DQ284080.1| Theloderma corticale histone H3a gene, partial cds 180 2e-42
421gb|DQ284054.1| Boophis albilabris histone H3a gene, partial cds 180 2e-42
422gb|DQ284053.1| Boophis tephraeomystax histone H3a gene, partial cds 180 2e-42
423gb|DQ284052.1| Ptychadena mascareniensis histone H3a gene, parti... 180 2e-42
424gb|AY662912.1| Paratilapia sp. 'Ifasy' histone H3a gene, partial... 180 2e-42
425gb|AY662893.1| Paretroplus dambabe histone H3a gene, partial cds 180 2e-42
426gb|AY662891.1| Etroplus suratensis histone H3a gene, partial cds 180 2e-42
427gb|AY662889.1| Amphiprion polymnus histone H3a gene, partial cds 180 2e-42
428gb|AY749736.1| Atopopus sp. EP134 histone H3 (H3) gene, partial cds 180 2e-42
429gb|DQ028118.1| Leiognathus sp. Singapore histone H3 gene, partia... 178 9e-42
430gb|DQ079682.1| Lysmata wurdemanni voucher MLP120 histone H3 (H3)... 178 9e-42
431gb|BC084311.1| Xenopus laevis cDNA clone IMAGE:6865011 178 9e-42
432emb|X03018.1|XLHISH3A Xenopus laevis histone gene cluster XlH3-A... 178 9e-42
433gb|DQ284368.1| Ctenophryne geayi histone H3a gene, partial cds 178 9e-42
434gb|DQ284353.1| Scotobleps gabonicus histone H3a gene, partial cds 178 9e-42
435gb|DQ284273.1| Odontophrynus achalensis histone H3a gene, partia... 178 9e-42
436gb|DQ284200.1| Bufo cf. arunco AMNH A168401 histone H3a gene, pa... 178 9e-42
437gb|DQ284184.1| Calluella guttulata histone H3a gene, partial cds 178 9e-42
438gb|DQ284121.1| Tlalocohyla picta histone H3a gene, partial cds 178 9e-42
439dbj|AB193281.1| Marchantia polymorpha H3 gene for histone, parti... 178 9e-42
440ref|XM_683485.1| PREDICTED: Danio rerio similar to CG31613-PA (L... 178 9e-42
441ref|XM_694149.1| PREDICTED: Danio rerio similar to CG31613-PA (L... 178 9e-42
442ref|XM_344595.2| PREDICTED: Rattus norvegicus histone 1, H4a (pr... 178 9e-42
443gb|AY218163.1| Echinorhynchus gadi histone H3 gene, partial cds 178 9e-42
444gb|AY662930.1| Crenicichla alta histone H3a gene, partial cds 178 9e-42
445gb|AY539266.1| Haemulon plumieri histone H3 gene, partial cds 178 9e-42
446gb|M21287.1|XELHX1H3 X.laevis histone H1B, H2A, H2B, and H4 gene... 178 9e-42
447gb|J00869.1|CHKH3A Chicken histone H3 gene (intronless) 178 9e-42
448gb|AY725673.1| Cylindrocladium multiphialidicum strain CBS 11267... 176 4e-41
449gb|DQ028119.1| Leiognathus sp. L2 histone H3 gene, partial cds 176 4e-41
450gb|AY377764.1| Helicoradomenia sp. AO-2003 histone H3 gene, part... 176 4e-41
451gb|AY125233.1| Isoperla davisi histone 3 gene, partial cds 176 4e-41
452gb|DQ284225.1| Rana heckscheri histone H3a gene, partial cds 176 4e-41
453ref|XM_684015.1| PREDICTED: Danio rerio similar to CG31613-PA (L... 176 4e-41
454gb|AF404591.1| Alternaria arborescens isolate CR2 histone gene, ... 176 4e-41
455gb|AY923981.1| Turbo setosus isolate TU5 histone H3 (H3) gene, p... 176 4e-41
456gb|AY923967.1| Peltospira delicata isolate PS1 histone H3 (H3) g... 176 4e-41
457gb|AY662911.1| Paratilapia sp. 'East' histone H3a gene, partial cds 176 4e-41
458gb|AY662908.1| Paratilapia cf. bleekeri JSS-2004 histone H3a gen... 176 4e-41
459gb|AY539262.1| Gramma loreto histone H3 gene, partial cds 176 4e-41
460gb|AY749717.1| Siphlonella sp. EP083 histone H3 (H3) gene, parti... 176 4e-41
461gb|AY749713.1| Penaphlebia sp. EP076 histone H3 (H3) gene, parti... 176 4e-41
462gb|AY749699.1| Epeorus longimanus histone H3 (H3) gene, partial cds 176 4e-41
463gb|M35867.1|ALFHISH3A Alfalfa histone H3 (H3-1.1) gene, complete... 176 4e-41
464gb|AY655576.1| Marosatherina ladigesi histone H3a gene, partial cds 174 1e-40
465gb|DQ028130.1| Leiognathus robustus isolate LEQ1s histone H3 gen... 174 1e-40
466gb|DQ028129.1| Leiognathus robustus isolate L35 histone H3 gene,... 174 1e-40
467gb|DQ028127.1| Leiognathus fasciatus histone H3 gene, partial cds 174 1e-40
468gb|DQ028121.1| Leiognathus equulus histone H3 gene, partial cds 174 1e-40
469gb|DQ028117.1| Leiognathus sp. L41 histone H3 gene, partial cds 174 1e-40
470gb|DQ028116.1| Leiognathus sp. L39 histone H3 gene, partial cds 174 1e-40
471gb|DQ028113.1| Gazza squamiventralis isolate WLS52 histone H3 ge... 174 1e-40
472gb|AY491352.1| Anamiopteryx sp. MN028 histone 3 gene, partial cds 174 1e-40
473gb|AY230984.1| Nesticus sp. X132 histone H3A (H3A) gene, partial... 174 1e-40
474ref|XM_384466.1| Gibberella zeae PH-1 chromosome 2 H3_NEUCR Hist... 174 1e-40
475emb|AL109948.9|HSJ998N21 Human DNA sequence from clone RP5-998N2... 174 1e-40
476ref|NM_001025303.1| Homo sapiens similar to histone H2B histone ... 174 1e-40
477gb|DQ284405.1| Arthroleptis tanneri histone H3a gene, partial cds 174 1e-40
478gb|DQ284379.1| Kaloula pulchra histone H3a gene, partial cds 174 1e-40
479gb|DQ284179.1| Rana chalconota histone H3a gene, partial cds 174 1e-40
480gb|DQ284077.1| Bufo spinulosus histone H3a gene, partial cds 174 1e-40
481gb|DQ104790.1| Compsocus elegans histone 3 gene, partial cds 174 1e-40
482gb|DQ026791.1| Alternaria alternata histone gene, partial cds 174 1e-40
483gb|AY662888.1| Embiotoca jacksoni histone H3a gene, partial cds 174 1e-40
484gb|AY539269.1| Cheilodactylus variegatus histone H3 gene, partia... 174 1e-40
485gb|AY752254.1| Cladosporium cladosporioides strain ATCC 66669 hi... 172 6e-40
486gb|DQ028161.1| Secutor cf. insidiator JS-2005 histone H3 gene, p... 172 6e-40
487gb|DQ028160.1| Secutor indicius histone H3 gene, partial cds 172 6e-40
488gb|DQ028159.1| Secutor indicius histone H3 gene, partial cds 172 6e-40
489gb|DQ028086.1| Zeus faber histone H3 gene, partial cds 172 6e-40
490gb|DQ284400.1| Microhyla sp. Rds 05 histone H3a gene, partial cds 172 6e-40
491gb|DQ284384.1| Tomopterna delalandii histone H3a gene, partial cds 172 6e-40
492gb|DQ284383.1| Rana vertebralis histone H3a gene, partial cds 172 6e-40
493gb|DQ284366.1| Rhacophorus calcaneus histone H3a gene, partial cds 172 6e-40
494gb|DQ284351.1| Leptodactylodon bicolor histone H3a gene, partial... 172 6e-40
495gb|DQ284348.1| Cardioglossa leucomystax histone H3a gene, partia... 172 6e-40
496gb|DQ284289.1| Bufo alvarius histone H3a gene, partial cds 172 6e-40
497gb|DQ284271.1| Paa exilispinosa histone H3a gene, partial cds 172 6e-40
498gb|DQ284259.1| Phrynobatrachus dendrobates histone H3a gene, par... 172 6e-40
499gb|DQ284258.1| Afrana angolensis histone H3a gene, partial cds 172 6e-40
500gb|DQ284254.1| Occidozyga lima histone H3a gene, partial cds 172 6e-40

>gb|M36658.1|MZEH3A Corn histone H3 (H3C3) gene, complete cds
          Length = 1177

 Score =  440 bits (222), Expect = e-120
 Identities = 252/262 (96%)
 Strand = Plus / Minus

                                                                       
Query: 156 cctaggcgcgctccccgcggatgcggcgggcgagctggatgtccttgggcatgattgtga 215
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||
Sbjct: 957 cctaggcgcgctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtga 898

                                                                       
Query: 216 cgcgcttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtacgcct 275
           |||||||||||||||||||||||||||||||||||||||| || ||||||||||| ||||
Sbjct: 897 cgcgcttggcgtggatggcgcagaggttggtgtcctcgaacaggccgacgaggtaggcct 838

                                                                       
Query: 276 cggcggcctcctggagcgcggagacggcggaggactggaagcggaggtcggtcttgaagt 335
           ||||||||||||| ||||||| ||||||||||||||||||||||||||||||||||||||
Sbjct: 837 cggcggcctcctgcagcgcggcgacggcggaggactggaagcggaggtcggtcttgaagt 778

                                                                       
Query: 336 cctgcgcgatctcccggacgaggcgctgaaaggggagcttgcggatgagcagctccgtgc 395
           ||||||||||||| ||||| |||||||| ||||| |||||||||||||||||||||||||
Sbjct: 777 cctgcgcgatctcgcggaccaggcgctggaagggcagcttgcggatgagcagctccgtgc 718

                                 
Query: 396 tcttctggtacttgcggatctc 417
           ||||||||||||||||||||||
Sbjct: 717 tcttctggtacttgcggatctc 696



to top

>gb|BT017805.1| Zea mays clone EL01N0506E02.c mRNA sequence
          Length = 638

 Score =  432 bits (218), Expect = e-118
 Identities = 251/262 (95%)
 Strand = Plus / Minus

                                                                       
Query: 156 cctaggcgcgctccccgcggatgcggcgggcgagctggatgtccttgggcatgattgtga 215
           |||| |||||||||||||||||||||||||||||||| ||||||||||||||||| ||||
Sbjct: 354 cctaagcgcgctccccgcggatgcggcgggcgagctgaatgtccttgggcatgatggtga 295

                                                                       
Query: 216 cgcgcttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtacgcct 275
           ||||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||
Sbjct: 294 cgcgcttggcgtggatggcgcagaggttggtgtcctcgaagaggccgacgaggtaggcct 235

                                                                       
Query: 276 cggcggcctcctggagcgcggagacggcggaggactggaagcggaggtcggtcttgaagt 335
           | ||||||||||| ||||||| ||||||||||||||||||||||||||||||||||||||
Sbjct: 234 ccgcggcctcctgcagcgcggcgacggcggaggactggaagcggaggtcggtcttgaagt 175

                                                                       
Query: 336 cctgcgcgatctcccggacgaggcgctgaaaggggagcttgcggatgagcagctccgtgc 395
           ||||||||||||| ||||| |||||||| |||||||||||||||||||||||||||||||
Sbjct: 174 cctgcgcgatctcgcggaccaggcgctggaaggggagcttgcggatgagcagctccgtgc 115

                                 
Query: 396 tcttctggtacttgcggatctc 417
           ||||||||||||||||||||||
Sbjct: 114 tcttctggtacttgcggatctc 93



to top

>gb|AC134048.3| Oryza sativa (japonica cultivar-group) chromosome 11 clone OSJNBb0076K20,
              complete sequence
          Length = 127338

 Score =  424 bits (214), Expect = e-115
 Identities = 247/258 (95%)
 Strand = Plus / Minus

                                                                          
Query: 161    gcgcgctccccgcggatgcggcgggcgagctggatgtccttgggcatgattgtgacgcgc 220
              |||||||| ||||||||||||||||||||||||||||||||||||||||| |||||||||
Sbjct: 118174 gcgcgctcaccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 118115

                                                                          
Query: 221    ttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtacgcctcggcg 280
              |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||
Sbjct: 118114 ttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtaggcctcggcg 118055

                                                                          
Query: 281    gcctcctggagcgcggagacggcggaggactggaagcggaggtcggtcttgaagtcctgc 340
              |||||||||||||||| ||||||||||  |||||| |||||||| |||||||||||||||
Sbjct: 118054 gcctcctggagcgcggcgacggcggagctctggaaccggaggtccgtcttgaagtcctgc 117995

                                                                          
Query: 341    gcgatctcccggacgaggcgctgaaaggggagcttgcggatgagcagctccgtgctcttc 400
              ||||||||||||||||| ||||| ||||||||||||||||| ||||||||||||||||||
Sbjct: 117994 gcgatctcccggacgagccgctggaaggggagcttgcggatcagcagctccgtgctcttc 117935

                                
Query: 401    tggtacttgcggatctcc 418
              ||||||||||||||||||
Sbjct: 117934 tggtacttgcggatctcc 117917



to top

>gb|AC112209.4| Oryza sativa (japonica cultivar-group) chromosome 11 clone
             OSJNBb0030I09 map C83B, complete sequence
          Length = 123477

 Score =  424 bits (214), Expect = e-115
 Identities = 247/258 (95%)
 Strand = Plus / Minus

                                                                         
Query: 161   gcgcgctccccgcggatgcggcgggcgagctggatgtccttgggcatgattgtgacgcgc 220
             |||||||| ||||||||||||||||||||||||||||||||||||||||| |||||||||
Sbjct: 13780 gcgcgctcaccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 13721

                                                                         
Query: 221   ttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtacgcctcggcg 280
             |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||
Sbjct: 13720 ttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtaggcctcggcg 13661

                                                                         
Query: 281   gcctcctggagcgcggagacggcggaggactggaagcggaggtcggtcttgaagtcctgc 340
             |||||||||||||||| ||||||||||  |||||| |||||||| |||||||||||||||
Sbjct: 13660 gcctcctggagcgcggcgacggcggagctctggaaccggaggtccgtcttgaagtcctgc 13601

                                                                         
Query: 341   gcgatctcccggacgaggcgctgaaaggggagcttgcggatgagcagctccgtgctcttc 400
             ||||||||||||||||| ||||| ||||||||||||||||| ||||||||||||||||||
Sbjct: 13600 gcgatctcccggacgagccgctggaaggggagcttgcggatcagcagctccgtgctcttc 13541

                               
Query: 401   tggtacttgcggatctcc 418
             ||||||||||||||||||
Sbjct: 13540 tggtacttgcggatctcc 13523



to top

>emb|X13680.1|OSHIS321 Oryza sativa H3 histone H3R-21 clone RH3-2
          Length = 1200

 Score =  424 bits (214), Expect = e-115
 Identities = 247/258 (95%)
 Strand = Plus / Minus

                                                                       
Query: 161 gcgcgctccccgcggatgcggcgggcgagctggatgtccttgggcatgattgtgacgcgc 220
           |||||||| ||||||||||||||||||||||||||||||||||||||||| |||||||||
Sbjct: 807 gcgcgctcaccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 748

                                                                       
Query: 221 ttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtacgcctcggcg 280
           |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||
Sbjct: 747 ttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtaggcctcggcg 688

                                                                       
Query: 281 gcctcctggagcgcggagacggcggaggactggaagcggaggtcggtcttgaagtcctgc 340
           |||||||||||||||| ||||||||||  |||||| |||||||| |||||||||||||||
Sbjct: 687 gcctcctggagcgcggcgacggcggagctctggaaccggaggtccgtcttgaagtcctgc 628

                                                                       
Query: 341 gcgatctcccggacgaggcgctgaaaggggagcttgcggatgagcagctccgtgctcttc 400
           ||||||||||||||||| ||||| ||||||||||||||||| ||||||||||||||||||
Sbjct: 627 gcgatctcccggacgagccgctggaaggggagcttgcggatcagcagctccgtgctcttc 568

                             
Query: 401 tggtacttgcggatctcc 418
           ||||||||||||||||||
Sbjct: 567 tggtacttgcggatctcc 550



to top

>dbj|AP008217.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 11, complete
               sequence
          Length = 28386948

 Score =  424 bits (214), Expect = e-115
 Identities = 247/258 (95%)
 Strand = Plus / Plus

                                                                           
Query: 161     gcgcgctccccgcggatgcggcgggcgagctggatgtccttgggcatgattgtgacgcgc 220
               |||||||| ||||||||||||||||||||||||||||||||||||||||| |||||||||
Sbjct: 2608624 gcgcgctcaccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 2608683

                                                                           
Query: 221     ttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtacgcctcggcg 280
               |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||
Sbjct: 2608684 ttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtaggcctcggcg 2608743

                                                                           
Query: 281     gcctcctggagcgcggagacggcggaggactggaagcggaggtcggtcttgaagtcctgc 340
               |||||||||||||||| ||||||||||  |||||| |||||||| |||||||||||||||
Sbjct: 2608744 gcctcctggagcgcggcgacggcggagctctggaaccggaggtccgtcttgaagtcctgc 2608803

                                                                           
Query: 341     gcgatctcccggacgaggcgctgaaaggggagcttgcggatgagcagctccgtgctcttc 400
               ||||||||||||||||| ||||| ||||||||||||||||| ||||||||||||||||||
Sbjct: 2608804 gcgatctcccggacgagccgctggaaggggagcttgcggatcagcagctccgtgctcttc 2608863

                                 
Query: 401     tggtacttgcggatctcc 418
               ||||||||||||||||||
Sbjct: 2608864 tggtacttgcggatctcc 2608881



to top

>gb|DP000010.1| Oryza sativa (japonica cultivar-group) chromosome 11, complete sequence
          Length = 28369397

 Score =  424 bits (214), Expect = e-115
 Identities = 247/258 (95%)
 Strand = Plus / Plus

                                                                           
Query: 161     gcgcgctccccgcggatgcggcgggcgagctggatgtccttgggcatgattgtgacgcgc 220
               |||||||| ||||||||||||||||||||||||||||||||||||||||| |||||||||
Sbjct: 2617655 gcgcgctcaccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 2617714

                                                                           
Query: 221     ttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtacgcctcggcg 280
               |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||
Sbjct: 2617715 ttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtaggcctcggcg 2617774

                                                                           
Query: 281     gcctcctggagcgcggagacggcggaggactggaagcggaggtcggtcttgaagtcctgc 340
               |||||||||||||||| ||||||||||  |||||| |||||||| |||||||||||||||
Sbjct: 2617775 gcctcctggagcgcggcgacggcggagctctggaaccggaggtccgtcttgaagtcctgc 2617834

                                                                           
Query: 341     gcgatctcccggacgaggcgctgaaaggggagcttgcggatgagcagctccgtgctcttc 400
               ||||||||||||||||| ||||| ||||||||||||||||| ||||||||||||||||||
Sbjct: 2617835 gcgatctcccggacgagccgctggaaggggagcttgcggatcagcagctccgtgctcttc 2617894

                                 
Query: 401     tggtacttgcggatctcc 418
               ||||||||||||||||||
Sbjct: 2617895 tggtacttgcggatctcc 2617912



to top

>gb|U77296.1|OSU77296 Oryza sativa histone 3 mRNA, complete cds
          Length = 642

 Score =  424 bits (214), Expect = e-115
 Identities = 247/258 (95%)
 Strand = Plus / Minus

                                                                       
Query: 161 gcgcgctccccgcggatgcggcgggcgagctggatgtccttgggcatgattgtgacgcgc 220
           |||||||| ||||||||||||||||||||||||||||||||||||||||| |||||||||
Sbjct: 478 gcgcgctcaccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 419

                                                                       
Query: 221 ttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtacgcctcggcg 280
           |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||
Sbjct: 418 ttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtaggcctcggcg 359

                                                                       
Query: 281 gcctcctggagcgcggagacggcggaggactggaagcggaggtcggtcttgaagtcctgc 340
           |||||||||||||||| ||||||||||  |||||| |||||||| |||||||||||||||
Sbjct: 358 gcctcctggagcgcggcgacggcggagctctggaaccggaggtccgtcttgaagtcctgc 299

                                                                       
Query: 341 gcgatctcccggacgaggcgctgaaaggggagcttgcggatgagcagctccgtgctcttc 400
           ||||||||||||||||| ||||| ||||||||||||||||| ||||||||||||||||||
Sbjct: 298 gcgatctcccggacgagccgctggaaggggagcttgcggatcagcagctccgtgctcttc 239

                             
Query: 401 tggtacttgcggatctcc 418
           ||||||||||||||||||
Sbjct: 238 tggtacttgcggatctcc 221



to top

>ref|NM_185612.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 411

 Score =  418 bits (211), Expect = e-114
 Identities = 247/259 (95%)
 Strand = Plus / Minus

                                                                       
Query: 159 aggcgcgctccccgcggatgcggcgggcgagctggatgtccttgggcatgattgtgacgc 218
           |||||||||| ||||||||||||||||||||||||||||||||||||||||| |||||||
Sbjct: 409 aggcgcgctcaccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgc 350

                                                                       
Query: 219 gcttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtacgcctcgg 278
           ||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||| |
Sbjct: 349 gcttggcgtggatggcgcacaggttagtgtcctcgaagagcccgacgaggtacgcctccg 290

                                                                       
Query: 279 cggcctcctggagcgcggagacggcggaggactggaagcggaggtcggtcttgaagtcct 338
           |||||||||| ||||||| ||||||||||  |||||||||||||||||||||||||||||
Sbjct: 289 cggcctcctgcagcgcggcgacggcggagctctggaagcggaggtcggtcttgaagtcct 230

                                                                       
Query: 339 gcgcgatctcccggacgaggcgctgaaaggggagcttgcggatgagcagctccgtgctct 398
           | |||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||
Sbjct: 229 gggcgatctcgcggacgaggcgctggaaggggagcttgcggatgagcagctccgtgctct 170

                              
Query: 399 tctggtacttgcggatctc 417
           |||||||||||||||||||
Sbjct: 169 tctggtacttgcggatctc 151



to top

>dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, complete
               sequence
          Length = 30731886

 Score =  418 bits (211), Expect = e-114
 Identities = 247/259 (95%)
 Strand = Plus / Plus

                                                                           
Query: 159     aggcgcgctccccgcggatgcggcgggcgagctggatgtccttgggcatgattgtgacgc 218
               |||||||||| ||||||||||||||||||||||||||||||||||||||||| |||||||
Sbjct: 3054206 aggcgcgctcaccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgc 3054265

                                                                           
Query: 219     gcttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtacgcctcgg 278
               ||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||| |
Sbjct: 3054266 gcttggcgtggatggcgcacaggttagtgtcctcgaagagcccgacgaggtacgcctccg 3054325

                                                                           
Query: 279     cggcctcctggagcgcggagacggcggaggactggaagcggaggtcggtcttgaagtcct 338
               |||||||||| ||||||| ||||||||||  |||||||||||||||||||||||||||||
Sbjct: 3054326 cggcctcctgcagcgcggcgacggcggagctctggaagcggaggtcggtcttgaagtcct 3054385

                                                                           
Query: 339     gcgcgatctcccggacgaggcgctgaaaggggagcttgcggatgagcagctccgtgctct 398
               | |||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||
Sbjct: 3054386 gggcgatctcgcggacgaggcgctggaaggggagcttgcggatgagcagctccgtgctct 3054445

                                  
Query: 399     tctggtacttgcggatctc 417
               |||||||||||||||||||
Sbjct: 3054446 tctggtacttgcggatctc 3054464



 Score =  410 bits (207), Expect = e-111
 Identities = 246/259 (94%)
 Strand = Plus / Plus

                                                                           
Query: 159     aggcgcgctccccgcggatgcggcgggcgagctggatgtccttgggcatgattgtgacgc 218
               |||||||||| |||||||| ||||| |||||||||||||||||||||||||| |||||||
Sbjct: 3045559 aggcgcgctcaccgcggatccggcgcgcgagctggatgtccttgggcatgatggtgacgc 3045618

                                                                           
Query: 219     gcttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtacgcctcgg 278
               ||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||||||
Sbjct: 3045619 gcttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacgaggtacgcctcgg 3045678

                                                                           
Query: 279     cggcctcctggagcgcggagacggcggaggactggaagcggaggtcggtcttgaagtcct 338
               |||||||||| ||||||| ||||||||||  |||||||||||||||||||||||||||||
Sbjct: 3045679 cggcctcctgcagcgcggcgacggcggagctctggaagcggaggtcggtcttgaagtcct 3045738

                                                                           
Query: 339     gcgcgatctcccggacgaggcgctgaaaggggagcttgcggatgagcagctccgtgctct 398
               | |||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||
Sbjct: 3045739 gggcgatctcgcggacgaggcgctggaaggggagcttgcggatgagcagctccgtgctct 3045798

                                  
Query: 399     tctggtacttgcggatctc 417
               |||||||||||||||||||
Sbjct: 3045799 tctggtacttgcggatctc 3045817



 Score =  400 bits (202), Expect = e-108
 Identities = 247/262 (94%)
 Strand = Plus / Plus

                                                                           
Query: 156     cctaggcgcgctccccgcggatgcggcgggcgagctggatgtccttgggcatgattgtga 215
               |||| |||||||| |||||||| ||||| |||||||||||||||||||||||||| ||||
Sbjct: 3039526 cctaagcgcgctcgccgcggatccggcgcgcgagctggatgtccttgggcatgatggtga 3039585

                                                                           
Query: 216     cgcgcttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtacgcct 275
               ||||||||||||||||||| || ||||||||||||||||| |||||||||||||||||||
Sbjct: 3039586 cgcgcttggcgtggatggcacacaggttggtgtcctcgaacagcccgacgaggtacgcct 3039645

                                                                           
Query: 276     cggcggcctcctggagcgcggagacggcggaggactggaagcggaggtcggtcttgaagt 335
               ||||||||||||| ||||||| ||||||||||  ||||||||||||||||||||||||||
Sbjct: 3039646 cggcggcctcctgcagcgcggcgacggcggagctctggaagcggaggtcggtcttgaagt 3039705

                                                                           
Query: 336     cctgcgcgatctcccggacgaggcgctgaaaggggagcttgcggatgagcagctccgtgc 395
               |||| |||||||| |||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 3039706 cctgggcgatctcgcggacgaggcgctggaaggggagcttgcggatgagcagctccgtgc 3039765

                                     
Query: 396     tcttctggtacttgcggatctc 417
               ||||||||||||||||||||||
Sbjct: 3039766 tcttctggtacttgcggatctc 3039787



 Score =  392 bits (198), Expect = e-106
 Identities = 246/262 (93%)
 Strand = Plus / Minus

                                                                           
Query: 156     cctaggcgcgctccccgcggatgcggcgggcgagctggatgtccttgggcatgattgtga 215
               |||| |||||||| |||||||| ||||| |||||||||||||||||||||||||| ||||
Sbjct: 3055574 cctaagcgcgctcgccgcggatccggcgcgcgagctggatgtccttgggcatgatggtga 3055515

                                                                           
Query: 216     cgcgcttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtacgcct 275
               |||||||||||||||||||||| ||||||||||||||||| |||||||||||||||||||
Sbjct: 3055514 cgcgcttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacgaggtacgcct 3055455

                                                                           
Query: 276     cggcggcctcctggagcgcggagacggcggaggactggaagcggaggtcggtcttgaagt 335
               | ||||||||||| || |||| ||||||||||  ||||||||||||||||||||||||||
Sbjct: 3055454 ccgcggcctcctgcagggcggcgacggcggagctctggaagcggaggtcggtcttgaagt 3055395

                                                                           
Query: 336     cctgcgcgatctcccggacgaggcgctgaaaggggagcttgcggatgagcagctccgtgc 395
               |||| |||||||| |||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 3055394 cctgggcgatctcgcggacgaggcgctggaaggggagcttgcggatgagcagctccgtgc 3055335

                                     
Query: 396     tcttctggtacttgcggatctc 417
               ||||||||||||||||||||||
Sbjct: 3055334 tcttctggtacttgcggatctc 3055313



 Score =  375 bits (189), Expect = e-101
 Identities = 240/257 (93%)
 Strand = Plus / Plus

                                                                           
Query: 161     gcgcgctccccgcggatgcggcgggcgagctggatgtccttgggcatgattgtgacgcgc 220
               |||||||| ||||||||||||||||||||||||||||||||||||||||| |||||||||
Sbjct: 1644700 gcgcgctcgccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 1644759

                                                                           
Query: 221     ttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtacgcctcggcg 280
               |||||||||||||||||||||||||||||||||||||| ||||||||||| |||||||||
Sbjct: 1644760 ttggcgtggatggcgcagaggttggtgtcctcgaagagaccgacgaggtaggcctcggcg 1644819

                                                                           
Query: 281     gcctcctggagcgcggagacggcggaggactggaagcggaggtcggtcttgaagtcctgc 340
               ||||||||||| |||   || |||  |  |||||||||||||||||||||||||||||||
Sbjct: 1644820 gcctcctggagggcgagcaccgcgtggctctggaagcggaggtcggtcttgaagtcctgc 1644879

                                                                           
Query: 341     gcgatctcccggacgaggcgctgaaaggggagcttgcggatgagcagctccgtgctcttc 400
               |||||||| |||||||||||||| ||||||||||||||||| || |||||||||||||||
Sbjct: 1644880 gcgatctcgcggacgaggcgctggaaggggagcttgcggatcaggagctccgtgctcttc 1644939

                                
Query: 401     tggtacttgcggatctc 417
               |||||||||||||||||
Sbjct: 1644940 tggtacttgcggatctc 1644956



to top

>dbj|AP005828.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC
              clone:P0702F05
          Length = 145018

 Score =  418 bits (211), Expect = e-114
 Identities = 247/259 (95%)
 Strand = Plus / Plus

                                                                          
Query: 159    aggcgcgctccccgcggatgcggcgggcgagctggatgtccttgggcatgattgtgacgc 218
              |||||||||| ||||||||||||||||||||||||||||||||||||||||| |||||||
Sbjct: 142155 aggcgcgctcaccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgc 142214

                                                                          
Query: 219    gcttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtacgcctcgg 278
              ||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||| |
Sbjct: 142215 gcttggcgtggatggcgcacaggttagtgtcctcgaagagcccgacgaggtacgcctccg 142274

                                                                          
Query: 279    cggcctcctggagcgcggagacggcggaggactggaagcggaggtcggtcttgaagtcct 338
              |||||||||| ||||||| ||||||||||  |||||||||||||||||||||||||||||
Sbjct: 142275 cggcctcctgcagcgcggcgacggcggagctctggaagcggaggtcggtcttgaagtcct 142334

                                                                          
Query: 339    gcgcgatctcccggacgaggcgctgaaaggggagcttgcggatgagcagctccgtgctct 398
              | |||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||
Sbjct: 142335 gggcgatctcgcggacgaggcgctggaaggggagcttgcggatgagcagctccgtgctct 142394

                                 
Query: 399    tctggtacttgcggatctc 417
              |||||||||||||||||||
Sbjct: 142395 tctggtacttgcggatctc 142413



 Score =  410 bits (207), Expect = e-111
 Identities = 246/259 (94%)
 Strand = Plus / Plus

                                                                          
Query: 159    aggcgcgctccccgcggatgcggcgggcgagctggatgtccttgggcatgattgtgacgc 218
              |||||||||| |||||||| ||||| |||||||||||||||||||||||||| |||||||
Sbjct: 133508 aggcgcgctcaccgcggatccggcgcgcgagctggatgtccttgggcatgatggtgacgc 133567

                                                                          
Query: 219    gcttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtacgcctcgg 278
              ||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||||||
Sbjct: 133568 gcttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacgaggtacgcctcgg 133627

                                                                          
Query: 279    cggcctcctggagcgcggagacggcggaggactggaagcggaggtcggtcttgaagtcct 338
              |||||||||| ||||||| ||||||||||  |||||||||||||||||||||||||||||
Sbjct: 133628 cggcctcctgcagcgcggcgacggcggagctctggaagcggaggtcggtcttgaagtcct 133687

                                                                          
Query: 339    gcgcgatctcccggacgaggcgctgaaaggggagcttgcggatgagcagctccgtgctct 398
              | |||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||
Sbjct: 133688 gggcgatctcgcggacgaggcgctggaaggggagcttgcggatgagcagctccgtgctct 133747

                                 
Query: 399    tctggtacttgcggatctc 417
              |||||||||||||||||||
Sbjct: 133748 tctggtacttgcggatctc 133766



 Score =  400 bits (202), Expect = e-108
 Identities = 247/262 (94%)
 Strand = Plus / Plus

                                                                          
Query: 156    cctaggcgcgctccccgcggatgcggcgggcgagctggatgtccttgggcatgattgtga 215
              |||| |||||||| |||||||| ||||| |||||||||||||||||||||||||| ||||
Sbjct: 127475 cctaagcgcgctcgccgcggatccggcgcgcgagctggatgtccttgggcatgatggtga 127534

                                                                          
Query: 216    cgcgcttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtacgcct 275
              ||||||||||||||||||| || ||||||||||||||||| |||||||||||||||||||
Sbjct: 127535 cgcgcttggcgtggatggcacacaggttggtgtcctcgaacagcccgacgaggtacgcct 127594

                                                                          
Query: 276    cggcggcctcctggagcgcggagacggcggaggactggaagcggaggtcggtcttgaagt 335
              ||||||||||||| ||||||| ||||||||||  ||||||||||||||||||||||||||
Sbjct: 127595 cggcggcctcctgcagcgcggcgacggcggagctctggaagcggaggtcggtcttgaagt 127654

                                                                          
Query: 336    cctgcgcgatctcccggacgaggcgctgaaaggggagcttgcggatgagcagctccgtgc 395
              |||| |||||||| |||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 127655 cctgggcgatctcgcggacgaggcgctggaaggggagcttgcggatgagcagctccgtgc 127714

                                    
Query: 396    tcttctggtacttgcggatctc 417
              ||||||||||||||||||||||
Sbjct: 127715 tcttctggtacttgcggatctc 127736



 Score =  392 bits (198), Expect = e-106
 Identities = 246/262 (93%)
 Strand = Plus / Minus

                                                                          
Query: 156    cctaggcgcgctccccgcggatgcggcgggcgagctggatgtccttgggcatgattgtga 215
              |||| |||||||| |||||||| ||||| |||||||||||||||||||||||||| ||||
Sbjct: 143523 cctaagcgcgctcgccgcggatccggcgcgcgagctggatgtccttgggcatgatggtga 143464

                                                                          
Query: 216    cgcgcttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtacgcct 275
              |||||||||||||||||||||| ||||||||||||||||| |||||||||||||||||||
Sbjct: 143463 cgcgcttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacgaggtacgcct 143404

                                                                          
Query: 276    cggcggcctcctggagcgcggagacggcggaggactggaagcggaggtcggtcttgaagt 335
              | ||||||||||| || |||| ||||||||||  ||||||||||||||||||||||||||
Sbjct: 143403 ccgcggcctcctgcagggcggcgacggcggagctctggaagcggaggtcggtcttgaagt 143344

                                                                          
Query: 336    cctgcgcgatctcccggacgaggcgctgaaaggggagcttgcggatgagcagctccgtgc 395
              |||| |||||||| |||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 143343 cctgggcgatctcgcggacgaggcgctggaaggggagcttgcggatgagcagctccgtgc 143284

                                    
Query: 396    tcttctggtacttgcggatctc 417
              ||||||||||||||||||||||
Sbjct: 143283 tcttctggtacttgcggatctc 143262



to top

>dbj|AB026295.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6,
            clone:P0681F10
          Length = 170371

 Score =  418 bits (211), Expect = e-114
 Identities = 247/259 (95%)
 Strand = Plus / Plus

                                                                        
Query: 159  aggcgcgctccccgcggatgcggcgggcgagctggatgtccttgggcatgattgtgacgc 218
            |||||||||| ||||||||||||||||||||||||||||||||||||||||| |||||||
Sbjct: 8391 aggcgcgctcaccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgc 8450

                                                                        
Query: 219  gcttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtacgcctcgg 278
            ||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||| |
Sbjct: 8451 gcttggcgtggatggcgcacaggttagtgtcctcgaagagcccgacgaggtacgcctccg 8510

                                                                        
Query: 279  cggcctcctggagcgcggagacggcggaggactggaagcggaggtcggtcttgaagtcct 338
            |||||||||| ||||||| ||||||||||  |||||||||||||||||||||||||||||
Sbjct: 8511 cggcctcctgcagcgcggcgacggcggagctctggaagcggaggtcggtcttgaagtcct 8570

                                                                        
Query: 339  gcgcgatctcccggacgaggcgctgaaaggggagcttgcggatgagcagctccgtgctct 398
            | |||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||
Sbjct: 8571 gggcgatctcgcggacgaggcgctggaaggggagcttgcggatgagcagctccgtgctct 8630

                               
Query: 399  tctggtacttgcggatctc 417
            |||||||||||||||||||
Sbjct: 8631 tctggtacttgcggatctc 8649



 Score =  392 bits (198), Expect = e-106
 Identities = 246/262 (93%)
 Strand = Plus / Minus

                                                                        
Query: 156  cctaggcgcgctccccgcggatgcggcgggcgagctggatgtccttgggcatgattgtga 215
            |||| |||||||| |||||||| ||||| |||||||||||||||||||||||||| ||||
Sbjct: 9759 cctaagcgcgctcgccgcggatccggcgcgcgagctggatgtccttgggcatgatggtga 9700

                                                                        
Query: 216  cgcgcttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtacgcct 275
            |||||||||||||||||||||| ||||||||||||||||| |||||||||||||||||||
Sbjct: 9699 cgcgcttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacgaggtacgcct 9640

                                                                        
Query: 276  cggcggcctcctggagcgcggagacggcggaggactggaagcggaggtcggtcttgaagt 335
            | ||||||||||| || |||| ||||||||||  ||||||||||||||||||||||||||
Sbjct: 9639 ccgcggcctcctgcagggcggcgacggcggagctctggaagcggaggtcggtcttgaagt 9580

                                                                        
Query: 336  cctgcgcgatctcccggacgaggcgctgaaaggggagcttgcggatgagcagctccgtgc 395
            |||| |||||||| |||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 9579 cctgggcgatctcgcggacgaggcgctggaaggggagcttgcggatgagcagctccgtgc 9520

                                  
Query: 396  tcttctggtacttgcggatctc 417
            ||||||||||||||||||||||
Sbjct: 9519 tcttctggtacttgcggatctc 9498



to top

>ref|NM_185609.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 432

 Score =  410 bits (207), Expect = e-111
 Identities = 246/259 (94%)
 Strand = Plus / Minus

                                                                       
Query: 159 aggcgcgctccccgcggatgcggcgggcgagctggatgtccttgggcatgattgtgacgc 218
           |||||||||| |||||||| ||||| |||||||||||||||||||||||||| |||||||
Sbjct: 430 aggcgcgctcaccgcggatccggcgcgcgagctggatgtccttgggcatgatggtgacgc 371

                                                                       
Query: 219 gcttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtacgcctcgg 278
           ||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||||||
Sbjct: 370 gcttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacgaggtacgcctcgg 311

                                                                       
Query: 279 cggcctcctggagcgcggagacggcggaggactggaagcggaggtcggtcttgaagtcct 338
           |||||||||| ||||||| ||||||||||  |||||||||||||||||||||||||||||
Sbjct: 310 cggcctcctgcagcgcggcgacggcggagctctggaagcggaggtcggtcttgaagtcct 251

                                                                       
Query: 339 gcgcgatctcccggacgaggcgctgaaaggggagcttgcggatgagcagctccgtgctct 398
           | |||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||
Sbjct: 250 gggcgatctcgcggacgaggcgctggaaggggagcttgcggatgagcagctccgtgctct 191

                              
Query: 399 tctggtacttgcggatctc 417
           |||||||||||||||||||
Sbjct: 190 tctggtacttgcggatctc 172



to top

>emb|X13679.1|OSHIS3PS Oryza sativa H3 histone pseudogene H3R-12
          Length = 1920

 Score =  410 bits (207), Expect = e-111
 Identities = 246/259 (94%)
 Strand = Plus / Minus

                                                                        
Query: 159  aggcgcgctccccgcggatgcggcgggcgagctggatgtccttgggcatgattgtgacgc 218
            |||||||||| |||||||| ||||| |||||||||||||||||||||||||| |||||||
Sbjct: 1529 aggcgcgctcaccgcggatccggcgcgcgagctggatgtccttgggcatgatggtgacgc 1470

                                                                        
Query: 219  gcttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtacgcctcgg 278
            ||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||||||
Sbjct: 1469 gcttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacgaggtacgcctcgg 1410

                                                                        
Query: 279  cggcctcctggagcgcggagacggcggaggactggaagcggaggtcggtcttgaagtcct 338
            |||||||||| ||||||| ||||||||||  |||||||||||||||||||||||||||||
Sbjct: 1409 cggcctcctgcagcgcggcgacggcggagctctggaagcggaggtcggtcttgaagtcct 1350

                                                                        
Query: 339  gcgcgatctcccggacgaggcgctgaaaggggagcttgcggatgagcagctccgtgctct 398
            | |||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||
Sbjct: 1349 gggcgatctcgcggacgaggcgctggaaggggagcttgcggatgagcagctccgtgctct 1290

                               
Query: 399  tctggtacttgcggatctc 417
            |||||||||||||||||||
Sbjct: 1289 tctggtacttgcggatctc 1271



to top

>emb|X13678.1|OSHIS311 Oryza sativa H3 histone gene H3R-11
          Length = 1200

 Score =  400 bits (202), Expect = e-108
 Identities = 247/262 (94%)
 Strand = Plus / Minus

                                                                       
Query: 156 cctaggcgcgctccccgcggatgcggcgggcgagctggatgtccttgggcatgattgtga 215
           |||| |||||||| |||||||| ||||| |||||||||||||||||||||||||| ||||
Sbjct: 812 cctaagcgcgctcgccgcggatccggcgcgcgagctggatgtccttgggcatgatggtga 753

                                                                       
Query: 216 cgcgcttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtacgcct 275
           ||||||||||||||||||| || ||||||||||||||||| |||||||||||||||||||
Sbjct: 752 cgcgcttggcgtggatggcacacaggttggtgtcctcgaacagcccgacgaggtacgcct 693

                                                                       
Query: 276 cggcggcctcctggagcgcggagacggcggaggactggaagcggaggtcggtcttgaagt 335
           ||||||||||||| ||||||| ||||||||||  ||||||||||||||||||||||||||
Sbjct: 692 cggcggcctcctgcagcgcggcgacggcggagctctggaagcggaggtcggtcttgaagt 633

                                                                       
Query: 336 cctgcgcgatctcccggacgaggcgctgaaaggggagcttgcggatgagcagctccgtgc 395
           |||| |||||||| |||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 632 cctgggcgatctcgcggacgaggcgctggaaggggagcttgcggatgagcagctccgtgc 573

                                 
Query: 396 tcttctggtacttgcggatctc 417
           ||||||||||||||||||||||
Sbjct: 572 tcttctggtacttgcggatctc 551



to top

>emb|X00937.1|TAHI02 Wheat histone H3 gene
          Length = 811

 Score =  400 bits (202), Expect = e-108
 Identities = 247/262 (94%)
 Strand = Plus / Minus

                                                                       
Query: 156 cctaggcgcgctccccgcggatgcggcgggcgagctggatgtccttgggcatgattgtga 215
           ||||||| | ||| || |||||||||||||||||||||||||||||||||||||| ||||
Sbjct: 659 cctaggccctctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtga 600

                                                                       
Query: 216 cgcgcttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtacgcct 275
           ||||||||||||||||||||||||||||||||||||||||||| || |||||||| ||||
Sbjct: 599 cgcgcttggcgtggatggcgcagaggttggtgtcctcgaagaggcccacgaggtaggcct 540

                                                                       
Query: 276 cggcggcctcctggagcgcggagacggcggaggactggaagcggaggtcggtcttgaagt 335
           ||||||||||||| || |||||||||||||||||||||||||||||||||||||||||||
Sbjct: 539 cggcggcctcctgcagggcggagacggcggaggactggaagcggaggtcggtcttgaagt 480

                                                                       
Query: 336 cctgcgcgatctcccggacgaggcgctgaaaggggagcttgcggatgagcagctccgtgc 395
           |||| |||||||| || || |||||||| |||||||||||||||||||||||||||||||
Sbjct: 479 cctgggcgatctcgcgcactaggcgctggaaggggagcttgcggatgagcagctccgtgc 420

                                 
Query: 396 tcttctggtacttgcggatctc 417
           ||||||||||||||||||||||
Sbjct: 419 tcttctggtacttgcggatctc 398



to top

>ref|NM_185607.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 411

 Score =  398 bits (201), Expect = e-108
 Identities = 243/257 (94%)
 Strand = Plus / Minus

                                                                       
Query: 161 gcgcgctccccgcggatgcggcgggcgagctggatgtccttgggcatgattgtgacgcgc 220
           |||||||| |||||||| ||||| |||||||||||||||||||||||||| |||||||||
Sbjct: 407 gcgcgctcgccgcggatccggcgcgcgagctggatgtccttgggcatgatggtgacgcgc 348

                                                                       
Query: 221 ttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtacgcctcggcg 280
           |||||||||||||| || ||||||||||||||||| ||||||||||||||||||||||||
Sbjct: 347 ttggcgtggatggcacacaggttggtgtcctcgaacagcccgacgaggtacgcctcggcg 288

                                                                       
Query: 281 gcctcctggagcgcggagacggcggaggactggaagcggaggtcggtcttgaagtcctgc 340
           |||||||| ||||||| ||||||||||  |||||||||||||||||||||||||||||| 
Sbjct: 287 gcctcctgcagcgcggcgacggcggagctctggaagcggaggtcggtcttgaagtcctgg 228

                                                                       
Query: 341 gcgatctcccggacgaggcgctgaaaggggagcttgcggatgagcagctccgtgctcttc 400
           |||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||||
Sbjct: 227 gcgatctcgcggacgaggcgctggaaggggagcttgcggatgagcagctccgtgctcttc 168

                            
Query: 401 tggtacttgcggatctc 417
           |||||||||||||||||
Sbjct: 167 tggtacttgcggatctc 151



to top

>gb|U25664.1|OSU25664 Oryza sativa histone H3 gene, complete cds
          Length = 711

 Score =  394 bits (199), Expect = e-107
 Identities = 244/259 (94%)
 Strand = Plus / Minus

                                                                       
Query: 159 aggcgcgctccccgcggatgcggcgggcgagctggatgtccttgggcatgattgtgacgc 218
           |||||||||| ||||||||||||||||||||||||||||||||||||||||| |||||||
Sbjct: 639 aggcgcgctcaccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgc 580

                                                                       
Query: 219 gcttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtacgcctcgg 278
           ||||||||||||||||||| ||||| |||||||||||||||||||||||||||  ||| |
Sbjct: 579 gcttggcgtggatggcgcacaggttagtgtcctcgaagagcccgacgaggtaccgctccg 520

                                                                       
Query: 279 cggcctcctggagcgcggagacggcggaggactggaagcggaggtcggtcttgaagtcct 338
           |||||||||| ||||||  ||||||||| | |||||||||||||||||||||||||||||
Sbjct: 519 cggcctcctgcagcgcgcggacggcggacgtctggaagcggaggtcggtcttgaagtcct 460

                                                                       
Query: 339 gcgcgatctcccggacgaggcgctgaaaggggagcttgcggatgagcagctccgtgctct 398
           | |||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||
Sbjct: 459 gggcgatctcgcggacgaggcgctggaaggggagcttgcggatgagcagctccgtgctct 400

                              
Query: 399 tctggtacttgcggatctc 417
           |||||||||||||||||||
Sbjct: 399 tctggtacttgcggatctc 381



to top

>gb|M15664.1|RICHIS3 Rice histone 3 gene, complete cds
          Length = 568

 Score =  394 bits (199), Expect = e-107
 Identities = 244/259 (94%)
 Strand = Plus / Minus

                                                                       
Query: 159 aggcgcgctccccgcggatgcggcgggcgagctggatgtccttgggcatgattgtgacgc 218
           |||||||||| ||||||||||||||||||||||||||||||||||||||||| |||||||
Sbjct: 546 aggcgcgctcaccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgc 487

                                                                       
Query: 219 gcttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtacgcctcgg 278
           ||||||||||||||||||| ||||| |||||||||||||||||||||||||||  ||| |
Sbjct: 486 gcttggcgtggatggcgcacaggttagtgtcctcgaagagcccgacgaggtaccgctccg 427

                                                                       
Query: 279 cggcctcctggagcgcggagacggcggaggactggaagcggaggtcggtcttgaagtcct 338
           |||||||||| ||||||  ||||||||| | |||||||||||||||||||||||||||||
Sbjct: 426 cggcctcctgcagcgcgcggacggcggacgtctggaagcggaggtcggtcttgaagtcct 367

                                                                       
Query: 339 gcgcgatctcccggacgaggcgctgaaaggggagcttgcggatgagcagctccgtgctct 398
           | |||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||
Sbjct: 366 gggcgatctcgcggacgaggcgctggaaggggagcttgcggatgagcagctccgtgctct 307

                              
Query: 399 tctggtacttgcggatctc 417
           |||||||||||||||||||
Sbjct: 306 tctggtacttgcggatctc 288



to top

>ref|XM_475315.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 411

 Score =  392 bits (198), Expect = e-106
 Identities = 234/246 (95%)
 Strand = Plus / Minus

                                                                       
Query: 173 cggatgcggcgggcgagctggatgtccttgggcatgattgtgacgcgcttggcgtggatg 232
           |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||
Sbjct: 395 cggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtggatg 336

                                                                       
Query: 233 gcgcagaggttggtgtcctcgaagagcccgacgaggtacgcctcggcggcctcctggagc 292
           |||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |||
Sbjct: 335 gcgcagaggttggtgtcctcgaagagcccgacgaggtaggcctcggcggcctcctgcagc 276

                                                                       
Query: 293 gcggagacggcggaggactggaagcggaggtcggtcttgaagtcctgcgcgatctcccgg 352
           |||| ||||||||||  |||||||||||||||||||||||||||||||||||||||||| 
Sbjct: 275 gcggcgacggcggagctctggaagcggaggtcggtcttgaagtcctgcgcgatctcccgc 216

                                                                       
Query: 353 acgaggcgctgaaaggggagcttgcggatgagcagctccgtgctcttctggtacttgcgg 412
           || || ||||| || || ||||||||||||||||||||||||||||||||||||||||||
Sbjct: 215 accagccgctggaacggcagcttgcggatgagcagctccgtgctcttctggtacttgcgg 156

                 
Query: 413 atctcc 418
           ||||||
Sbjct: 155 atctcc 150



to top

>gb|AC134930.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone
             OSJNBb0042J17, complete sequence
          Length = 124139

 Score =  392 bits (198), Expect = e-106
 Identities = 234/246 (95%)
 Strand = Plus / Plus

                                                                         
Query: 173   cggatgcggcgggcgagctggatgtccttgggcatgattgtgacgcgcttggcgtggatg 232
             |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||
Sbjct: 72777 cggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtggatg 72836

                                                                         
Query: 233   gcgcagaggttggtgtcctcgaagagcccgacgaggtacgcctcggcggcctcctggagc 292
             |||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |||
Sbjct: 72837 gcgcagaggttggtgtcctcgaagagcccgacgaggtaggcctcggcggcctcctgcagc 72896

                                                                         
Query: 293   gcggagacggcggaggactggaagcggaggtcggtcttgaagtcctgcgcgatctcccgg 352
             |||| ||||||||||  |||||||||||||||||||||||||||||||||||||||||| 
Sbjct: 72897 gcggcgacggcggagctctggaagcggaggtcggtcttgaagtcctgcgcgatctcccgc 72956

                                                                         
Query: 353   acgaggcgctgaaaggggagcttgcggatgagcagctccgtgctcttctggtacttgcgg 412
             || || ||||| || || ||||||||||||||||||||||||||||||||||||||||||
Sbjct: 72957 accagccgctggaacggcagcttgcggatgagcagctccgtgctcttctggtacttgcgg 73016

                   
Query: 413   atctcc 418
             ||||||
Sbjct: 73017 atctcc 73022



to top

>dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 5, complete
                sequence
          Length = 29737217

 Score =  392 bits (198), Expect = e-106
 Identities = 234/246 (95%)
 Strand = Plus / Plus

                                                                            
Query: 173      cggatgcggcgggcgagctggatgtccttgggcatgattgtgacgcgcttggcgtggatg 232
                |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||
Sbjct: 21355455 cggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtggatg 21355514

                                                                            
Query: 233      gcgcagaggttggtgtcctcgaagagcccgacgaggtacgcctcggcggcctcctggagc 292
                |||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |||
Sbjct: 21355515 gcgcagaggttggtgtcctcgaagagcccgacgaggtaggcctcggcggcctcctgcagc 21355574

                                                                            
Query: 293      gcggagacggcggaggactggaagcggaggtcggtcttgaagtcctgcgcgatctcccgg 352
                |||| ||||||||||  |||||||||||||||||||||||||||||||||||||||||| 
Sbjct: 21355575 gcggcgacggcggagctctggaagcggaggtcggtcttgaagtcctgcgcgatctcccgc 21355634

                                                                            
Query: 353      acgaggcgctgaaaggggagcttgcggatgagcagctccgtgctcttctggtacttgcgg 412
                || || ||||| || || ||||||||||||||||||||||||||||||||||||||||||
Sbjct: 21355635 accagccgctggaacggcagcttgcggatgagcagctccgtgctcttctggtacttgcgg 21355694

                      
Query: 413      atctcc 418
                ||||||
Sbjct: 21355695 atctcc 21355700



 Score = 42.1 bits (21), Expect = 1.4
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                         
Query: 286      ctggagcgcggagacggcggaggac 310
                ||||||||||| |||||||||||||
Sbjct: 22239243 ctggagcgcggtgacggcggaggac 22239267



to top

>dbj|AK120955.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023039F20, full
           insert sequence
          Length = 735

 Score =  392 bits (198), Expect = e-106
 Identities = 234/246 (95%)
 Strand = Plus / Minus

                                                                       
Query: 173 cggatgcggcgggcgagctggatgtccttgggcatgattgtgacgcgcttggcgtggatg 232
           |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||
Sbjct: 480 cggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtggatg 421

                                                                       
Query: 233 gcgcagaggttggtgtcctcgaagagcccgacgaggtacgcctcggcggcctcctggagc 292
           |||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |||
Sbjct: 420 gcgcagaggttggtgtcctcgaagagcccgacgaggtaggcctcggcggcctcctgcagc 361

                                                                       
Query: 293 gcggagacggcggaggactggaagcggaggtcggtcttgaagtcctgcgcgatctcccgg 352
           |||| ||||||||||  |||||||||||||||||||||||||||||||||||||||||| 
Sbjct: 360 gcggcgacggcggagctctggaagcggaggtcggtcttgaagtcctgcgcgatctcccgc 301

                                                                       
Query: 353 acgaggcgctgaaaggggagcttgcggatgagcagctccgtgctcttctggtacttgcgg 412
           || || ||||| || || ||||||||||||||||||||||||||||||||||||||||||
Sbjct: 300 accagccgctggaacggcagcttgcggatgagcagctccgtgctcttctggtacttgcgg 241

                 
Query: 413 atctcc 418
           ||||||
Sbjct: 240 atctcc 235



to top

>ref|NM_185613.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 411

 Score =  391 bits (197), Expect = e-105
 Identities = 242/257 (94%)
 Strand = Plus / Minus

                                                                       
Query: 161 gcgcgctccccgcggatgcggcgggcgagctggatgtccttgggcatgattgtgacgcgc 220
           |||||||| |||||||| ||||| |||||||||||||||||||||||||| |||||||||
Sbjct: 407 gcgcgctcgccgcggatccggcgcgcgagctggatgtccttgggcatgatggtgacgcgc 348

                                                                       
Query: 221 ttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtacgcctcggcg 280
           ||||||||||||||||| ||||||||||||||||| |||||||||||||||||||| |||
Sbjct: 347 ttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacgaggtacgcctccgcg 288

                                                                       
Query: 281 gcctcctggagcgcggagacggcggaggactggaagcggaggtcggtcttgaagtcctgc 340
           |||||||| || |||| ||||||||||  |||||||||||||||||||||||||||||| 
Sbjct: 287 gcctcctgcagggcggcgacggcggagctctggaagcggaggtcggtcttgaagtcctgg 228

                                                                       
Query: 341 gcgatctcccggacgaggcgctgaaaggggagcttgcggatgagcagctccgtgctcttc 400
           |||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||||
Sbjct: 227 gcgatctcgcggacgaggcgctggaaggggagcttgcggatgagcagctccgtgctcttc 168

                            
Query: 401 tggtacttgcggatctc 417
           |||||||||||||||||
Sbjct: 167 tggtacttgcggatctc 151



to top

>gb|M35388.1|MZEHISH3A Zea mays histone H3 gene, complete cds
          Length = 411

 Score =  389 bits (196), Expect = e-105
 Identities = 232/244 (95%)
 Strand = Plus / Minus

                                                                       
Query: 175 gatgcggcgggcgagctggatgtccttgggcatgattgtgacgcgcttggcgtggatggc 234
           ||||||||| |||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct: 393 gatgcggcgcgcgagctggatgtccttgggcatgatggtgacgcgcttggcgtggatggc 334

                                                                       
Query: 235 gcagaggttggtgtcctcgaagagcccgacgaggtacgcctcggcggcctcctggagcgc 294
           ||||||||||||||||||||||||||| |||||||| ||||||||||||||||| |||||
Sbjct: 333 gcagaggttggtgtcctcgaagagccccacgaggtaggcctcggcggcctcctgcagcgc 274

                                                                       
Query: 295 ggagacggcggaggactggaagcggaggtcggtcttgaagtcctgcgcgatctcccggac 354
           || ||| |||||||||||||||||||||||||||||||| |||||||||||||| |||||
Sbjct: 273 ggcgacagcggaggactggaagcggaggtcggtcttgaaatcctgcgcgatctcacggac 214

                                                                       
Query: 355 gaggcgctgaaaggggagcttgcggatgagcagctccgtgctcttctggtacttgcggat 414
           ||||||||| ||||| ||||||||||||||||||||||||||||||||||||||||| ||
Sbjct: 213 gaggcgctggaagggcagcttgcggatgagcagctccgtgctcttctggtacttgcgaat 154

               
Query: 415 ctcc 418
           ||||
Sbjct: 153 ctcc 150



to top

>gb|M13378.1|MZEH3C2 Maize (Zea mays) histone H3 gene (H3C2), complete cds
          Length = 1001

 Score =  389 bits (196), Expect = e-105
 Identities = 232/244 (95%)
 Strand = Plus / Minus

                                                                       
Query: 175 gatgcggcgggcgagctggatgtccttgggcatgattgtgacgcgcttggcgtggatggc 234
           ||||||||| |||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct: 814 gatgcggcgcgcgagctggatgtccttgggcatgatggtgacgcgcttggcgtggatggc 755

                                                                       
Query: 235 gcagaggttggtgtcctcgaagagcccgacgaggtacgcctcggcggcctcctggagcgc 294
           ||||||||||||||||||||||||||| |||||||| ||||||||||||||||| |||||
Sbjct: 754 gcagaggttggtgtcctcgaagagccccacgaggtaggcctcggcggcctcctgcagcgc 695

                                                                       
Query: 295 ggagacggcggaggactggaagcggaggtcggtcttgaagtcctgcgcgatctcccggac 354
           || ||| |||||||||||||||||||||||||||||||| |||||||||||||| |||||
Sbjct: 694 ggcgacagcggaggactggaagcggaggtcggtcttgaaatcctgcgcgatctcacggac 635

                                                                       
Query: 355 gaggcgctgaaaggggagcttgcggatgagcagctccgtgctcttctggtacttgcggat 414
           ||||||||| ||||| ||||||||||||||||||||||||||||||||||||||||| ||
Sbjct: 634 gaggcgctggaagggcagcttgcggatgagcagctccgtgctcttctggtacttgcgaat 575

               
Query: 415 ctcc 418
           ||||
Sbjct: 574 ctcc 571



to top

>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete
                sequence
          Length = 43261740

 Score =  379 bits (191), Expect = e-102
 Identities = 245/263 (93%)
 Strand = Plus / Minus

                                                                            
Query: 156      cctaggcgcgctccccgcggatgcggcgggcgagctggatgtccttgggcatgattgtga 215
                ||||||| | ||| || |||||||||||||||||||||||||||||||||||||| ||||
Sbjct: 37507567 cctaggccctctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtga 37507508

                                                                            
Query: 216      cgcgcttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtacgcct 275
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||
Sbjct: 37507507 cgcgcttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtaggcct 37507448

                                                                            
Query: 276      cggcggcctcctggagcgcggagacggcggaggactggaagcggaggtcggtcttgaagt 335
                |||| |||||||| ||||||| ||||||||||  ||||||||||||||||||||||||||
Sbjct: 37507447 cggccgcctcctgcagcgcggcgacggcggagctctggaagcggaggtcggtcttgaagt 37507388

                                                                            
Query: 336      cctgcgcgatctcccggacgaggcgctgaaaggggagcttgcggatgagcagctccgtgc 395
                |||||||||||||||| || |||||||| || || ||||||||||| |||||||| ||||
Sbjct: 37507387 cctgcgcgatctcccgcaccaggcgctggaacggcagcttgcggatcagcagctcggtgc 37507328

                                       
Query: 396      tcttctggtacttgcggatctcc 418
                |||||||||||||||||||||||
Sbjct: 37507327 tcttctggtacttgcggatctcc 37507305



 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                    
Query: 171     cgcggatgcggcgggcgagct 191
               |||||||||||||||||||||
Sbjct: 9911750 cgcggatgcggcgggcgagct 9911730



to top

>dbj|AP003270.4| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC
              clone:P0505D12
          Length = 146951

 Score =  379 bits (191), Expect = e-102
 Identities = 245/263 (93%)
 Strand = Plus / Minus

                                                                          
Query: 156    cctaggcgcgctccccgcggatgcggcgggcgagctggatgtccttgggcatgattgtga 215
              ||||||| | ||| || |||||||||||||||||||||||||||||||||||||| ||||
Sbjct: 102104 cctaggccctctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtga 102045

                                                                          
Query: 216    cgcgcttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtacgcct 275
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||
Sbjct: 102044 cgcgcttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtaggcct 101985

                                                                          
Query: 276    cggcggcctcctggagcgcggagacggcggaggactggaagcggaggtcggtcttgaagt 335
              |||| |||||||| ||||||| ||||||||||  ||||||||||||||||||||||||||
Sbjct: 101984 cggccgcctcctgcagcgcggcgacggcggagctctggaagcggaggtcggtcttgaagt 101925

                                                                          
Query: 336    cctgcgcgatctcccggacgaggcgctgaaaggggagcttgcggatgagcagctccgtgc 395
              |||||||||||||||| || |||||||| || || ||||||||||| |||||||| ||||
Sbjct: 101924 cctgcgcgatctcccgcaccaggcgctggaacggcagcttgcggatcagcagctcggtgc 101865

                                     
Query: 396    tcttctggtacttgcggatctcc 418
              |||||||||||||||||||||||
Sbjct: 101864 tcttctggtacttgcggatctcc 101842



to top

>dbj|AK108078.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-138-E03, full
           insert sequence
          Length = 1296

 Score =  379 bits (191), Expect = e-102
 Identities = 245/263 (93%)
 Strand = Plus / Minus

                                                                       
Query: 156 cctaggcgcgctccccgcggatgcggcgggcgagctggatgtccttgggcatgattgtga 215
           ||||||| | ||| || |||||||||||||||||||||||||||||||||||||| ||||
Sbjct: 490 cctaggccctctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtga 431

                                                                       
Query: 216 cgcgcttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtacgcct 275
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||
Sbjct: 430 cgcgcttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtaggcct 371

                                                                       
Query: 276 cggcggcctcctggagcgcggagacggcggaggactggaagcggaggtcggtcttgaagt 335
           |||| |||||||| ||||||| ||||||||||  ||||||||||||||||||||||||||
Sbjct: 370 cggccgcctcctgcagcgcggcgacggcggagctctggaagcggaggtcggtcttgaagt 311

                                                                       
Query: 336 cctgcgcgatctcccggacgaggcgctgaaaggggagcttgcggatgagcagctccgtgc 395
           |||||||||||||||| || |||||||| || || ||||||||||| |||||||| ||||
Sbjct: 310 cctgcgcgatctcccgcaccaggcgctggaacggcagcttgcggatcagcagctcggtgc 251

                                  
Query: 396 tcttctggtacttgcggatctcc 418
           |||||||||||||||||||||||
Sbjct: 250 tcttctggtacttgcggatctcc 228



to top

>ref|NM_190750.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 411

 Score =  377 bits (190), Expect = e-101
 Identities = 232/246 (94%)
 Strand = Plus / Minus

                                                                       
Query: 173 cggatgcggcgggcgagctggatgtccttgggcatgattgtgacgcgcttggcgtggatg 232
           |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||
Sbjct: 395 cggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtggatg 336

                                                                       
Query: 233 gcgcagaggttggtgtcctcgaagagcccgacgaggtacgcctcggcggcctcctggagc 292
           |||||||||||||||||||||||||||||||||||||| |||||||| |||||||| |||
Sbjct: 335 gcgcagaggttggtgtcctcgaagagcccgacgaggtaggcctcggccgcctcctgcagc 276

                                                                       
Query: 293 gcggagacggcggaggactggaagcggaggtcggtcttgaagtcctgcgcgatctcccgg 352
           |||| ||||||||||  |||||||||||||||||||||||||||||||||||||||||| 
Sbjct: 275 gcggcgacggcggagctctggaagcggaggtcggtcttgaagtcctgcgcgatctcccgc 216

                                                                       
Query: 353 acgaggcgctgaaaggggagcttgcggatgagcagctccgtgctcttctggtacttgcgg 412
           || |||||||| || || ||||||||||| |||||||| |||||||||||||||||||||
Sbjct: 215 accaggcgctggaacggcagcttgcggatcagcagctcggtgctcttctggtacttgcgg 156

                 
Query: 413 atctcc 418
           ||||||
Sbjct: 155 atctcc 150



to top

>ref|XM_493701.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 411

 Score =  375 bits (189), Expect = e-101
 Identities = 240/257 (93%)
 Strand = Plus / Minus

                                                                       
Query: 161 gcgcgctccccgcggatgcggcgggcgagctggatgtccttgggcatgattgtgacgcgc 220
           |||||||| ||||||||||||||||||||||||||||||||||||||||| |||||||||
Sbjct: 407 gcgcgctcgccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 348

                                                                       
Query: 221 ttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtacgcctcggcg 280
           |||||||||||||||||||||||||||||||||||||| ||||||||||| |||||||||
Sbjct: 347 ttggcgtggatggcgcagaggttggtgtcctcgaagagaccgacgaggtaggcctcggcg 288

                                                                       
Query: 281 gcctcctggagcgcggagacggcggaggactggaagcggaggtcggtcttgaagtcctgc 340
           ||||||||||| |||   || |||  |  |||||||||||||||||||||||||||||||
Sbjct: 287 gcctcctggagggcgagcaccgcgtggctctggaagcggaggtcggtcttgaagtcctgc 228

                                                                       
Query: 341 gcgatctcccggacgaggcgctgaaaggggagcttgcggatgagcagctccgtgctcttc 400
           |||||||| |||||||||||||| ||||||||||||||||| || |||||||||||||||
Sbjct: 227 gcgatctcgcggacgaggcgctggaaggggagcttgcggatcaggagctccgtgctcttc 168

                            
Query: 401 tggtacttgcggatctc 417
           |||||||||||||||||
Sbjct: 167 tggtacttgcggatctc 151



to top

>dbj|AP000559.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6,
             clone:P0493C11
          Length = 143113

 Score =  375 bits (189), Expect = e-101
 Identities = 240/257 (93%)
 Strand = Plus / Plus

                                                                         
Query: 161   gcgcgctccccgcggatgcggcgggcgagctggatgtccttgggcatgattgtgacgcgc 220
             |||||||| ||||||||||||||||||||||||||||||||||||||||| |||||||||
Sbjct: 47871 gcgcgctcgccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 47930

                                                                         
Query: 221   ttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtacgcctcggcg 280
             |||||||||||||||||||||||||||||||||||||| ||||||||||| |||||||||
Sbjct: 47931 ttggcgtggatggcgcagaggttggtgtcctcgaagagaccgacgaggtaggcctcggcg 47990

                                                                         
Query: 281   gcctcctggagcgcggagacggcggaggactggaagcggaggtcggtcttgaagtcctgc 340
             ||||||||||| |||   || |||  |  |||||||||||||||||||||||||||||||
Sbjct: 47991 gcctcctggagggcgagcaccgcgtggctctggaagcggaggtcggtcttgaagtcctgc 48050

                                                                         
Query: 341   gcgatctcccggacgaggcgctgaaaggggagcttgcggatgagcagctccgtgctcttc 400
             |||||||| |||||||||||||| ||||||||||||||||| || |||||||||||||||
Sbjct: 48051 gcgatctcgcggacgaggcgctggaaggggagcttgcggatcaggagctccgtgctcttc 48110

                              
Query: 401   tggtacttgcggatctc 417
             |||||||||||||||||
Sbjct: 48111 tggtacttgcggatctc 48127



to top

>gb|AF093633.1|AF093633 Oryza sativa histone H3 mRNA, complete cds
          Length = 793

 Score =  375 bits (189), Expect = e-101
 Identities = 240/257 (93%)
 Strand = Plus / Minus

                                                                       
Query: 161 gcgcgctccccgcggatgcggcgggcgagctggatgtccttgggcatgattgtgacgcgc 220
           |||||||| ||||||||||||||||||||||||||||||||||||||||| |||||||||
Sbjct: 495 gcgcgctcgccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 436

                                                                       
Query: 221 ttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtacgcctcggcg 280
           |||||||||||||||||||||||||||||||||||||| ||||||||||| |||||||||
Sbjct: 435 ttggcgtggatggcgcagaggttggtgtcctcgaagagaccgacgaggtaggcctcggcg 376

                                                                       
Query: 281 gcctcctggagcgcggagacggcggaggactggaagcggaggtcggtcttgaagtcctgc 340
           ||||||||||| |||   || |||  |  |||||||||||||||||||||||||||||||
Sbjct: 375 gcctcctggagggcgagcaccgcgtggctctggaagcggaggtcggtcttgaagtcctgc 316

                                                                       
Query: 341 gcgatctcccggacgaggcgctgaaaggggagcttgcggatgagcagctccgtgctcttc 400
           |||||||| |||||||||||||| ||||||||||||||||| || |||||||||||||||
Sbjct: 315 gcgatctcgcggacgaggcgctggaaggggagcttgcggatcaggagctccgtgctcttc 256

                            
Query: 401 tggtacttgcggatctc 417
           |||||||||||||||||
Sbjct: 255 tggtacttgcggatctc 239



to top

>dbj|AB205017.1| Lolium multiflorum gene for replacement histone H3, exon 1-2,
           complete cds
          Length = 784

 Score =  369 bits (186), Expect = 5e-99
 Identities = 243/262 (92%)
 Strand = Plus / Minus

                                                                       
Query: 156 cctaggcgcgctccccgcggatgcggcgggcgagctggatgtccttgggcatgattgtga 215
           ||||||||||||| ||||||||||||||||||||||||||||||||||||||||| ||||
Sbjct: 576 cctaggcgcgctcaccgcggatgcggcgggcgagctggatgtccttgggcatgatggtga 517

                                                                       
Query: 216 cgcgcttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtacgcct 275
           ||||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||
Sbjct: 516 cgcgcttggcgtggatggcgcagaggttggtgtcctcgaagaggccgacgaggtaggcct 457

                                                                       
Query: 276 cggcggcctcctggagcgcggagacggcggaggactggaagcggaggtcggtcttgaagt 335
           |||| ||||||||||||||    ||||||  |  |||||| || ||||| ||||||||||
Sbjct: 456 cggccgcctcctggagcgccagcacggcgtggctctggaaccgcaggtccgtcttgaagt 397

                                                                       
Query: 336 cctgcgcgatctcccggacgaggcgctgaaaggggagcttgcggatgagcagctccgtgc 395
           ||||||||||||| ||||| |||||||| |||||||||||||||||||||||||||||||
Sbjct: 396 cctgcgcgatctcgcggaccaggcgctggaaggggagcttgcggatgagcagctccgtgc 337

                                 
Query: 396 tcttctggtacttgcggatctc 417
           ||||||||||||||||||||||
Sbjct: 336 tcttctggtacttgcggatctc 315



to top

>ref|XM_472456.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 411

 Score =  365 bits (184), Expect = 8e-98
 Identities = 229/244 (93%)
 Strand = Plus / Minus

                                                                       
Query: 175 gatgcggcgggcgagctggatgtccttgggcatgattgtgacgcgcttggcgtggatggc 234
           |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct: 393 gatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtggatggc 334

                                                                       
Query: 235 gcagaggttggtgtcctcgaagagcccgacgaggtacgcctcggcggcctcctggagcgc 294
           |||||||||||||||||||||||| ||||||||||| ||||||||||||||||| |||||
Sbjct: 333 gcagaggttggtgtcctcgaagaggccgacgaggtaggcctcggcggcctcctgcagcgc 274

                                                                       
Query: 295 ggagacggcggaggactggaagcggaggtcggtcttgaagtcctgcgcgatctcccggac 354
           || ||||||||| |||||||| |||||||| |||||||||||||||||||||||||| ||
Sbjct: 273 ggcgacggcggacgactggaaccggaggtccgtcttgaagtcctgcgcgatctcccgcac 214

                                                                       
Query: 355 gaggcgctgaaaggggagcttgcggatgagcagctccgtgctcttctggtacttgcggat 414
            || ||||| || |||||||| ||||| ||||||||||||||||||||||||||||||||
Sbjct: 213 cagccgctggaacgggagcttccggatcagcagctccgtgctcttctggtacttgcggat 154

               
Query: 415 ctcc 418
           ||||
Sbjct: 153 ctcc 150



to top

>emb|X79714.1|LTMRHIS3 L.temulentum mRNA for histone H3
          Length = 657

 Score =  365 bits (184), Expect = 8e-98
 Identities = 241/260 (92%)
 Strand = Plus / Minus

                                                                       
Query: 158 taggcgcgctccccgcggatgcggcgggcgagctggatgtccttgggcatgattgtgacg 217
           ||||||||||| ||||||||||||||||||||||||||||||||||||||||| ||||||
Sbjct: 461 taggcgcgctcaccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacg 402

                                                                       
Query: 218 cgcttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtacgcctcg 277
           |||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||||
Sbjct: 401 cgcttggcgtggatggcgcacaggttggtgtcctcgaagagcccgacgaggtaggcctcg 342

                                                                       
Query: 278 gcggcctcctggagcgcggagacggcggaggactggaagcggaggtcggtcttgaagtcc 337
           || ||||||||||||||    ||||||  |  |||||| || ||||| || |||||||||
Sbjct: 341 gccgcctcctggagcgccagcacggcgtggctctggaaccgcaggtccgttttgaagtcc 282

                                                                       
Query: 338 tgcgcgatctcccggacgaggcgctgaaaggggagcttgcggatgagcagctccgtgctc 397
           ||||||||||| |||||||||||||| |||||||||||||||||||||||||||||||||
Sbjct: 281 tgcgcgatctcgcggacgaggcgctggaaggggagcttgcggatgagcagctccgtgctc 222

                               
Query: 398 ttctggtacttgcggatctc 417
           ||||||||||||||||||||
Sbjct: 221 ttctggtacttgcggatctc 202



to top

>dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 4, complete
                sequence
          Length = 35498469

 Score =  365 bits (184), Expect = 8e-98
 Identities = 229/244 (93%)
 Strand = Plus / Minus

                                                                            
Query: 175      gatgcggcgggcgagctggatgtccttgggcatgattgtgacgcgcttggcgtggatggc 234
                |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct: 20749045 gatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtggatggc 20748986

                                                                            
Query: 235      gcagaggttggtgtcctcgaagagcccgacgaggtacgcctcggcggcctcctggagcgc 294
                |||||||||||||||||||||||| ||||||||||| ||||||||||||||||| |||||
Sbjct: 20748985 gcagaggttggtgtcctcgaagaggccgacgaggtaggcctcggcggcctcctgcagcgc 20748926

                                                                            
Query: 295      ggagacggcggaggactggaagcggaggtcggtcttgaagtcctgcgcgatctcccggac 354
                || ||||||||| |||||||| |||||||| |||||||||||||||||||||||||| ||
Sbjct: 20748925 ggcgacggcggacgactggaaccggaggtccgtcttgaagtcctgcgcgatctcccgcac 20748866

                                                                            
Query: 355      gaggcgctgaaaggggagcttgcggatgagcagctccgtgctcttctggtacttgcggat 414
                 || ||||| || |||||||| ||||| ||||||||||||||||||||||||||||||||
Sbjct: 20748865 cagccgctggaacgggagcttccggatcagcagctccgtgctcttctggtacttgcggat 20748806

                    
Query: 415      ctcc 418
                ||||
Sbjct: 20748805 ctcc 20748802



 Score =  113 bits (57), Expect = 5e-22
 Identities = 90/101 (89%)
 Strand = Plus / Minus

                                                                            
Query: 188      agctggatgtccttgggcatgattgtgacgcgcttggcgtggatggcgcagaggttggtg 247
                ||||| ||||||||||||||||| || || |||||||| ||||||||||| |||||||||
Sbjct: 22438361 agctgaatgtccttgggcatgatggtcacacgcttggcatggatggcgcacaggttggtg 22438302

                                                         
Query: 248      tcctcgaagagcccgacgaggtacgcctcggcggcctcctg 288
                ||||||||||| || || |||||||||||||| || |||||
Sbjct: 22438301 tcctcgaagagacccaccaggtacgcctcggcagcttcctg 22438261



 Score = 48.1 bits (24), Expect = 0.023
 Identities = 34/36 (94%), Gaps = 1/36 (2%)
 Strand = Plus / Minus

                                                    
Query: 380      atgagcagctccgtgct-cttctggtacttgcggat 414
                ||||||||||| ||||| ||||||||||||||||||
Sbjct: 22438073 atgagcagctcagtgcttcttctggtacttgcggat 22438038



 Score = 40.1 bits (20), Expect = 5.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                    
Query: 268      gtacgcctcggcggcctcct 287
                ||||||||||||||||||||
Sbjct: 25160884 gtacgcctcggcggcctcct 25160865



to top

>emb|AL606618.4|OSJN00062 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBb0108J11,
             complete sequence
          Length = 124629

 Score =  365 bits (184), Expect = 8e-98
 Identities = 229/244 (93%)
 Strand = Plus / Minus

                                                                         
Query: 175   gatgcggcgggcgagctggatgtccttgggcatgattgtgacgcgcttggcgtggatggc 234
             |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct: 95196 gatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtggatggc 95137

                                                                         
Query: 235   gcagaggttggtgtcctcgaagagcccgacgaggtacgcctcggcggcctcctggagcgc 294
             |||||||||||||||||||||||| ||||||||||| ||||||||||||||||| |||||
Sbjct: 95136 gcagaggttggtgtcctcgaagaggccgacgaggtaggcctcggcggcctcctgcagcgc 95077

                                                                         
Query: 295   ggagacggcggaggactggaagcggaggtcggtcttgaagtcctgcgcgatctcccggac 354
             || ||||||||| |||||||| |||||||| |||||||||||||||||||||||||| ||
Sbjct: 95076 ggcgacggcggacgactggaaccggaggtccgtcttgaagtcctgcgcgatctcccgcac 95017

                                                                         
Query: 355   gaggcgctgaaaggggagcttgcggatgagcagctccgtgctcttctggtacttgcggat 414
              || ||||| || |||||||| ||||| ||||||||||||||||||||||||||||||||
Sbjct: 95016 cagccgctggaacgggagcttccggatcagcagctccgtgctcttctggtacttgcggat 94957

                 
Query: 415   ctcc 418
             ||||
Sbjct: 94956 ctcc 94953



to top

>gb|BT018930.1| Zea mays clone Contig60.F mRNA sequence
          Length = 887

 Score =  353 bits (178), Expect = 3e-94
 Identities = 229/246 (93%)
 Strand = Plus / Plus

                                                                       
Query: 173 cggatgcggcgggcgagctggatgtccttgggcatgattgtgacgcgcttggcgtggatg 232
           |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||
Sbjct: 238 cggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtggatg 297

                                                                       
Query: 233 gcgcagaggttggtgtcctcgaagagcccgacgaggtacgcctcggcggcctcctggagc 292
           |||||||||||||||||||||||||| || |||||||| ||||||||||||||||| |||
Sbjct: 298 gcgcagaggttggtgtcctcgaagaggcccacgaggtaggcctcggcggcctcctgcagc 357

                                                                       
Query: 293 gcggagacggcggaggactggaagcggaggtcggtcttgaagtcctgcgcgatctcccgg 352
           ||||  ||||||||||||||||| |||||||| |||||||||||||||||||||||||| 
Sbjct: 358 gcggccacggcggaggactggaaccggaggtccgtcttgaagtcctgcgcgatctcccgc 417

                                                                       
Query: 353 acgaggcgctgaaaggggagcttgcggatgagcagctccgtgctcttctggtacttgcgg 412
           || || ||||| || || ||||| ||||| ||||||||||||||||||||||||||||||
Sbjct: 418 accagccgctggaacggcagcttccggatcagcagctccgtgctcttctggtacttgcgg 477

                 
Query: 413 atctcc 418
           ||||||
Sbjct: 478 atctcc 483



to top

>emb|X84377.1|ZMHIS3DNA Z.mays histone H3 gene
          Length = 1119

 Score =  353 bits (178), Expect = 3e-94
 Identities = 229/246 (93%)
 Strand = Plus / Minus

                                                                       
Query: 173 cggatgcggcgggcgagctggatgtccttgggcatgattgtgacgcgcttggcgtggatg 232
           |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||
Sbjct: 779 cggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggcgtggatg 720

                                                                       
Query: 233 gcgcagaggttggtgtcctcgaagagcccgacgaggtacgcctcggcggcctcctggagc 292
           |||||||||||||||||||||||||| || |||||||| ||||||||||||||||| |||
Sbjct: 719 gcgcagaggttggtgtcctcgaagaggcccacgaggtaggcctcggcggcctcctgcagc 660

                                                                       
Query: 293 gcggagacggcggaggactggaagcggaggtcggtcttgaagtcctgcgcgatctcccgg 352
           ||||  ||||||||||||||||| |||||||| |||||||||||||||||||||||||| 
Sbjct: 659 gcggccacggcggaggactggaaccggaggtccgtcttgaagtcctgcgcgatctcccgc 600

                                                                       
Query: 353 acgaggcgctgaaaggggagcttgcggatgagcagctccgtgctcttctggtacttgcgg 412
           || || ||||| || || ||||| ||||| ||||||||||||||||||||||||||||||
Sbjct: 599 accagccgctggaacggcagcttccggatcagcagctccgtgctcttctggtacttgcgg 540

                 
Query: 413 atctcc 418
           ||||||
Sbjct: 539 atctcc 534



to top

>gb|M13379.1|MZEH3C4 Maize (Zea mays) histone H3 gene (H3C4), complete cds
          Length = 1264

 Score =  341 bits (172), Expect = 1e-90
 Identities = 226/244 (92%)
 Strand = Plus / Minus

                                                                       
Query: 175 gatgcggcgggcgagctggatgtccttgggcatgattgtgacgcgcttggcgtggatggc 234
           ||||||||| |||||||| ||||||||||||||||| |||||||||||||||||||||||
Sbjct: 918 gatgcggcgcgcgagctgaatgtccttgggcatgatggtgacgcgcttggcgtggatggc 859

                                                                       
Query: 235 gcagaggttggtgtcctcgaagagcccgacgaggtacgcctcggcggcctcctggagcgc 294
           ||||||||| |||||||| |||||||| || ||||| ||||||||||||||||| |||||
Sbjct: 858 gcagaggttagtgtcctcaaagagccccacaaggtaggcctcggcggcctcctgcagcgc 799

                                                                       
Query: 295 ggagacggcggaggactggaagcggaggtcggtcttgaagtcctgcgcgatctcccggac 354
            | |||||||||||||||||||||||| |||||||||||||||||||||||||| |||||
Sbjct: 798 agcgacggcggaggactggaagcggagatcggtcttgaagtcctgcgcgatctcacggac 739

                                                                       
Query: 355 gaggcgctgaaaggggagcttgcggatgagcagctccgtgctcttctggtacttgcggat 414
           ||||||||| ||||| | |||||||||||||||||||||||||||||||||||| || ||
Sbjct: 738 gaggcgctggaagggcaacttgcggatgagcagctccgtgctcttctggtacttacgaat 679

               
Query: 415 ctcc 418
           ||||
Sbjct: 678 ctcc 675



to top

>gb|BT018950.1| Zea mays clone Contig110.F mRNA sequence
          Length = 636

 Score =  335 bits (169), Expect = 7e-89
 Identities = 235/257 (91%)
 Strand = Plus / Plus

                                                                       
Query: 161 gcgcgctccccgcggatgcggcgggcgagctggatgtccttgggcatgattgtgacgcgc 220
           |||||||| || |||||||||||||||||||||||||||||||||||||| |||||||||
Sbjct: 137 gcgcgctcgccacggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgc 196

                                                                       
Query: 221 ttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtacgcctcggcg 280
           || ||||||||||||||||||||||||||||||||||| ||||||||||| |||||||||
Sbjct: 197 ttagcgtggatggcgcagaggttggtgtcctcgaagagaccgacgaggtaggcctcggcg 256

                                                                       
Query: 281 gcctcctggagcgcggagacggcggaggactggaagcggaggtcggtcttgaagtcctgc 340
           ||||||||||||||    ||||||  |  |||||| |||||||| |||||||||||||||
Sbjct: 257 gcctcctggagcgccagcacggcgtggctctggaatcggaggtctgtcttgaagtcctgc 316

                                                                       
Query: 341 gcgatctcccggacgaggcgctgaaaggggagcttgcggatgagcagctccgtgctcttc 400
           |||||||| || || |||||||| ||||| ||||||||||| ||||||||||||||||||
Sbjct: 317 gcgatctcgcgcaccaggcgctggaagggcagcttgcggatcagcagctccgtgctcttc 376

                            
Query: 401 tggtacttgcggatctc 417
           |||||||||||||||||
Sbjct: 377 tggtacttgcggatctc 393



to top

>gb|BT018179.1| Zea mays clone EL01N0557G06.c mRNA sequence
          Length = 716

 Score =  333 bits (168), Expect = 3e-88
 Identities = 225/244 (92%)
 Strand = Plus / Minus

                                                                       
Query: 175 gatgcggcgggcgagctggatgtccttgggcatgattgtgacgcgcttggcgtggatggc 234
           ||||||||| |||||||||||||||||||||||||| |||||||||||||||||||||||
Sbjct: 453 gatgcggcgcgcgagctggatgtccttgggcatgatggtgacgcgcttggcgtggatggc 394

                                                                       
Query: 235 gcagaggttggtgtcctcgaagagcccgacgaggtacgcctcggcggcctcctggagcgc 294
           ||| ||| | |||||||| |||||||| |||||||| ||||||||||||||||| |||||
Sbjct: 393 gcacagggtagtgtcctcaaagagccccacgaggtaggcctcggcggcctcctgcagcgc 334

                                                                       
Query: 295 ggagacggcggaggactggaagcggaggtcggtcttgaagtcctgcgcgatctcccggac 354
            |||||||||||||||||||||||||| |||||||||||| ||||||||||||| |||||
Sbjct: 333 agagacggcggaggactggaagcggagatcggtcttgaagccctgcgcgatctcacggac 274

                                                                       
Query: 355 gaggcgctgaaaggggagcttgcggatgagcagctccgtgctcttctggtacttgcggat 414
           ||||||||| ||||| | ||||||||||||||||||||||||||||||| |||| || ||
Sbjct: 273 gaggcgctggaagggcaacttgcggatgagcagctccgtgctcttctgggacttacgaat 214

               
Query: 415 ctcc 418
           ||||
Sbjct: 213 ctcc 210



to top

>emb|Y08528.1|OSHISTON3 Oryza sativa mRNA for histone 3
          Length = 529

 Score =  333 bits (168), Expect = 3e-88
 Identities = 234/258 (90%)
 Strand = Plus / Minus

                                                                       
Query: 161 gcgcgctccccgcggatgcggcgggcgagctggatgtccttgggcatgattgtgacgcgc 220
           |||||||| ||||||||||||||||||||||||||||||||||||||||| | |||||||
Sbjct: 479 gcgcgctcaccgcggatgcggcgggcgagctggatgtccttgggcatgatggagacgcgc 420

                                                                       
Query: 221 ttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtacgcctcggcg 280
           |||||||||||||||||||||||||| || |||||||||| |||||||||  | ||||||
Sbjct: 419 ttggcgtggatggcgcagaggttggtntcntcgaagagccngacgaggtagccttcggcg 360

                                                                       
Query: 281 gcctcctggagcgcggagacggcggaggactggaagcggaggtcggtcttgaagtcctgc 340
           || || |||||||||| ||||||||||  |||||| |||||||| || | |||||| |||
Sbjct: 359 gcttcttggagcgcggcgacggcggagctctggaaccggaggtccgtntagaagtcatgc 300

                                                                       
Query: 341 gcgatctcccggacgaggcgctgaaaggggagcttgcggatgagcagctccgtgctcttc 400
           ||||||||||||||||| ||||| ||||||||||||||||| |||||||||||| |||||
Sbjct: 299 gcgatctcccggacgagccgctggaaggggagcttgcggatcagcagctccgtgntcttc 240

                             
Query: 401 tggtacttgcggatctcc 418
           ||| ||||||||||||||
Sbjct: 239 tggnacttgcggatctcc 222



to top

>gb|M34928.1|BLYHISH3PA Barley histone H3 mRNA, 3' end
          Length = 505

 Score =  329 bits (166), Expect = 4e-87
 Identities = 223/242 (92%)
 Strand = Plus / Minus

                                                                       
Query: 158 taggcgcgctccccgcggatgcggcgggcgagctggatgtccttgggcatgattgtgacg 217
           ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||
Sbjct: 242 taggcgcgctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacg 183

                                                                       
Query: 218 cgcttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtacgcctcg 277
           |||||||||||||||||||| ||||||||||||||||| |||||||||||||||||||||
Sbjct: 182 cgcttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacgaggtacgcctcg 123

                                                                       
Query: 278 gcggcctcctggagcgcggagacggcggaggactggaagcggaggtcggtcttgaagtcc 337
           |||||||||||||| ||    ||||||  ||||||||| | |||||||||||||||||||
Sbjct: 122 gcggcctcctggagggccagcacggcgtgggactggaacctgaggtcggtcttgaagtcc 63

                                                                       
Query: 338 tgcgcgatctcccggacgaggcgctgaaaggggagcttgcggatgagcagctccgtgctc 397
           |||||||||||||  || |||||||| || |||||||||||||| |||||||| ||||||
Sbjct: 62  tgcgcgatctccctcaccaggcgctggaacgggagcttgcggatcagcagctcggtgctc 3

             
Query: 398 tt 399
           ||
Sbjct: 2   tt 1



to top

>gb|BT016934.1| Zea mays clone E04912703G10.c mRNA sequence
          Length = 663

 Score =  323 bits (163), Expect = 3e-85
 Identities = 223/243 (91%)
 Strand = Plus / Plus

                                                                       
Query: 175 gatgcggcgggcgagctggatgtccttgggcatgattgtgacgcgcttggcgtggatggc 234
           |||||||||||||||||||||||||||||||||||| ||||| | |||||||||||||||
Sbjct: 168 gatgcggcgggcgagctggatgtccttgggcatgatggtgaccctcttggcgtggatggc 227

                                                                       
Query: 235 gcagaggttggtgtcctcgaagagcccgacgaggtacgcctcggcggcctcctggagcgc 294
           ||||||||||||||||||||||||||| || ||||||||||| ||||||||||| |||||
Sbjct: 228 gcagaggttggtgtcctcgaagagccccaccaggtacgcctccgcggcctcctgcagcgc 287

                                                                       
Query: 295 ggagacggcggaggactggaagcggaggtcggtcttgaagtcctgcgcgatctcccggac 354
            |  || || || |||||||| || ||||| ||||||||||||||||||||||| || ||
Sbjct: 288 cgccaccgccgacgactggaaccgcaggtccgtcttgaagtcctgcgcgatctcgcgaac 347

                                                                       
Query: 355 gaggcgctgaaaggggagcttgcggatgagcagctccgtgctcttctggtacttgcggat 414
            |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 348 caggcgctggaaggggagcttgcggatgagcagctccgtgctcttctggtacttgcggat 407

              
Query: 415 ctc 417
           |||
Sbjct: 408 ctc 410



to top

>ref|XM_425464.1| PREDICTED: Gallus gallus similar to histone protein Hist2h3c1
           (LOC427890), mRNA
          Length = 600

 Score =  299 bits (151), Expect = 4e-78
 Identities = 223/247 (90%)
 Strand = Plus / Minus

                                                                       
Query: 159 aggcgcgctccccgcggatgcggcgggcgagctggatgtccttgggcatgattgtgacgc 218
           |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||
Sbjct: 598 aggcgcgctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgc 539

                                                                       
Query: 219 gcttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtacgcctcgg 278
           ||||||||||||||||||| ||||||||||||||||||||||| || ||||| |||||| 
Sbjct: 538 gcttggcgtggatggcgcacaggttggtgtcctcgaagagccccaccaggtaggcctcgc 479

                                                                       
Query: 279 cggcctcctggagcgcggagacggcggaggactggaagcggaggtcggtcttgaagtcct 338
             |||||||| |||||   |||||| |||  ||||||||| |||||||||||||||||||
Sbjct: 478 tcgcctcctgcagcgccatgacggccgagctctggaagcgcaggtcggtcttgaagtcct 419

                                                                       
Query: 339 gcgcgatctcccggacgaggcgctgaaaggggagcttgcggatgagcagctccgtgctct 398
           |||||||||| || || |||||||| ||||| ||||||||||| ||||||||||||  ||
Sbjct: 418 gcgcgatctcgcgcaccaggcgctggaagggcagcttgcggatcagcagctccgtggact 359

                  
Query: 399 tctggta 405
           |||||||
Sbjct: 358 tctggta 352



to top

>ref|XM_416198.1| PREDICTED: Gallus gallus similar to GLP_39_88222_87572 (LOC417958),
           mRNA
          Length = 1512

 Score =  299 bits (151), Expect = 4e-78
 Identities = 223/247 (90%)
 Strand = Plus / Plus

                                                                       
Query: 159 aggcgcgctccccgcggatgcggcgggcgagctggatgtccttgggcatgattgtgacgc 218
           |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||
Sbjct: 570 aggcgcgctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgc 629

                                                                       
Query: 219 gcttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtacgcctcgg 278
           ||||||||||||||||||| ||||||||||||||||||||||| || ||||| |||||| 
Sbjct: 630 gcttggcgtggatggcgcacaggttggtgtcctcgaagagccccaccaggtaggcctcgc 689

                                                                       
Query: 279 cggcctcctggagcgcggagacggcggaggactggaagcggaggtcggtcttgaagtcct 338
             |||||||| |||||   |||||| |||  ||||||||| |||||||||||||||||||
Sbjct: 690 tcgcctcctgcagcgccatgacggccgagctctggaagcgcaggtcggtcttgaagtcct 749

                                                                       
Query: 339 gcgcgatctcccggacgaggcgctgaaaggggagcttgcggatgagcagctccgtgctct 398
           |||||||||| || || |||||||| ||||| ||||||||||| ||||||||||||  ||
Sbjct: 750 gcgcgatctcgcgcaccaggcgctggaagggcagcttgcggatcagcagctccgtggact 809

                  
Query: 399 tctggta 405
           |||||||
Sbjct: 810 tctggta 816



to top

>ref|XM_416190.1| PREDICTED: Gallus gallus similar to GLP_39_88222_87572 (LOC417949),
           mRNA
          Length = 752

 Score =  299 bits (151), Expect = 4e-78
 Identities = 223/247 (90%)
 Strand = Plus / Plus

                                                                       
Query: 159 aggcgcgctccccgcggatgcggcgggcgagctggatgtccttgggcatgattgtgacgc 218
           |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||
Sbjct: 315 aggcgcgctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgc 374

                                                                       
Query: 219 gcttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtacgcctcgg 278
           ||||||||||||||||||| ||||||||||||||||||||||| || ||||| |||||| 
Sbjct: 375 gcttggcgtggatggcgcacaggttggtgtcctcgaagagccccaccaggtaggcctcgc 434

                                                                       
Query: 279 cggcctcctggagcgcggagacggcggaggactggaagcggaggtcggtcttgaagtcct 338
             |||||||| |||||   |||||| |||  ||||||||| |||||||||||||||||||
Sbjct: 435 tcgcctcctgcagcgccatgacggccgagctctggaagcgcaggtcggtcttgaagtcct 494

                                                                       
Query: 339 gcgcgatctcccggacgaggcgctgaaaggggagcttgcggatgagcagctccgtgctct 398
           |||||||||| || || |||||||| ||||| ||||||||||| ||||||||||||  ||
Sbjct: 495 gcgcgatctcgcgcaccaggcgctggaagggcagcttgcggatcagcagctccgtggact 554

                  
Query: 399 tctggta 405
           |||||||
Sbjct: 555 tctggta 561



to top

>gb|U37579.1|GGU37579 Gallus gallus histone H3-VIII gene, complete cds
          Length = 1809

 Score =  299 bits (151), Expect = 4e-78
 Identities = 223/247 (90%)
 Strand = Plus / Minus

                                                                       
Query: 159 aggcgcgctccccgcggatgcggcgggcgagctggatgtccttgggcatgattgtgacgc 218
           |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||
Sbjct: 880 aggcgcgctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgc 821

                                                                       
Query: 219 gcttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtacgcctcgg 278
           ||||||||||||||||||| ||||||||||||||||||||||| || ||||| |||||| 
Sbjct: 820 gcttggcgtggatggcgcacaggttggtgtcctcgaagagccccaccaggtaggcctcgc 761

                                                                       
Query: 279 cggcctcctggagcgcggagacggcggaggactggaagcggaggtcggtcttgaagtcct 338
             |||||||| |||||   |||||| |||  ||||||||| |||||||||||||||||||
Sbjct: 760 tcgcctcctgcagcgccatgacggccgagctctggaagcgcaggtcggtcttgaagtcct 701

                                                                       
Query: 339 gcgcgatctcccggacgaggcgctgaaaggggagcttgcggatgagcagctccgtgctct 398
           |||||||||| || || |||||||| ||||| ||||||||||| ||||||||||||  ||
Sbjct: 700 gcgcgatctcgcgcaccaggcgctggaagggcagcttgcggatcagcagctccgtggact 641

                  
Query: 399 tctggta 405
           |||||||
Sbjct: 640 tctggta 634



to top

>gb|U37577.1|GGU37577 Gallus gallus histone H3-VI gene, complete cds
          Length = 1271

 Score =  299 bits (151), Expect = 4e-78
 Identities = 223/247 (90%)
 Strand = Plus / Minus

                                                                       
Query: 159 aggcgcgctccccgcggatgcggcgggcgagctggatgtccttgggcatgattgtgacgc 218
           |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||
Sbjct: 693 aggcgcgctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgc 634

                                                                       
Query: 219 gcttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtacgcctcgg 278
           ||||||||||||||||||| ||||||||||||||||||||||| || ||||| |||||| 
Sbjct: 633 gcttggcgtggatggcgcacaggttggtgtcctcgaagagccccaccaggtaggcctcgc 574

                                                                       
Query: 279 cggcctcctggagcgcggagacggcggaggactggaagcggaggtcggtcttgaagtcct 338
             |||||||| |||||   |||||| |||  ||||||||| |||||||||||||||||||
Sbjct: 573 tcgcctcctgcagcgccatgacggccgagctctggaagcgcaggtcggtcttgaagtcct 514

                                                                       
Query: 339 gcgcgatctcccggacgaggcgctgaaaggggagcttgcggatgagcagctccgtgctct 398
           |||||||||| || || |||||||| ||||| ||||||||||| ||||||||||||  ||
Sbjct: 513 gcgcgatctcgcgcaccaggcgctggaagggcagcttgcggatcagcagctccgtggact 454

                  
Query: 399 tctggta 405
           |||||||
Sbjct: 453 tctggta 447



to top

>gb|BT017332.1| Zea mays clone EL01N0320H03.c mRNA sequence
          Length = 639

 Score =  297 bits (150), Expect = 1e-77
 Identities = 234/262 (89%)
 Strand = Plus / Minus

                                                                       
Query: 156 cctaggcgcgctccccgcggatgcggcgggcgagctggatgtccttgggcatgattgtga 215
           |||| |||||||| ||||||||||||||||||||||||||||| ||||||||||| ||||
Sbjct: 411 cctacgcgcgctcgccgcggatgcggcgggcgagctggatgtctttgggcatgatggtga 352

                                                                       
Query: 216 cgcgcttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtacgcct 275
           |||||||||||||||||||||||||||||||||||||||| || ||||||||||| ||||
Sbjct: 351 cgcgcttggcgtggatggcgcagaggttggtgtcctcgaacaggccgacgaggtaggcct 292

                                                                       
Query: 276 cggcggcctcctggagcgcggagacggcggaggactggaagcggaggtcggtcttgaagt 335
           ||||||| |||||||| ||   |||||||  |  |||||| || || || ||||||||||
Sbjct: 291 cggcggcttcctggagggccaggacggcgtggctctggaaccgcagatccgtcttgaagt 232

                                                                       
Query: 336 cctgcgcgatctcccggacgaggcgctgaaaggggagcttgcggatgagcagctccgtgc 395
           |||| |||||||| ||||| |||||||| ||||| | ||| ||||| |||||||||||||
Sbjct: 231 cctgagcgatctcacggaccaggcgctggaagggcaacttccggatcagcagctccgtgc 172

                                 
Query: 396 tcttctggtacttgcggatctc 417
           ||||||||||||||||||||||
Sbjct: 171 tcttctggtacttgcggatctc 150



to top

>emb|X02218.1|GGHIS1 Chicken duplicated genes for histone H2A, H4 and a histone H3 gene
          Length = 8384

 Score =  293 bits (148), Expect = 2e-76
 Identities = 217/240 (90%)
 Strand = Plus / Plus

                                                                        
Query: 166  ctccccgcggatgcggcgggcgagctggatgtccttgggcatgattgtgacgcgcttggc 225
            ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||
Sbjct: 3353 ctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggc 3412

                                                                        
Query: 226  gtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtacgcctcggcggcctc 285
            |||||||||||| ||||||||||||||||||||||| || ||||| ||||||   |||||
Sbjct: 3413 gtggatggcgcacaggttggtgtcctcgaagagccccaccaggtaggcctcgctcgcctc 3472

                                                                        
Query: 286  ctggagcgcggagacggcggaggactggaagcggaggtcggtcttgaagtcctgcgcgat 345
            ||| |||||   |||||| |||  ||||||||| ||||||||||||||||||||||||||
Sbjct: 3473 ctgcagcgccatgacggccgagctctggaagcgcaggtcggtcttgaagtcctgcgcgat 3532

                                                                        
Query: 346  ctcccggacgaggcgctgaaaggggagcttgcggatgagcagctccgtgctcttctggta 405
            |||||| || |||||||| ||||| ||||||||||| ||||||||||||  |||||||||
Sbjct: 3533 ctcccgcaccaggcgctggaagggcagcttgcggatcagcagctccgtggacttctggta 3592



to top

>ref|XM_416186.1| PREDICTED: Gallus gallus similar to GLP_39_88222_87572 (LOC417945),
           mRNA
          Length = 972

 Score =  291 bits (147), Expect = 9e-76
 Identities = 222/247 (89%)
 Strand = Plus / Plus

                                                                       
Query: 159 aggcgcgctccccgcggatgcggcgggcgagctggatgtccttgggcatgattgtgacgc 218
           |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||
Sbjct: 378 aggcgcgctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgc 437

                                                                       
Query: 219 gcttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtacgcctcgg 278
           ||||||||||||||||||| ||||||||||||||||||||||| || ||||| |||||| 
Sbjct: 438 gcttggcgtggatggcgcacaggttggtgtcctcgaagagccccaccaggtaggcctcgc 497

                                                                       
Query: 279 cggcctcctggagcgcggagacggcggaggactggaagcggaggtcggtcttgaagtcct 338
             |||||||| |||||   |||||| |||  ||||||||| |||||||||||||||||||
Sbjct: 498 tcgcctcctgcagcgccatgacggccgagctctggaagcgcaggtcggtcttgaagtcct 557

                                                                       
Query: 339 gcgcgatctcccggacgaggcgctgaaaggggagcttgcggatgagcagctccgtgctct 398
           |||||||||| || || |||||||| ||||| || |||||||| ||||||||||||  ||
Sbjct: 558 gcgcgatctcgcgcaccaggcgctggaagggcagtttgcggatcagcagctccgtggact 617

                  
Query: 399 tctggta 405
           |||||||
Sbjct: 618 tctggta 624



to top

>emb|CR390239.1| Gallus gallus finished cDNA, clone ChEST932d15
          Length = 578

 Score =  291 bits (147), Expect = 9e-76
 Identities = 222/247 (89%)
 Strand = Plus / Plus

                                                                       
Query: 159 aggcgcgctccccgcggatgcggcgggcgagctggatgtccttgggcatgattgtgacgc 218
           |||| ||||||||||||||||||||||||||||||||||||||||||||||| |||||||
Sbjct: 134 aggcacgctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgc 193

                                                                       
Query: 219 gcttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtacgcctcgg 278
           ||||||||||||||||||| ||||||||||||||||||||||| || ||||| |||||| 
Sbjct: 194 gcttggcgtggatggcgcacaggttggtgtcctcgaagagccccaccaggtaggcctcgc 253

                                                                       
Query: 279 cggcctcctggagcgcggagacggcggaggactggaagcggaggtcggtcttgaagtcct 338
             |||||||| |||||   |||||| |||  ||||||||| |||||||||||||||||||
Sbjct: 254 tcgcctcctgcagcgccatgacggccgagctctggaagcgcaggtcggtcttgaagtcct 313

                                                                       
Query: 339 gcgcgatctcccggacgaggcgctgaaaggggagcttgcggatgagcagctccgtgctct 398
           |||||||||| || || |||||||| ||||| ||||||||||| ||||||||||||  ||
Sbjct: 314 gcgcgatctcgcgcaccaggcgctggaagggcagcttgcggatcagcagctccgtggact 373

                  
Query: 399 tctggta 405
           |||||||
Sbjct: 374 tctggta 380



to top

>emb|X62291.1|GGHISH3IV G.gallus gene for histone H3-IV
          Length = 1094

 Score =  291 bits (147), Expect = 9e-76
 Identities = 222/247 (89%)
 Strand = Plus / Minus

                                                                       
Query: 159 aggcgcgctccccgcggatgcggcgggcgagctggatgtccttgggcatgattgtgacgc 218
           |||| ||||||||||||||||||||||||||||||||||||||||||||||| |||||||
Sbjct: 823 aggcacgctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgc 764

                                                                       
Query: 219 gcttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtacgcctcgg 278
           ||||||||||||||||||| ||||||||||||||||||||||| || ||||| |||||| 
Sbjct: 763 gcttggcgtggatggcgcacaggttggtgtcctcgaagagccccaccaggtaggcctcgc 704

                                                                       
Query: 279 cggcctcctggagcgcggagacggcggaggactggaagcggaggtcggtcttgaagtcct 338
             |||||||| |||||   |||||| |||  ||||||||| |||||||||||||||||||
Sbjct: 703 tcgcctcctgcagcgccatgacggccgagctctggaagcgcaggtcggtcttgaagtcct 644

                                                                       
Query: 339 gcgcgatctcccggacgaggcgctgaaaggggagcttgcggatgagcagctccgtgctct 398
           |||||||||| || || |||||||| ||||| ||||||||||| ||||||||||||  ||
Sbjct: 643 gcgcgatctcacgcaccaggcgctggaagggcagcttgcggatcagcagctccgtggact 584

                  
Query: 399 tctggta 405
           |||||||
Sbjct: 583 tctggta 577



to top

>emb|X62292.1|GGHISH3V G.gallus gene for histone H3-V
          Length = 1107

 Score =  291 bits (147), Expect = 9e-76
 Identities = 222/247 (89%)
 Strand = Plus / Minus

                                                                       
Query: 159 aggcgcgctccccgcggatgcggcgggcgagctggatgtccttgggcatgattgtgacgc 218
           |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||
Sbjct: 823 aggcgcgctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgc 764

                                                                       
Query: 219 gcttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtacgcctcgg 278
           ||||||| ||||||||||| ||||||||||||||||||||||| || ||||| |||||| 
Sbjct: 763 gcttggcatggatggcgcacaggttggtgtcctcgaagagccccaccaggtaggcctcgc 704

                                                                       
Query: 279 cggcctcctggagcgcggagacggcggaggactggaagcggaggtcggtcttgaagtcct 338
             |||||||| |||||   |||||| |||  ||||||||| |||||||||||||||||||
Sbjct: 703 tcgcctcctgcagcgccatgacggccgagctctggaagcgcaggtcggtcttgaagtcct 644

                                                                       
Query: 339 gcgcgatctcccggacgaggcgctgaaaggggagcttgcggatgagcagctccgtgctct 398
           |||||||||| || || |||||||| ||||| ||||||||||| ||||||||||||  ||
Sbjct: 643 gcgcgatctcgcgcaccaggcgctggaagggcagcttgcggatcagcagctccgtggact 584

                  
Query: 399 tctggta 405
           |||||||
Sbjct: 583 tctggta 577



to top

>gb|U37578.1|GGU37578 Gallus gallus histone H3-VII gene, complete cds
          Length = 1204

 Score =  291 bits (147), Expect = 9e-76
 Identities = 222/247 (89%)
 Strand = Plus / Minus

                                                                       
Query: 159 aggcgcgctccccgcggatgcggcgggcgagctggatgtccttgggcatgattgtgacgc 218
           |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||
Sbjct: 897 aggcgcgctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgc 838

                                                                       
Query: 219 gcttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtacgcctcgg 278
           ||||||||||||||||||| ||||||||||||||||||||||| || ||||| |||||| 
Sbjct: 837 gcttggcgtggatggcgcacaggttggtgtcctcgaagagccccaccaggtaggcctcgc 778

                                                                       
Query: 279 cggcctcctggagcgcggagacggcggaggactggaagcggaggtcggtcttgaagtcct 338
             |||||||| |||||   |||||| |||  ||||||||| ||||||||||| |||||||
Sbjct: 777 tcgcctcctgcagcgccatgacggccgagctctggaagcgcaggtcggtcttaaagtcct 718

                                                                       
Query: 339 gcgcgatctcccggacgaggcgctgaaaggggagcttgcggatgagcagctccgtgctct 398
           |||||||||| || || |||||||| ||||| ||||||||||| ||||||||||||  ||
Sbjct: 717 gcgcgatctcgcgcaccaggcgctggaagggcagcttgcggatcagcagctccgtggact 658

                  
Query: 399 tctggta 405
           |||||||
Sbjct: 657 tctggta 651



to top

>gb|M61155.1|CHKH3AB Chicken histone H3 gene, complete cds
          Length = 1017

 Score =  291 bits (147), Expect = 9e-76
 Identities = 222/247 (89%)
 Strand = Plus / Minus

                                                                       
Query: 159 aggcgcgctccccgcggatgcggcgggcgagctggatgtccttgggcatgattgtgacgc 218
           |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||
Sbjct: 569 aggcgcgctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgc 510

                                                                       
Query: 219 gcttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtacgcctcgg 278
           |||||||||| |||||||| ||||||||||||||||||||||| || ||||| |||||| 
Sbjct: 509 gcttggcgtgcatggcgcacaggttggtgtcctcgaagagccccaccaggtaggcctcgc 450

                                                                       
Query: 279 cggcctcctggagcgcggagacggcggaggactggaagcggaggtcggtcttgaagtcct 338
             |||||||| |||||   |||||| |||  ||||||||| |||||||||||||||||||
Sbjct: 449 tcgcctcctgcagcgccatgacggccgagctctggaagcgcaggtcggtcttgaagtcct 390

                                                                       
Query: 339 gcgcgatctcccggacgaggcgctgaaaggggagcttgcggatgagcagctccgtgctct 398
           |||||||||| || || |||||||| ||||| ||||||||||| ||||||||||||  ||
Sbjct: 389 gcgcgatctcgcgcaccaggcgctggaagggcagcttgcggatcagcagctccgtggact 330

                  
Query: 399 tctggta 405
           |||||||
Sbjct: 329 tctggta 323



to top

>gb|M61154.1|CHKH3AA Chicken histone H3 gene, complete cds
          Length = 784

 Score =  291 bits (147), Expect = 9e-76
 Identities = 222/247 (89%)
 Strand = Plus / Minus

                                                                       
Query: 159 aggcgcgctccccgcggatgcggcgggcgagctggatgtccttgggcatgattgtgacgc 218
           |||| ||||||||||||||||||||||||||||||||||||||||||||||| |||||||
Sbjct: 762 aggcacgctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgc 703

                                                                       
Query: 219 gcttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtacgcctcgg 278
           ||||||||||||||||||| ||||||||||||||||||||||| || ||||| |||||| 
Sbjct: 702 gcttggcgtggatggcgcacaggttggtgtcctcgaagagccccaccaggtaggcctcgc 643

                                                                       
Query: 279 cggcctcctggagcgcggagacggcggaggactggaagcggaggtcggtcttgaagtcct 338
             |||||||| |||||   |||||| |||  ||||||||| |||||||||||||||||||
Sbjct: 642 tcgcctcctgcagcgccatgacggccgagctctggaagcgcaggtcggtcttgaagtcct 583

                                                                       
Query: 339 gcgcgatctcccggacgaggcgctgaaaggggagcttgcggatgagcagctccgtgctct 398
           |||||||||| || || |||||||| ||||| ||||||||||| ||||||||||||  ||
Sbjct: 582 gcgcgatctcgcgcaccaggcgctggaagggcagcttgcggatcagcagctccgtggact 523

                  
Query: 399 tctggta 405
           |||||||
Sbjct: 522 tctggta 516



to top

>ref|XM_416193.1| PREDICTED: Gallus gallus similar to histone protein Hist2h3c1
            (LOC417953), mRNA
          Length = 2271

 Score =  285 bits (144), Expect = 6e-74
 Identities = 216/240 (90%)
 Strand = Plus / Minus

                                                                        
Query: 166  ctccccgcggatgcggcgggcgagctggatgtccttgggcatgattgtgacgcgcttggc 225
            ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||
Sbjct: 2262 ctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgcgcttggc 2203

                                                                        
Query: 226  gtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtacgcctcggcggcctc 285
            |||||||||||| ||||||||||||||||||||||| || ||||| ||||||   |||||
Sbjct: 2202 gtggatggcgcacaggttggtgtcctcgaagagccccaccaggtaggcctcgctcgcctc 2143

                                                                        
Query: 286  ctggagcgcggagacggcggaggactggaagcggaggtcggtcttgaagtcctgcgcgat 345
            ||| |||||   |||||| |||  ||||||||| ||||||||||||||||||||||||||
Sbjct: 2142 ctgcagcgccatgacggccgagctctggaagcgcaggtcggtcttgaagtcctgcgcgat 2083

                                                                        
Query: 346  ctcccggacgaggcgctgaaaggggagcttgcggatgagcagctccgtgctcttctggta 405
            ||| || || |||||||| ||||| ||||||||||| ||||||||||||  |||||||||
Sbjct: 2082 ctcgcgcaccaggcgctggaagggcagcttgcggatcagcagctccgtggacttctggta 2023



to top

>gb|U38422.1|TAU38422 Triticum aestivum histone H3 gene, partial cds, clone W1
          Length = 479

 Score =  283 bits (143), Expect = 2e-73
 Identities = 209/231 (90%)
 Strand = Plus / Minus

                                                                       
Query: 188 agctggatgtccttgggcatgattgtgacgcgcttggcgtggatggcgcagaggttggtg 247
           ||||||||||||||||||||||| |||||||||||||||||||||||||| |||||||||
Sbjct: 479 agctggatgtccttgggcatgatggtgacgcgcttggcgtggatggcgcacaggttggtg 420

                                                                       
Query: 248 tcctcgaagagcccgacgaggtacgcctcggcggcctcctggagcgcggagacggcggag 307
           |||||||| ||||| || |||||||||||||| ||||||||||| ||    ||||||  |
Sbjct: 419 tcctcgaacagccccaccaggtacgcctcggccgcctcctggagggccagcacggcgtgg 360

                                                                       
Query: 308 gactggaagcggaggtcggtcttgaagtcctgcgcgatctcccggacgaggcgctgaaag 367
           ||||||||||||||||| |||||||||||||||||||||||||  || |||||||| || 
Sbjct: 359 gactggaagcggaggtccgtcttgaagtcctgcgcgatctccctcaccaggcgctggaac 300

                                                              
Query: 368 gggagcttgcggatgagcagctccgtgctcttctggtacttgcggatctcc 418
           || ||||||||||| |||||||||||||||||||||||||||||| |||||
Sbjct: 299 ggcagcttgcggatcagcagctccgtgctcttctggtacttgcgggtctcc 249



to top

>gb|AF140033.1|AF140033 Phreatamoeba balamuthi histone H3 mRNA, complete cds
          Length = 626

 Score =  281 bits (142), Expect = 9e-73
 Identities = 232/262 (88%)
 Strand = Plus / Minus

                                                                       
Query: 156 cctaggcgcgctccccgcggatgcggcgggcgagctggatgtccttgggcatgattgtga 215
           ||||||||||||| || |||||||||||||| ||||||||||||||||||||||| || |
Sbjct: 423 cctaggcgcgctcgccacggatgcggcgggccagctggatgtccttgggcatgatcgtca 364

                                                                       
Query: 216 cgcgcttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtacgcct 275
           | |||||||||||||||||||| ||||||||||||||||| |||||||||||||| ||||
Sbjct: 363 cacgcttggcgtggatggcgcacaggttggtgtcctcgaacagcccgacgaggtaggcct 304

                                                                       
Query: 276 cggcggcctcctggagcgcggagacggcggaggactggaagcggaggtcggtcttgaagt 335
           ||||||||||||| ||||| | ||  || | |  |||||| |  ||||| || |||||||
Sbjct: 303 cggcggcctcctgcagcgccgcgatcgcagcgctctggaacctcaggtccgttttgaagt 244

                                                                       
Query: 336 cctgcgcgatctcccggacgaggcgctgaaaggggagcttgcggatgagcagctccgtgc 395
           |||| || ||||| |||||||||||||| ||||| |||||||||||||||||||| ||||
Sbjct: 243 cctgggcaatctcgcggacgaggcgctggaagggcagcttgcggatgagcagctcggtgc 184

                                 
Query: 396 tcttctggtacttgcggatctc 417
           ||||||||||| ||||||||||
Sbjct: 183 tcttctggtacctgcggatctc 162



to top

>emb|X14732.1|CMHIST34 Duck H3 and H4 histone genes
          Length = 4717

 Score =  276 bits (139), Expect = 5e-71
 Identities = 211/235 (89%)
 Strand = Plus / Minus

                                                                        
Query: 159  aggcgcgctccccgcggatgcggcgggcgagctggatgtccttgggcatgattgtgacgc 218
            |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||
Sbjct: 3244 aggcgcgctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgc 3185

                                                                        
Query: 219  gcttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtacgcctcgg 278
            ||||||||||||||||||| ||||||||||||||||||||||| || ||||| |||||| 
Sbjct: 3184 gcttggcgtggatggcgcacaggttggtgtcctcgaagagccccaccaggtaggcctcgc 3125

                                                                        
Query: 279  cggcctcctggagcgcggagacggcggaggactggaagcggaggtcggtcttgaagtcct 338
              |||||||| |||||    ||||| |||  ||||||||| |||||||||||||||||||
Sbjct: 3124 tcgcctcctgcagcgccatcacggccgagctctggaagcgcaggtcggtcttgaagtcct 3065

                                                                   
Query: 339  gcgcgatctcccggacgaggcgctgaaaggggagcttgcggatgagcagctccgt 393
            |||||||||| || || || ||||| ||||| ||||||||||| |||||||||||
Sbjct: 3064 gcgcgatctcgcgcaccagccgctggaagggcagcttgcggatcagcagctccgt 3010



 Score =  276 bits (139), Expect = 5e-71
 Identities = 211/235 (89%)
 Strand = Plus / Plus

                                                                        
Query: 159  aggcgcgctccccgcggatgcggcgggcgagctggatgtccttgggcatgattgtgacgc 218
            |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||
Sbjct: 1477 aggcgcgctccccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacgc 1536

                                                                        
Query: 219  gcttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtacgcctcgg 278
            ||||||||||||||||||| ||||||||||||||||||||||| || ||||| |||||| 
Sbjct: 1537 gcttggcgtggatggcgcacaggttggtgtcctcgaagagccccaccaggtaggcctcgc 1596

                                                                        
Query: 279  cggcctcctggagcgcggagacggcggaggactggaagcggaggtcggtcttgaagtcct 338
              |||||||| |||||    ||||| |||  ||||||||| |||||||||||||||||||
Sbjct: 1597 tcgcctcctgcagcgccatcacggccgagctctggaagcgcaggtcggtcttgaagtcct 1656

                                                                   
Query: 339  gcgcgatctcccggacgaggcgctgaaaggggagcttgcggatgagcagctccgt 393
            |||||||||| || || || ||||| ||||| ||||||||||| |||||||||||
Sbjct: 1657 gcgcgatctcgcgcaccagccgctggaagggcagcttgcggatcagcagctccgt 1711



to top

>gb|U38423.1|TAU38423 Triticum aestivum histone H3 gene, partial cds, clone W2
          Length = 486

 Score =  276 bits (139), Expect = 5e-71
 Identities = 208/231 (90%)
 Strand = Plus / Minus

                                                                       
Query: 188 agctggatgtccttgggcatgattgtgacgcgcttggcgtggatggcgcagaggttggtg 247
           ||||||||||||||||||||||| |||||||||||||| |||||||||||| ||||||||
Sbjct: 486 agctggatgtccttgggcatgatggtgacgcgcttggcatggatggcgcaggggttggtg 427

                                                                       
Query: 248 tcctcgaagagcccgacgaggtacgcctcggcggcctcctggagcgcggagacggcggag 307
           |||||||||||||||||||||||||||||||||||||||||||| ||    ||||||  |
Sbjct: 426 tcctcgaagagcccgacgaggtacgcctcggcggcctcctggagggccagcacggcgtgg 367

                                                                       
Query: 308 gactggaagcggaggtcggtcttgaagtcctgcgcgatctcccggacgaggcgctgaaag 367
             ||||||||| || || |||||||||||||| ||||||||||| |  |||||||| || 
Sbjct: 366 ctctggaagcgcagatccgtcttgaagtcctgggcgatctcccgcagcaggcgctggaac 307

                                                              
Query: 368 gggagcttgcggatgagcagctccgtgctcttctggtacttgcggatctcc 418
           || ||||||||||||||||| ||||||||||||||||||||||||||||||
Sbjct: 306 ggcagcttgcggatgagcagatccgtgctcttctggtacttgcggatctcc 256



to top

>gb|AY125231.1| Melanoplus sp. OR18 histone 3 gene, partial cds
          Length = 372

 Score =  272 bits (137), Expect = 8e-70
 Identities = 191/209 (91%)
 Strand = Plus / Minus

                                                                       
Query: 197 tccttgggcatgattgtgacgcgcttggcgtggatggcgcagaggttggtgtcctcgaag 256
           |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 368 tccttgggcatgatggtgacgcgcttggcgtggatggcgcagaggttggtgtcctcgaag 309

                                                                       
Query: 257 agcccgacgaggtacgcctcggcggcctcctggagcgcggagacggcggaggactggaag 316
           || ||||||||||| ||||||  ||||||||| |||||   ||||||||||  |||||||
Sbjct: 308 aggccgacgaggtaggcctcgctggcctcctgcagcgccatgacggcggagctctggaag 249

                                                                       
Query: 317 cggaggtcggtcttgaagtcctgcgcgatctcccggacgaggcgctgaaaggggagcttg 376
           || ||||||||||||||||||||||||||||| || || |||||||| ||||| ||||||
Sbjct: 248 cgcaggtcggtcttgaagtcctgcgcgatctcgcgcactaggcgctggaagggcagcttg 189

                                        
Query: 377 cggatgagcagctccgtgctcttctggta 405
           |||||||||||||| ||||||||||||||
Sbjct: 188 cggatgagcagctcggtgctcttctggta 160



to top

>ref|XM_849194.1| PREDICTED: Canis familiaris similar to histone 1, H2ai (predicted)
           (LOC611519), mRNA
          Length = 471

 Score =  270 bits (136), Expect = 3e-69
 Identities = 214/240 (89%)
 Strand = Plus / Minus

                                                                       
Query: 166 ctccccgcggatgcggcgggcgagctggatgtccttgggcatgattgtgacgcgcttggc 225
           |||||||||||||||||| || ||||||||||||||||||||||| ||||||||||||||
Sbjct: 462 ctccccgcggatgcggcgcgccagctggatgtccttgggcatgatggtgacgcgcttggc 403

                                                                       
Query: 226 gtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtacgcctcggcggcctc 285
           |||||||||||||||||||||||||||||||||||| || ||||| ||||||   |||||
Sbjct: 402 gtggatggcgcagaggttggtgtcctcgaagagccccaccaggtaggcctcgcacgcctc 343

                                                                       
Query: 286 ctggagcgcggagacggcggaggactggaagcggaggtcggtcttgaagtcctgcgcgat 345
           ||| |||||   |||||| |||  ||||||||| ||||||||||||||||||||||||||
Sbjct: 342 ctgcagcgccatgacggccgagctctggaagcgcaggtcggtcttgaagtcctgcgcgat 283

                                                                       
Query: 346 ctcccggacgaggcgctgaaaggggagcttgcggatgagcagctccgtgctcttctggta 405
           ||| || || |||||||| || || ||||||||||| ||||||||||||  |||||||||
Sbjct: 282 ctcgcgcaccaggcgctggaacggcagcttgcggatcagcagctccgtggacttctggta 223



to top

>ref|XM_545420.2| PREDICTED: Canis familiaris similar to histone 1, H2ai (predicted)
           (LOC488298), mRNA
          Length = 411

 Score =  270 bits (136), Expect = 3e-69
 Identities = 214/240 (89%)
 Strand = Plus / Minus

                                                                       
Query: 166 ctccccgcggatgcggcgggcgagctggatgtccttgggcatgattgtgacgcgcttggc 225
           |||||||||||||||||| || ||||||||||||||||||||||| ||||||||||||||
Sbjct: 402 ctccccgcggatgcggcgcgccagctggatgtccttgggcatgatggtgacgcgcttggc 343

                                                                       
Query: 226 gtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtacgcctcggcggcctc 285
           |||||||||||||||||||||||||||||||||||| || ||||| ||||||   |||||
Sbjct: 342 gtggatggcgcagaggttggtgtcctcgaagagccccaccaggtaggcctcgcacgcctc 283

                                                                       
Query: 286 ctggagcgcggagacggcggaggactggaagcggaggtcggtcttgaagtcctgcgcgat 345
           ||| |||||   |||||| |||  ||||||||| ||||||||||||||||||||||||||
Sbjct: 282 ctgcagcgccatgacggccgagctctggaagcgcaggtcggtcttgaagtcctgcgcgat 223

                                                                       
Query: 346 ctcccggacgaggcgctgaaaggggagcttgcggatgagcagctccgtgctcttctggta 405
           ||| || || |||||||| || || ||||||||||| ||||||||||||  |||||||||
Sbjct: 222 ctcgcgcaccaggcgctggaacggcagcttgcggatcagcagctccgtggacttctggta 163



to top

>ref|XM_545399.1| PREDICTED: Canis familiaris similar to histone 1, H2ai (predicted)
           (LOC488277), mRNA
          Length = 411

 Score =  270 bits (136), Expect = 3e-69
 Identities = 214/240 (89%)
 Strand = Plus / Minus

                                                                       
Query: 166 ctccccgcggatgcggcgggcgagctggatgtccttgggcatgattgtgacgcgcttggc 225
           |||||||||||||||||| || ||||||||||||||||||||||| ||||||||||||||
Sbjct: 402 ctccccgcggatgcggcgcgccagctggatgtccttgggcatgatggtgacgcgcttggc 343

                                                                       
Query: 226 gtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtacgcctcggcggcctc 285
           |||||||||||||||||||||||||||||||||||| || ||||| ||||||   |||||
Sbjct: 342 gtggatggcgcagaggttggtgtcctcgaagagccccaccaggtaggcctcgcacgcctc 283

                                                                       
Query: 286 ctggagcgcggagacggcggaggactggaagcggaggtcggtcttgaagtcctgcgcgat 345
           ||| |||||   |||||| |||  ||||||||| ||||||||||||||||||||||||||
Sbjct: 282 ctgcagcgccatgacggccgagctctggaagcgcaggtcggtcttgaagtcctgcgcgat 223

                                                                       
Query: 346 ctcccggacgaggcgctgaaaggggagcttgcggatgagcagctccgtgctcttctggta 405
           ||| || || |||||||| || || ||||||||||| ||||||||||||  |||||||||
Sbjct: 222 ctcgcgcaccaggcgctggaacggcagcttgcggatcagcagctccgtggacttctggta 163



to top

>ref|XM_545397.2| PREDICTED: Canis familiaris similar to histone 1, H2ai (predicted)
           (LOC488275), mRNA
          Length = 459

 Score =  270 bits (136), Expect = 3e-69
 Identities = 214/240 (89%)
 Strand = Plus / Minus

                                                                       
Query: 166 ctccccgcggatgcggcgggcgagctggatgtccttgggcatgattgtgacgcgcttggc 225
           |||||||||||||||||| || ||||||||||||||||||||||| ||||||||||||||
Sbjct: 450 ctccccgcggatgcggcgcgccagctggatgtccttgggcatgatggtgacgcgcttggc 391

                                                                       
Query: 226 gtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtacgcctcggcggcctc 285
           |||||||||||||||||||||||||||||||||||| || ||||| ||||||   |||||
Sbjct: 390 gtggatggcgcagaggttggtgtcctcgaagagccccaccaggtaggcctcgcacgcctc 331

                                                                       
Query: 286 ctggagcgcggagacggcggaggactggaagcggaggtcggtcttgaagtcctgcgcgat 345
           ||| |||||   |||||| |||  ||||||||| ||||||||||||||||||||||||||
Sbjct: 330 ctgcagcgccatgacggccgagctctggaagcgcaggtcggtcttgaagtcctgcgcgat 271

                                                                       
Query: 346 ctcccggacgaggcgctgaaaggggagcttgcggatgagcagctccgtgctcttctggta 405
           ||| || || |||||||| || || ||||||||||| ||||||||||||  |||||||||
Sbjct: 270 ctcgcgcaccaggcgctggaacggcagcttgcggatcagcagctccgtggacttctggta 211



to top

>ref|XM_848810.1| PREDICTED: Canis familiaris similar to histone 1, H2ai (predicted)
           (LOC611167), mRNA
          Length = 504

 Score =  270 bits (136), Expect = 3e-69
 Identities = 214/240 (89%)
 Strand = Plus / Minus

                                                                       
Query: 166 ctccccgcggatgcggcgggcgagctggatgtccttgggcatgattgtgacgcgcttggc 225
           |||||||||||||||||| || ||||||||||||||||||||||| ||||||||||||||
Sbjct: 495 ctccccgcggatgcggcgcgccagctggatgtccttgggcatgatggtgacgcgcttggc 436

                                                                       
Query: 226 gtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtacgcctcggcggcctc 285
           |||||||||||||||||||||||||||||||||||| || ||||| ||||||   |||||
Sbjct: 435 gtggatggcgcagaggttggtgtcctcgaagagccccaccaggtaggcctcgcacgcctc 376

                                                                       
Query: 286 ctggagcgcggagacggcggaggactggaagcggaggtcggtcttgaagtcctgcgcgat 345
           ||| |||||   |||||| |||  ||||||||| ||||||||||||||||||||||||||
Sbjct: 375 ctgcagcgccatgacggccgagctctggaagcgcaggtcggtcttgaagtcctgcgcgat 316

                                                                       
Query: 346 ctcccggacgaggcgctgaaaggggagcttgcggatgagcagctccgtgctcttctggta 405
           ||| || || |||||||| || || ||||||||||| ||||||||||||  |||||||||
Sbjct: 315 ctcgcgcaccaggcgctggaacggcagcttgcggatcagcagctccgtggacttctggta 256



to top

>ref|XM_848782.1| PREDICTED: Canis familiaris similar to histone 1, H2ai (predicted)
           (LOC611138), mRNA
          Length = 411

 Score =  270 bits (136), Expect = 3e-69
 Identities = 214/240 (89%)
 Strand = Plus / Minus

                                                                       
Query: 166 ctccccgcggatgcggcgggcgagctggatgtccttgggcatgattgtgacgcgcttggc 225
           |||||||||||||||||| || ||||||||||||||||||||||| ||||||||||||||
Sbjct: 402 ctccccgcggatgcggcgcgccagctggatgtccttgggcatgatggtgacgcgcttggc 343

                                                                       
Query: 226 gtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtacgcctcggcggcctc 285
           |||||||||||||||||||||||||||||||||||| || ||||| ||||||   |||||
Sbjct: 342 gtggatggcgcagaggttggtgtcctcgaagagccccaccaggtaggcctcgcacgcctc 283

                                                                       
Query: 286 ctggagcgcggagacggcggaggactggaagcggaggtcggtcttgaagtcctgcgcgat 345
           ||| |||||   |||||| |||  ||||||||| ||||||||||||||||||||||||||
Sbjct: 282 ctgcagcgccatgacggccgagctctggaagcgcaggtcggtcttgaagtcctgcgcgat 223

                                                                       
Query: 346 ctcccggacgaggcgctgaaaggggagcttgcggatgagcagctccgtgctcttctggta 405
           ||| || || |||||||| || || ||||||||||| ||||||||||||  |||||||||
Sbjct: 222 ctcgcgcaccaggcgctggaacggcagcttgcggatcagcagctccgtggacttctggta 163



to top

>ref|XM_545429.1| PREDICTED: Canis familiaris similar to histone 1, H2ai (predicted)
           (LOC488307), mRNA
          Length = 411

 Score =  270 bits (136), Expect = 3e-69
 Identities = 214/240 (89%)
 Strand = Plus / Minus

                                                                       
Query: 166 ctccccgcggatgcggcgggcgagctggatgtccttgggcatgattgtgacgcgcttggc 225
           |||||||||||||||||| || ||||||||||||||||||||||| ||||||||||||||
Sbjct: 402 ctccccgcggatgcggcgcgccagctggatgtccttgggcatgatggtgacgcgcttggc 343

                                                                       
Query: 226 gtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtacgcctcggcggcctc 285
           |||||||||||||||||||||||||||||||||||| || ||||| ||||||   |||||
Sbjct: 342 gtggatggcgcagaggttggtgtcctcgaagagccccaccaggtaggcctcgcacgcctc 283

                                                                       
Query: 286 ctggagcgcggagacggcggaggactggaagcggaggtcggtcttgaagtcctgcgcgat 345
           ||| |||||   |||||| |||  ||||||||| ||||||||||||||||||||||||||
Sbjct: 282 ctgcagcgccatgacggccgagctctggaagcgcaggtcggtcttgaagtcctgcgcgat 223

                                                                       
Query: 346 ctcccggacgaggcgctgaaaggggagcttgcggatgagcagctccgtgctcttctggta 405
           ||| || || |||||||| || || ||||||||||| ||||||||||||  |||||||||
Sbjct: 222 ctcgcgcaccaggcgctggaacggcagcttgcggatcagcagctccgtggacttctggta 163



to top

>ref|XM_545385.1| PREDICTED: Canis familiaris similar to histone 1, H2ai (predicted)
           (LOC488263), mRNA
          Length = 411

 Score =  270 bits (136), Expect = 3e-69
 Identities = 214/240 (89%)
 Strand = Plus / Minus

                                                                       
Query: 166 ctccccgcggatgcggcgggcgagctggatgtccttgggcatgattgtgacgcgcttggc 225
           |||||||||||||||||| || ||||||||||||||||||||||| ||||||||||||||
Sbjct: 402 ctccccgcggatgcggcgcgccagctggatgtccttgggcatgatggtgacgcgcttggc 343

                                                                       
Query: 226 gtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtacgcctcggcggcctc 285
           |||||||||||||||||||||||||||||||||||| || ||||| ||||||   |||||
Sbjct: 342 gtggatggcgcagaggttggtgtcctcgaagagccccaccaggtaggcctcgcacgcctc 283

                                                                       
Query: 286 ctggagcgcggagacggcggaggactggaagcggaggtcggtcttgaagtcctgcgcgat 345
           ||| |||||   |||||| |||  ||||||||| ||||||||||||||||||||||||||
Sbjct: 282 ctgcagcgccatgacggccgagctctggaagcgcaggtcggtcttgaagtcctgcgcgat 223

                                                                       
Query: 346 ctcccggacgaggcgctgaaaggggagcttgcggatgagcagctccgtgctcttctggta 405
           ||| || || |||||||| || || ||||||||||| ||||||||||||  |||||||||
Sbjct: 222 ctcgcgcaccaggcgctggaacggcagcttgcggatcagcagctccgtggacttctggta 163



to top

>ref|XM_854155.1| PREDICTED: Canis familiaris similar to histone 1, H2ai (predicted),
           transcript variant 3 (LOC480760), mRNA
          Length = 862

 Score =  270 bits (136), Expect = 3e-69
 Identities = 214/240 (89%)
 Strand = Plus / Minus

                                                                       
Query: 166 ctccccgcggatgcggcgggcgagctggatgtccttgggcatgattgtgacgcgcttggc 225
           |||||||||||||||||| || ||||||||||||||||||||||| ||||||||||||||
Sbjct: 402 ctccccgcggatgcggcgcgccagctggatgtccttgggcatgatggtgacgcgcttggc 343

                                                                       
Query: 226 gtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtacgcctcggcggcctc 285
           |||||||||||||||||||||||||||||||||||| || ||||| ||||||   |||||
Sbjct: 342 gtggatggcgcagaggttggtgtcctcgaagagccccaccaggtaggcctcgcacgcctc 283

                                                                       
Query: 286 ctggagcgcggagacggcggaggactggaagcggaggtcggtcttgaagtcctgcgcgat 345
           ||| |||||   |||||| |||  ||||||||| ||||||||||||||||||||||||||
Sbjct: 282 ctgcagcgccatgacggccgagctctggaagcgcaggtcggtcttgaagtcctgcgcgat 223

                                                                       
Query: 346 ctcccggacgaggcgctgaaaggggagcttgcggatgagcagctccgtgctcttctggta 405
           ||| || || |||||||| || || ||||||||||| ||||||||||||  |||||||||
Sbjct: 222 ctcgcgcaccaggcgctggaacggcagcttgcggatcagcagctccgtggacttctggta 163



to top

>ref|XM_537880.2| PREDICTED: Canis familiaris similar to histone 1, H2ai (predicted),
           transcript variant 1 (LOC480760), mRNA
          Length = 1422

 Score =  270 bits (136), Expect = 3e-69
 Identities = 214/240 (89%)
 Strand = Plus / Minus

                                                                       
Query: 166 ctccccgcggatgcggcgggcgagctggatgtccttgggcatgattgtgacgcgcttggc 225
           |||||||||||||||||| || ||||||||||||||||||||||| ||||||||||||||
Sbjct: 402 ctccccgcggatgcggcgcgccagctggatgtccttgggcatgatggtgacgcgcttggc 343

                                                                       
Query: 226 gtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtacgcctcggcggcctc 285
           |||||||||||||||||||||||||||||||||||| || ||||| ||||||   |||||
Sbjct: 342 gtggatggcgcagaggttggtgtcctcgaagagccccaccaggtaggcctcgcacgcctc 283

                                                                       
Query: 286 ctggagcgcggagacggcggaggactggaagcggaggtcggtcttgaagtcctgcgcgat 345
           ||| |||||   |||||| |||  ||||||||| ||||||||||||||||||||||||||
Sbjct: 282 ctgcagcgccatgacggccgagctctggaagcgcaggtcggtcttgaagtcctgcgcgat 223

                                                                       
Query: 346 ctcccggacgaggcgctgaaaggggagcttgcggatgagcagctccgtgctcttctggta 405
           ||| || || |||||||| || || ||||||||||| ||||||||||||  |||||||||
Sbjct: 222 ctcgcgcaccaggcgctggaacggcagcttgcggatcagcagctccgtggacttctggta 163



to top

>ref|XM_545428.1| PREDICTED: Canis familiaris similar to histone 1, H2ai (predicted)
           (LOC488306), mRNA
          Length = 411

 Score =  268 bits (135), Expect = 1e-68
 Identities = 213/239 (89%)
 Strand = Plus / Minus

                                                                       
Query: 167 tccccgcggatgcggcgggcgagctggatgtccttgggcatgattgtgacgcgcttggcg 226
           ||||||||||||||||| || ||||||||||||||||||||||| |||||||||||||||
Sbjct: 401 tccccgcggatgcggcgcgccagctggatgtccttgggcatgatggtgacgcgcttggcg 342

                                                                       
Query: 227 tggatggcgcagaggttggtgtcctcgaagagcccgacgaggtacgcctcggcggcctcc 286
           ||||||||||||||||||||||||||||||||||| || ||||| ||||||   ||||||
Sbjct: 341 tggatggcgcagaggttggtgtcctcgaagagccccaccaggtaggcctcgcacgcctcc 282

                                                                       
Query: 287 tggagcgcggagacggcggaggactggaagcggaggtcggtcttgaagtcctgcgcgatc 346
           || |||||   |||||| |||  ||||||||| |||||||||||||||||||||||||||
Sbjct: 281 tgcagcgccatgacggccgagctctggaagcgcaggtcggtcttgaagtcctgcgcgatc 222

                                                                      
Query: 347 tcccggacgaggcgctgaaaggggagcttgcggatgagcagctccgtgctcttctggta 405
           || || || |||||||| || || ||||||||||| ||||||||||||  |||||||||
Sbjct: 221 tcgcgcaccaggcgctggaacggcagcttgcggatcagcagctccgtggacttctggta 163



to top

>gb|AC146538.2| Gasterosteus aculeatus clone CH213-118G22, complete sequence
          Length = 211945

 Score =  266 bits (134), Expect = 5e-68
 Identities = 230/262 (87%)
 Strand = Plus / Plus

                                                                          
Query: 157    ctaggcgcgctccccgcggatgcggcgggcgagctggatgtccttgggcatgattgtgac 216
              |||||| ||||||||||||||||||||||| ||||||||||| ||||||||||| |||||
Sbjct: 102348 ctaggctcgctccccgcggatgcggcgggccagctggatgtctttgggcatgatggtgac 102407

                                                                          
Query: 217    gcgcttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtacgcctc 276
               |||||||||||||||||||| ||||||||||||||||| || || || ||||| |||||
Sbjct: 102408 ccgcttggcgtggatggcgcacaggttggtgtcctcgaacaggcccaccaggtaagcctc 102467

                                                                          
Query: 277    ggcggcctcctggagcgcggagacggcggaggactggaagcggaggtcggtcttgaagtc 336
              |  || |||||| || ||   ||||||||||  ||||||||| |||||||||||||||||
Sbjct: 102468 gctggactcctgcagggccatgacggcggagctctggaagcgcaggtcggtcttgaagtc 102527

                                                                          
Query: 337    ctgcgcgatctcccggacgaggcgctgaaaggggagcttgcggatgagcagctccgtgct 396
              ||||||||||||||| ||||||||||| ||||| ||||||||||| |||||||| |||  
Sbjct: 102528 ctgcgcgatctcccgcacgaggcgctggaagggcagcttgcggatcagcagctcggtgga 102587

                                    
Query: 397    cttctggtacttgcggatctcc 418
              |||||||||   ||||||||||
Sbjct: 102588 cttctggtagcggcggatctcc 102609



to top

>ref|XM_845651.1| PREDICTED: Canis familiaris similar to CG31613-PA (LOC608586), mRNA
          Length = 411

 Score =  264 bits (133), Expect = 2e-67
 Identities = 220/249 (88%)
 Strand = Plus / Minus

                                                                       
Query: 157 ctaggcgcgctccccgcggatgcggcgggcgagctggatgtccttgggcatgattgtgac 216
           ||||||||||||||||||||||||||| || ||||||||||||||||||||||| |||||
Sbjct: 411 ctaggcgcgctccccgcggatgcggcgcgccagctggatgtccttgggcatgatggtgac 352

                                                                       
Query: 217 gcgcttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtacgcctc 276
           ||||||||||||||||||||| ||||||||||||||||||||||| || ||||| |||||
Sbjct: 351 gcgcttggcgtggatggcgcacaggttggtgtcctcgaagagccccaccaggtaggcctc 292

                                                                       
Query: 277 ggcggcctcctggagcgcggagacggcggaggactggaagcggaggtcggtcttgaagtc 336
           |   |||||||| |||||   |||||| |||  ||||||||| ||||| |||||||||||
Sbjct: 291 gctcgcctcctgcagcgccatgacggccgagctctggaagcgcaggtccgtcttgaagtc 232

                                                                       
Query: 337 ctgcgcgatctcccggacgaggcgctgaaaggggagcttgcggatgagcagctccgtgct 396
           |||||||||||| || || || ||||| || || ||||||||||| ||||||||||||  
Sbjct: 231 ctgcgcgatctcgcgcaccagccgctggaacggcagcttgcggatcagcagctccgtgga 172

                    
Query: 397 cttctggta 405
           |||||||||
Sbjct: 171 cttctggta 163



to top

>gb|U38420.1|HVU38420 Hordeum vulgare histone H3 gene, partial cds, clone B1
          Length = 494

 Score =  258 bits (130), Expect = 1e-65
 Identities = 205/230 (89%)
 Strand = Plus / Minus

                                                                       
Query: 188 agctggatgtccttgggcatgattgtgacgcgcttggcgtggatggcgcagaggttggtg 247
           ||||||||||||||||||||||| |||||||||||||||||||||||||| |||||||||
Sbjct: 494 agctggatgtccttgggcatgatggtgacgcgcttggcgtggatggcgcacaggttggtg 435

                                                                       
Query: 248 tcctcgaagagcccgacgaggtacgcctcggcggcctcctggagcgcggagacggcggag 307
           |||||||| ||||||   ||||| |||||||| ||||||||||| ||    ||||||  |
Sbjct: 434 tcctcgaacagcccgcgaaggtatgcctcggcagcctcctggagggccagcacggcgtgg 375

                                                                       
Query: 308 gactggaagcggaggtcggtcttgaagtcctgcgcgatctcccggacgaggcgctgaaag 367
           |||||||| | ||||||||||||||||||||| ||||||||||  || |||||||| || 
Sbjct: 374 gactggaacctgaggtcggtcttgaagtcctgagcgatctccctcaccaggcgctggaac 315

                                                             
Query: 368 gggagcttgcggatgagcagctccgtgctcttctggtacttgcggatctc 417
           || ||||||||||| |||||||||||||||||||||||||||||||||||
Sbjct: 314 ggcagcttgcggatcagcagctccgtgctcttctggtacttgcggatctc 265



to top

>ref|XM_540290.1| PREDICTED: Canis familiaris similar to H3 histone, family 2 isoform
           2 (LOC483172), mRNA
          Length = 525

 Score =  250 bits (126), Expect = 3e-63
 Identities = 213/242 (88%)
 Strand = Plus / Minus

                                                                       
Query: 164 cgctccccgcggatgcggcgggcgagctggatgtccttgggcatgattgtgacgcgcttg 223
           |||||||||||||||||||| || ||||||||||||||||||||||| ||||||||||||
Sbjct: 518 cgctccccgcggatgcggcgcgccagctggatgtccttgggcatgatggtgacgcgcttg 459

                                                                       
Query: 224 gcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtacgcctcggcggcc 283
           |||||||||||||| ||||||||||||||||||||||| || ||||| ||||||   |||
Sbjct: 458 gcgtggatggcgcacaggttggtgtcctcgaagagccccaccaggtaggcctcgctcgcc 399

                                                                       
Query: 284 tcctggagcgcggagacggcggaggactggaagcggaggtcggtcttgaagtcctgcgcg 343
           ||||| |||||   |||||| |||  ||||||||| ||||| ||||||||||||||||||
Sbjct: 398 tcctgcagcgccatgacggccgagctctggaagcgcaggtccgtcttgaagtcctgcgcg 339

                                                                       
Query: 344 atctcccggacgaggcgctgaaaggggagcttgcggatgagcagctccgtgctcttctgg 403
           ||||| || || || ||||| || || ||||||||||| ||||||||||||  |||||||
Sbjct: 338 atctcgcgcaccagccgctggaacggcagcttgcggatcagcagctccgtggacttctgg 279

             
Query: 404 ta 405
           ||
Sbjct: 278 ta 277



to top

>ref|XM_540285.1| PREDICTED: Canis familiaris similar to H3 histone, family 2 isoform
           2 (LOC483167), mRNA
          Length = 525

 Score =  250 bits (126), Expect = 3e-63
 Identities = 213/242 (88%)
 Strand = Plus / Minus

                                                                       
Query: 164 cgctccccgcggatgcggcgggcgagctggatgtccttgggcatgattgtgacgcgcttg 223
           |||||||||||||||||||| || ||||||||||||||||||||||| ||||||||||||
Sbjct: 518 cgctccccgcggatgcggcgcgccagctggatgtccttgggcatgatggtgacgcgcttg 459

                                                                       
Query: 224 gcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtacgcctcggcggcc 283
           |||||||||||||| ||||||||||||||||||||||| || ||||| ||||||   |||
Sbjct: 458 gcgtggatggcgcacaggttggtgtcctcgaagagccccaccaggtaggcctcgctcgcc 399

                                                                       
Query: 284 tcctggagcgcggagacggcggaggactggaagcggaggtcggtcttgaagtcctgcgcg 343
           ||||| |||||   |||||| |||  ||||||||| ||||| ||||||||||||||||||
Sbjct: 398 tcctgcagcgccatgacggccgagctctggaagcgcaggtccgtcttgaagtcctgcgcg 339

                                                                       
Query: 344 atctcccggacgaggcgctgaaaggggagcttgcggatgagcagctccgtgctcttctgg 403
           ||||| || || || ||||| || || ||||||||||| ||||||||||||  |||||||
Sbjct: 338 atctcgcgcaccagccgctggaacggcagcttgcggatcagcagctccgtggacttctgg 279

             
Query: 404 ta 405
           ||
Sbjct: 278 ta 277



to top

>gb|AY125229.1| Argia vivida histone 3 gene, partial cds
          Length = 372

 Score =  248 bits (125), Expect = 1e-62
 Identities = 188/209 (89%)
 Strand = Plus / Minus

                                                                       
Query: 197 tccttgggcatgattgtgacgcgcttggcgtggatggcgcagaggttggtgtcctcgaag 256
           |||||||||||||| |||||||||||||||||||||||||| ||||||||||||||||||
Sbjct: 368 tccttgggcatgatggtgacgcgcttggcgtggatggcgcacaggttggtgtcctcgaag 309

                                                                       
Query: 257 agcccgacgaggtacgcctcggcggcctcctggagcgcggagacggcggaggactggaag 316
           || ||||||||||| |||||||  |||||||| || ||   ||||||||||  |||||||
Sbjct: 308 agaccgacgaggtaggcctcggacgcctcctgcagagccatgacggcggagctctggaag 249

                                                                       
Query: 317 cggaggtcggtcttgaagtcctgcgcgatctcccggacgaggcgctgaaaggggagcttg 376
           ||||||||||||||||||||||| |||||||| ||||| |||||||| ||||| ||||||
Sbjct: 248 cggaggtcggtcttgaagtcctgggcgatctcgcggaccaggcgctggaagggcagcttg 189

                                        
Query: 377 cggatgagcagctccgtgctcttctggta 405
           ||||| || ||||| ||||||||||||||
Sbjct: 188 cggatcagaagctcggtgctcttctggta 160



to top

>gb|AY749755.1| Griseargiolestes albescens histone H3 (H3) gene, partial cds
          Length = 361

 Score =  248 bits (125), Expect = 1e-62
 Identities = 185/205 (90%)
 Strand = Plus / Minus

                                                                       
Query: 201 tgggcatgattgtgacgcgcttggcgtggatggcgcagaggttggtgtcctcgaagagcc 260
           |||||||||| ||||||||||| |||||||| ||||| |||||||||||||||||||| |
Sbjct: 361 tgggcatgatggtgacgcgcttagcgtggattgcgcacaggttggtgtcctcgaagagac 302

                                                                       
Query: 261 cgacgaggtacgcctcggcggcctcctggagcgcggagacggcggaggactggaagcgga 320
           |||||||||| ||||||  |||||||||||| ||   ||||||||||  |||||||||||
Sbjct: 301 cgacgaggtaagcctcgctggcctcctggagtgccatgacggcggagctctggaagcgga 242

                                                                       
Query: 321 ggtcggtcttgaagtcctgcgcgatctcccggacgaggcgctgaaaggggagcttgcgga 380
           ||||||||||||||||||| |||||||| |||||||||||||| ||||| ||||||||||
Sbjct: 241 ggtcggtcttgaagtcctgagcgatctcgcggacgaggcgctggaagggcagcttgcgga 182

                                    
Query: 381 tgagcagctccgtgctcttctggta 405
           | || ||||||||||||||||||||
Sbjct: 181 tcaggagctccgtgctcttctggta 157



to top

>gb|AY749753.1| Diphlebia coerulescens histone H3 (H3) gene, partial cds
          Length = 373

 Score =  248 bits (125), Expect = 1e-62
 Identities = 188/209 (89%)
 Strand = Plus / Minus

                                                                       
Query: 197 tccttgggcatgattgtgacgcgcttggcgtggatggcgcagaggttggtgtcctcgaag 256
           |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 370 tccttgggcatgatggtgacgcgcttggcgtggatggcgcagaggttggtgtcctcgaag 311

                                                                       
Query: 257 agcccgacgaggtacgcctcggcggcctcctggagcgcggagacggcggaggactggaag 316
           || || |||||||| ||||||  |||||||||||| ||   ||||||||||  |||||||
Sbjct: 310 agacccacgaggtaagcctcgctggcctcctggagtgccatgacggcggagctctggaag 251

                                                                       
Query: 317 cggaggtcggtcttgaagtcctgcgcgatctcccggacgaggcgctgaaaggggagcttg 376
           ||||||||||||||||||||||| |||||||| |||||||| ||||| || || | ||||
Sbjct: 250 cggaggtcggtcttgaagtcctgggcgatctcgcggacgagtcgctggaacggcaacttg 191

                                        
Query: 377 cggatgagcagctccgtgctcttctggta 405
           |||||||| ||||| ||||||||||||||
Sbjct: 190 cggatgaggagctcggtgctcttctggta 162



to top

>gb|DQ393956.1| Cydia pomonella clone Cp4.140 microsatellite sequence
          Length = 517

 Score =  246 bits (124), Expect = 5e-62
 Identities = 208/236 (88%)
 Strand = Plus / Plus

                                                                       
Query: 170 ccgcggatgcggcgggcgagctggatgtccttgggcatgattgtgacgcgcttggcgtgg 229
           |||||||| | ||| || ||||||||||||||||||||||| ||||| ||||||||||||
Sbjct: 129 ccgcggatcctgcgagccagctggatgtccttgggcatgatggtgacacgcttggcgtgg 188

                                                                       
Query: 230 atggcgcagaggttggtgtcctcgaagagcccgacgaggtacgcctcggcggcctcctgg 289
           |||||||| |||||||||||||||||||| ||||||||||| ||||||  ||||||||||
Sbjct: 189 atggcgcacaggttggtgtcctcgaagagaccgacgaggtaagcctcgctggcctcctgg 248

                                                                       
Query: 290 agcgcggagacggcggaggactggaagcggaggtcggtcttgaagtcctgcgcgatctcc 349
           || ||    |||||||||  ||||||||| |||||||||||||||||||| |||||||| 
Sbjct: 249 agagccataacggcggagctctggaagcgcaggtcggtcttgaagtcctgagcgatctca 308

                                                                   
Query: 350 cggacgaggcgctgaaaggggagcttgcggatgagcagctccgtgctcttctggta 405
           ||||| || ||||| ||||| ||||||||||| || ||||| ||||||||||||||
Sbjct: 309 cggaccagacgctggaagggcagcttgcggatcagaagctcagtgctcttctggta 364



to top

>gb|DQ393939.1| Cydia pomonella clone Cp4.P microsatellite sequence
          Length = 517

 Score =  246 bits (124), Expect = 5e-62
 Identities = 208/236 (88%)
 Strand = Plus / Minus

                                                                       
Query: 170 ccgcggatgcggcgggcgagctggatgtccttgggcatgattgtgacgcgcttggcgtgg 229
           |||||||| | ||| || ||||||||||||||||||||||| ||||| ||||||||||||
Sbjct: 389 ccgcggatcctgcgagccagctggatgtccttgggcatgatggtgacacgcttggcgtgg 330

                                                                       
Query: 230 atggcgcagaggttggtgtcctcgaagagcccgacgaggtacgcctcggcggcctcctgg 289
           |||||||| |||||||||||||||||||| ||||||||||| ||||||  ||||||||||
Sbjct: 329 atggcgcacaggttggtgtcctcgaagagaccgacgaggtaagcctcgctggcctcctgg 270

                                                                       
Query: 290 agcgcggagacggcggaggactggaagcggaggtcggtcttgaagtcctgcgcgatctcc 349
           || ||    |||||||||  ||||||||| |||||||||||||||||||| |||||||| 
Sbjct: 269 agagccataacggcggagctctggaagcgcaggtcggtcttgaagtcctgagcgatctca 210

                                                                   
Query: 350 cggacgaggcgctgaaaggggagcttgcggatgagcagctccgtgctcttctggta 405
           ||||| || ||||| ||||| ||||||||||| || ||||| ||||||||||||||
Sbjct: 209 cggaccagacgctggaagggcagcttgcggatcagaagctcagtgctcttctggta 154



to top

>gb|DQ393935.1| Cydia pomonella clone Cp4.118 microsatellite sequence
          Length = 438

 Score =  246 bits (124), Expect = 5e-62
 Identities = 208/236 (88%)
 Strand = Plus / Plus

                                                                       
Query: 170 ccgcggatgcggcgggcgagctggatgtccttgggcatgattgtgacgcgcttggcgtgg 229
           |||||||| | ||| || ||||||||||||||||||||||| ||||| ||||||||||||
Sbjct: 50  ccgcggatcctgcgagccagctggatgtccttgggcatgatggtgacacgcttggcgtgg 109

                                                                       
Query: 230 atggcgcagaggttggtgtcctcgaagagcccgacgaggtacgcctcggcggcctcctgg 289
           |||||||| |||||||||||||||||||| ||||||||||| ||||||  ||||||||||
Sbjct: 110 atggcgcacaggttggtgtcctcgaagagaccgacgaggtaagcctcgctggcctcctgg 169

                                                                       
Query: 290 agcgcggagacggcggaggactggaagcggaggtcggtcttgaagtcctgcgcgatctcc 349
           || ||    |||||||||  ||||||||| |||||||||||||||||||| |||||||| 
Sbjct: 170 agagccataacggcggagctctggaagcgcaggtcggtcttgaagtcctgagcgatctca 229

                                                                   
Query: 350 cggacgaggcgctgaaaggggagcttgcggatgagcagctccgtgctcttctggta 405
           ||||| || ||||| ||||| ||||||||||| || ||||| ||||||||||||||
Sbjct: 230 cggaccagacgctggaagggcagcttgcggatcagaagctcagtgctcttctggta 285



to top

>gb|DQ393934.1| Cydia pomonella clone Cp4.100 microsatellite sequence
          Length = 490

 Score =  246 bits (124), Expect = 5e-62
 Identities = 208/236 (88%)
 Strand = Plus / Plus

                                                                       
Query: 170 ccgcggatgcggcgggcgagctggatgtccttgggcatgattgtgacgcgcttggcgtgg 229
           |||||||| | ||| || ||||||||||||||||||||||| ||||| ||||||||||||
Sbjct: 103 ccgcggatcctgcgagccagctggatgtccttgggcatgatggtgacacgcttggcgtgg 162

                                                                       
Query: 230 atggcgcagaggttggtgtcctcgaagagcccgacgaggtacgcctcggcggcctcctgg 289
           |||||||| |||||||||||||||||||| ||||||||||| ||||||  ||||||||||
Sbjct: 163 atggcgcacaggttggtgtcctcgaagagaccgacgaggtaagcctcgctggcctcctgg 222

                                                                       
Query: 290 agcgcggagacggcggaggactggaagcggaggtcggtcttgaagtcctgcgcgatctcc 349
           || ||    |||||||||  ||||||||| |||||||||||||||||||| |||||||| 
Sbjct: 223 agagccataacggcggagctctggaagcgcaggtcggtcttgaagtcctgagcgatctca 282

                                                                   
Query: 350 cggacgaggcgctgaaaggggagcttgcggatgagcagctccgtgctcttctggta 405
           ||||| || ||||| ||||| ||||||||||| || ||||| ||||||||||||||
Sbjct: 283 cggaccagacgctggaagggcagcttgcggatcagaagctcagtgctcttctggta 338



to top

>ref|XM_782287.1| PREDICTED: Strongylocentrotus purpuratus similar to CG31613-PA
           (LOC582332), mRNA
          Length = 411

 Score =  242 bits (122), Expect = 8e-61
 Identities = 212/242 (87%)
 Strand = Plus / Minus

                                                                       
Query: 164 cgctccccgcggatgcggcgggcgagctggatgtccttgggcatgattgtgacgcgcttg 223
           ||||| || ||||| |||||||| ||||||||||||||||||||||| ||||| ||||||
Sbjct: 404 cgctcgccacggatacggcgggccagctggatgtccttgggcatgatggtgacacgcttg 345

                                                                       
Query: 224 gcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtacgcctcggcggcc 283
           |||||||||||||| |||||||||||||||||||| ||||| | ||| ||||||  ||||
Sbjct: 344 gcgtggatggcgcacaggttggtgtcctcgaagagaccgaccaagtatgcctcgctggcc 285

                                                                       
Query: 284 tcctggagcgcggagacggcggaggactggaagcggaggtcggtcttgaagtcctgcgcg 343
           ||||| || ||   ||| ||||||  |||||| ||||| ||||||||||||||||| |||
Sbjct: 284 tcctgaagagccatgactgcggagctctggaatcggagctcggtcttgaagtcctgagcg 225

                                                                       
Query: 344 atctcccggacgaggcgctgaaaggggagcttgcggatgagcagctccgtgctcttctgg 403
           ||||| ||||| || ||||| |||||||||||||||||||| ||||| ||||||||||||
Sbjct: 224 atctcacggaccagacgctggaaggggagcttgcggatgagaagctcggtgctcttctgg 165

             
Query: 404 ta 405
           ||
Sbjct: 164 ta 163



to top

>ref|XM_780065.1| PREDICTED: Strongylocentrotus purpuratus similar to CG31613-PA
           (LOC579977), mRNA
          Length = 411

 Score =  242 bits (122), Expect = 8e-61
 Identities = 212/242 (87%)
 Strand = Plus / Minus

                                                                       
Query: 164 cgctccccgcggatgcggcgggcgagctggatgtccttgggcatgattgtgacgcgcttg 223
           ||||| || |||||||| ||||| ||||||||||||||||||||||| ||||| ||||||
Sbjct: 404 cgctcgccacggatgcgacgggcaagctggatgtccttgggcatgatggtgacacgcttg 345

                                                                       
Query: 224 gcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtacgcctcggcggcc 283
           |||||||||||||| |||||||||||||||||||| ||||| | ||| || |||  ||||
Sbjct: 344 gcgtggatggcgcacaggttggtgtcctcgaagagaccgaccaagtatgcttcgctggcc 285

                                                                       
Query: 284 tcctggagcgcggagacggcggaggactggaagcggaggtcggtcttgaagtcctgcgcg 343
           ||||| || ||   ||| ||||||  |||||| ||||| ||||||||||||||||| |||
Sbjct: 284 tcctgaagagccatgactgcggagctctggaatcggagctcggtcttgaagtcctgagcg 225

                                                                       
Query: 344 atctcccggacgaggcgctgaaaggggagcttgcggatgagcagctccgtgctcttctgg 403
           ||||| ||||| || ||||| |||||||||||||||||||||||||| ||||||||||||
Sbjct: 224 atctcacggaccagacgctggaaggggagcttgcggatgagcagctcggtgctcttctgg 165

             
Query: 404 ta 405
           ||
Sbjct: 164 ta 163



to top

>gb|AY125232.1| Pterophylla camellifolia histone 3 gene, partial cds
          Length = 372

 Score =  240 bits (121), Expect = 3e-60
 Identities = 187/209 (89%)
 Strand = Plus / Minus

                                                                       
Query: 197 tccttgggcatgattgtgacgcgcttggcgtggatggcgcagaggttggtgtcctcgaag 256
           |||||||||||||| |||||||||||||||||||||||||| ||||||||||| ||||||
Sbjct: 368 tccttgggcatgatggtgacgcgcttggcgtggatggcgcacaggttggtgtcttcgaag 309

                                                                       
Query: 257 agcccgacgaggtacgcctcggcggcctcctggagcgcggagacggcggaggactggaag 316
           || ||||| ||||| ||||||  ||||||||| |||||   ||||||||||  |||||| 
Sbjct: 308 aggccgacaaggtaggcctcgctggcctcctgcagcgccatgacggcggagctctggaac 249

                                                                       
Query: 317 cggaggtcggtcttgaagtcctgcgcgatctcccggacgaggcgctgaaaggggagcttg 376
           |||||||| ||||||||||||||||| ||||| || || |||||||| ||||| ||||||
Sbjct: 248 cggaggtccgtcttgaagtcctgcgctatctcgcgcaccaggcgctggaagggcagcttg 189

                                        
Query: 377 cggatgagcagctccgtgctcttctggta 405
           |||||||||||||||||||||||||||||
Sbjct: 188 cggatgagcagctccgtgctcttctggta 160



to top

>ref|XM_599846.2| PREDICTED: Bos taurus similar to histone 1, H2ai (predicted)
           (LOC521581), mRNA
          Length = 411

 Score =  238 bits (120), Expect = 1e-59
 Identities = 210/240 (87%)
 Strand = Plus / Minus

                                                                       
Query: 166 ctccccgcggatgcggcgggcgagctggatgtccttgggcatgattgtgacgcgcttggc 225
           ||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||||||
Sbjct: 402 ctccccgcggatgcggcgggcaagctggatgtccttgggcatgatggtgacgcgcttggc 343

                                                                       
Query: 226 gtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtacgcctcggcggcctc 285
           ||||||||| || ||||||||||||||||||||||| || ||||| ||||||   |||||
Sbjct: 342 gtggatggcacaaaggttggtgtcctcgaagagccccaccaggtaggcctcgcacgcctc 283

                                                                       
Query: 286 ctggagcgcggagacggcggaggactggaagcggaggtcggtcttgaagtcctgcgcgat 345
           ||| |||||    || || |||  ||||||||| ||||||||||||||||||||||||||
Sbjct: 282 ctgcagcgccatcaccgccgagctctggaagcgcaggtcggtcttgaagtcctgcgcgat 223

                                                                       
Query: 346 ctcccggacgaggcgctgaaaggggagcttgcggatgagcagctccgtgctcttctggta 405
           ||| || || || ||||| || || ||||||||||| ||||||||||||  |||||||||
Sbjct: 222 ctcgcgcaccagccgctggaacggcagcttgcggatcagcagctccgtggacttctggta 163



to top

>ref|XM_848995.1| PREDICTED: Canis familiaris similar to histone 1, H2ai (predicted)
           (LOC611340), mRNA
          Length = 573

 Score =  238 bits (120), Expect = 1e-59
 Identities = 192/216 (88%)
 Strand = Plus / Minus

                                                                       
Query: 190 ctggatgtccttgggcatgattgtgacgcgcttggcgtggatggcgcagaggttggtgtc 249
           ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||
Sbjct: 450 ctggatgtccttgggcatgatggtgacgcgcttggcgtggatggcgcagaggttggtgtc 391

                                                                       
Query: 250 ctcgaagagcccgacgaggtacgcctcggcggcctcctggagcgcggagacggcggagga 309
           |||||||||||| || ||||| ||||||   |||||||| |||||   |||||| |||  
Sbjct: 390 ctcgaagagccccaccaggtaggcctcgcacgcctcctgcagcgccatgacggccgagct 331

                                                                       
Query: 310 ctggaagcggaggtcggtcttgaagtcctgcgcgatctcccggacgaggcgctgaaaggg 369
           ||||||||| ||||||||||||||||||||||||||||| || || |||||||| || ||
Sbjct: 330 ctggaagcgcaggtcggtcttgaagtcctgcgcgatctcgcgcaccaggcgctggaacgg 271

                                               
Query: 370 gagcttgcggatgagcagctccgtgctcttctggta 405
            ||||||||||| ||||||||||||  |||||||||
Sbjct: 270 cagcttgcggatcagcagctccgtggacttctggta 235



to top

>gb|DQ393931.1| Cydia pomonella clone Cp4.61 microsatellite sequence
          Length = 517

 Score =  238 bits (120), Expect = 1e-59
 Identities = 207/236 (87%)
 Strand = Plus / Minus

                                                                       
Query: 170 ccgcggatgcggcgggcgagctggatgtccttgggcatgattgtgacgcgcttggcgtgg 229
           |||||||| | ||| || ||||||||||||||||||||||| ||||| ||||||||||||
Sbjct: 388 ccgcggatcctgcgagccagctggatgtccttgggcatgatggtgacacgcttggcgtgg 329

                                                                       
Query: 230 atggcgcagaggttggtgtcctcgaagagcccgacgaggtacgcctcggcggcctcctgg 289
           |||||||| |||||||||||||||||| | ||||||||||| ||||||  ||||||||||
Sbjct: 328 atggcgcacaggttggtgtcctcgaagggaccgacgaggtaagcctcgctggcctcctgg 269

                                                                       
Query: 290 agcgcggagacggcggaggactggaagcggaggtcggtcttgaagtcctgcgcgatctcc 349
           || ||    |||||||||  ||||||||| |||||||||||||||||||| |||||||| 
Sbjct: 268 agagccataacggcggagctctggaagcgcaggtcggtcttgaagtcctgagcgatctca 209

                                                                   
Query: 350 cggacgaggcgctgaaaggggagcttgcggatgagcagctccgtgctcttctggta 405
           ||||| || ||||| ||||| ||||||||||| || ||||| ||||||||||||||
Sbjct: 208 cggaccagacgctggaagggcagcttgcggatcagaagctcagtgctcttctggta 153



to top

>gb|AF517884.1| Griffithsia japonica isolate Gj475 histone H3.3 protein mRNA,
           complete cds
          Length = 610

 Score =  234 bits (118), Expect = 2e-58
 Identities = 227/261 (86%), Gaps = 3/261 (1%)
 Strand = Plus / Minus

                                                                       
Query: 157 ctaggcgcgctccccgcggatgcggcgggcgagctggatgtccttgggcatgattgtgac 216
           |||||| || || ||||| || ||||| |||||||| ||||||||||||||||| |||||
Sbjct: 512 ctaggcacgttcgccgcgaatacggcgtgcgagctgaatgtccttgggcatgatggtgac 453

                                                                       
Query: 217 gcgcttggcgtggatggcgcagaggttggtgtcctcgaagag--cccgacga-ggtacgc 273
           ||||||||||||||||||||| | ||||||||||||||| ||  ||| |||| |||| ||
Sbjct: 452 gcgcttggcgtggatggcgcacaagttggtgtcctcgaacagtcccccacgaaggtaggc 393

                                                                       
Query: 274 ctcggcggcctcctggagcgcggagacggcggaggactggaagcggaggtcggtcttgaa 333
           |||||||||||| || ||||||   ||||| |||  ||||||||| ||||||| ||||||
Sbjct: 392 ctcggcggcctcttgcagcgcgagcacggccgagctctggaagcgcaggtcggacttgaa 333

                                                                       
Query: 334 gtcctgcgcgatctcccggacgaggcgctgaaaggggagcttgcggatgagcagctccgt 393
           |||||| |||||||| |||||||||||||| || || |||||||||||||| || |||||
Sbjct: 332 gtcctgggcgatctcacggacgaggcgctggaacggaagcttgcggatgaggaggtccgt 273

                                
Query: 394 gctcttctggtacttgcggat 414
           |||||||||| ||||||||||
Sbjct: 272 gctcttctggaacttgcggat 252



to top

>gb|AY749705.1| Choroterpes sp. EP024 histone H3 (H3) gene, partial cds
          Length = 375

 Score =  232 bits (117), Expect = 7e-58
 Identities = 186/209 (88%)
 Strand = Plus / Minus

                                                                       
Query: 197 tccttgggcatgattgtgacgcgcttggcgtggatggcgcagaggttggtgtcctcgaag 256
           |||||||||||||| |||||||||||||||||||||||||| | |||||||||||| |||
Sbjct: 371 tccttgggcatgatggtgacgcgcttggcgtggatggcgcacaagttggtgtcctcaaag 312

                                                                       
Query: 257 agcccgacgaggtacgcctcggcggcctcctggagcgcggagacggcggaggactggaag 316
           || ||||||||||| ||||||  |||||||||||| ||   ||| || |||  |||||||
Sbjct: 311 agaccgacgaggtaggcctcgctggcctcctggagggccatgactgccgagctctggaag 252

                                                                       
Query: 317 cggaggtcggtcttgaagtcctgcgcgatctcccggacgaggcgctgaaaggggagcttg 376
           ||||||||||||||||||||||||||||| || || || |||||||| ||||| ||||||
Sbjct: 251 cggaggtcggtcttgaagtcctgcgcgatttcacgcaccaggcgctggaagggcagcttg 192

                                        
Query: 377 cggatgagcagctccgtgctcttctggta 405
           |||||||||||||| ||||||||||||||
Sbjct: 191 cggatgagcagctcagtgctcttctggta 163



to top

>gb|AY749702.1| Thraulodes sp. EP014 histone H3 (H3) gene, partial cds
          Length = 375

 Score =  232 bits (117), Expect = 7e-58
 Identities = 186/209 (88%)
 Strand = Plus / Minus

                                                                       
Query: 197 tccttgggcatgattgtgacgcgcttggcgtggatggcgcagaggttggtgtcctcgaag 256
           |||||||||||||| |||||||||||||||||||||||||| ||||||||||||||||||
Sbjct: 371 tccttgggcatgatggtgacgcgcttggcgtggatggcgcacaggttggtgtcctcgaag 312

                                                                       
Query: 257 agcccgacgaggtacgcctcggcggcctcctggagcgcggagacggcggaggactggaag 316
           || ||||| ||||| ||||||  ||||||||| || ||   |||||| |||  |||||| 
Sbjct: 311 aggccgaccaggtaagcctcgctggcctcctgcagggccatgacggccgagctctggaaa 252

                                                                       
Query: 317 cggaggtcggtcttgaagtcctgcgcgatctcccggacgaggcgctgaaaggggagcttg 376
           || |||||||||||||||||||| ||||| || || ||||||||||| ||||||||||||
Sbjct: 251 cgcaggtcggtcttgaagtcctgggcgatttcacgcacgaggcgctggaaggggagcttg 192

                                        
Query: 377 cggatgagcagctccgtgctcttctggta 405
           |||||||||||||| ||||||||||||||
Sbjct: 191 cggatgagcagctcagtgctcttctggta 163



to top

>gb|AY521721.1| Gryllotalpidae sp. BYU_ACOR020 histone H3 (H3) gene, partial cds
          Length = 354

 Score =  230 bits (116), Expect = 3e-57
 Identities = 182/204 (89%)
 Strand = Plus / Minus

                                                                       
Query: 202 gggcatgattgtgacgcgcttggcgtggatggcgcagaggttggtgtcctcgaagagccc 261
           ||||||||| |||||||||||||||||||||||||| ||||||||||| |||||||| ||
Sbjct: 354 gggcatgatggtgacgcgcttggcgtggatggcgcacaggttggtgtcttcgaagaggcc 295

                                                                       
Query: 262 gacgaggtacgcctcggcggcctcctggagcgcggagacggcggaggactggaagcggag 321
           ||| ||||| ||||||  ||||||||| |||||   ||||||||||  |||||| |||||
Sbjct: 294 gacaaggtaggcctcgctggcctcctgcagcgccatgacggcggagctctggaaccggag 235

                                                                       
Query: 322 gtcggtcttgaagtcctgcgcgatctcccggacgaggcgctgaaaggggagcttgcggat 381
           ||| ||||||||||||||||| ||||| || || |||||||| ||||| |||||||||||
Sbjct: 234 gtccgtcttgaagtcctgcgctatctcgcgcaccaggcgctggaagggcagcttgcggat 175

                                   
Query: 382 gagcagctccgtgctcttctggta 405
           ||||||||||||||||||||||||
Sbjct: 174 gagcagctccgtgctcttctggta 151



to top

>gb|AY521718.1| Romalea sp. BYU_ACOR015 histone H3 (H3) gene, partial cds
          Length = 354

 Score =  230 bits (116), Expect = 3e-57
 Identities = 182/204 (89%)
 Strand = Plus / Minus

                                                                       
Query: 202 gggcatgattgtgacgcgcttggcgtggatggcgcagaggttggtgtcctcgaagagccc 261
           ||||||||| |||||||||||||||||||||||||| |||||||||||||||||||| ||
Sbjct: 354 gggcatgatggtgacgcgcttggcgtggatggcgcacaggttggtgtcctcgaagaggcc 295

                                                                       
Query: 262 gacgaggtacgcctcggcggcctcctggagcgcggagacggcggaggactggaagcggag 321
           ||||||||||||||||  ||||||||| || ||   ||| || |||  ||||||||| ||
Sbjct: 294 gacgaggtacgcctcgctggcctcctgcagggccatgaccgccgagctctggaagcgcag 235

                                                                       
Query: 322 gtcggtcttgaagtcctgcgcgatctcccggacgaggcgctgaaaggggagcttgcggat 381
           ||||||||||||||||||||||||||| || ||||||||||| ||||| |||||||||||
Sbjct: 234 gtcggtcttgaagtcctgcgcgatctcgcgcacgaggcgctggaagggcagcttgcggat 175

                                   
Query: 382 gagcagctccgtgctcttctggta 405
           |||||| || |||||||| |||||
Sbjct: 174 gagcagttcggtgctcttttggta 151



to top

>ref|NM_178216.1| Mus musculus histone 2, H3c1 (Hist2h3c1), transcript variant 2,
           mRNA
          Length = 546

 Score =  226 bits (114), Expect = 5e-56
 Identities = 201/230 (87%)
 Strand = Plus / Minus

                                                                       
Query: 161 gcgcgctccccgcggatgcggcgggcgagctggatgtccttgggcatgattgtgacgcgc 220
           ||||||||||| |||||||||||||| | ||||||||||||||||||||| |||||||| 
Sbjct: 542 gcgcgctccccacggatgcggcgggccaactggatgtccttgggcatgatggtgacgcgt 483

                                                                       
Query: 221 ttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtacgcctcggcg 280
           ||||||||||||||||| ||||||||||||||||| ||||| || ||||| ||||||   
Sbjct: 482 ttggcgtggatggcgcacaggttggtgtcctcgaacagccccaccaggtaggcctcgctc 423

                                                                       
Query: 281 gcctcctggagcgcggagacggcggaggactggaagcggaggtcggtcttgaagtcctgc 340
           |||||||| |||||   |||||| |||  ||||||||| ||||| |||||||||||||||
Sbjct: 422 gcctcctgcagcgccatgacggccgagctctggaagcgcaggtccgtcttgaagtcctgc 363

                                                             
Query: 341 gcgatctcccggacgaggcgctgaaaggggagcttgcggatgagcagctc 390
           |||||||| || || |||||||| || || ||||||||||| ||||||||
Sbjct: 362 gcgatctcgcgcaccaggcgctggaacggcagcttgcggatcagcagctc 313



to top

>gb|BC080809.1| Mus musculus cDNA clone IMAGE:6466339
          Length = 2972

 Score =  226 bits (114), Expect = 5e-56
 Identities = 201/230 (87%)
 Strand = Plus / Minus

                                                                        
Query: 161  gcgcgctccccgcggatgcggcgggcgagctggatgtccttgggcatgattgtgacgcgc 220
            ||||||||||| |||||||||||||| | ||||||||||||||||||||| |||||||| 
Sbjct: 1739 gcgcgctccccacggatgcggcgggccaactggatgtccttgggcatgatggtgacgcgt 1680

                                                                        
Query: 221  ttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtacgcctcggcg 280
            ||||||||||||||||| ||||||||||||||||| ||||| || ||||| ||||||   
Sbjct: 1679 ttggcgtggatggcgcacaggttggtgtcctcgaacagccccaccaggtaggcctcgctc 1620

                                                                        
Query: 281  gcctcctggagcgcggagacggcggaggactggaagcggaggtcggtcttgaagtcctgc 340
            |||||||| |||||   |||||| |||  ||||||||| ||||| |||||||||||||||
Sbjct: 1619 gcctcctgcagcgccatgacggccgagctctggaagcgcaggtccgtcttgaagtcctgc 1560

                                                              
Query: 341  gcgatctcccggacgaggcgctgaaaggggagcttgcggatgagcagctc 390
            |||||||| || || |||||||| || || ||||||||||| ||||||||
Sbjct: 1559 gcgatctcgcgcaccaggcgctggaacggcagcttgcggatcagcagctc 1510



to top

>ref|XM_886396.1| PREDICTED: Mus musculus histone 2, H3c1 (Hist2h3c1), mRNA
          Length = 2956

 Score =  226 bits (114), Expect = 5e-56
 Identities = 201/230 (87%)
 Strand = Plus / Minus

                                                                        
Query: 161  gcgcgctccccgcggatgcggcgggcgagctggatgtccttgggcatgattgtgacgcgc 220
            ||||||||||| |||||||||||||| | ||||||||||||||||||||| |||||||| 
Sbjct: 1739 gcgcgctccccacggatgcggcgggccaactggatgtccttgggcatgatggtgacgcgt 1680

                                                                        
Query: 221  ttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtacgcctcggcg 280
            ||||||||||||||||| ||||||||||||||||| ||||| || ||||| ||||||   
Sbjct: 1679 ttggcgtggatggcgcacaggttggtgtcctcgaacagccccaccaggtaggcctcgctc 1620

                                                                        
Query: 281  gcctcctggagcgcggagacggcggaggactggaagcggaggtcggtcttgaagtcctgc 340
            |||||||| |||||   |||||| |||  ||||||||| ||||| |||||||||||||||
Sbjct: 1619 gcctcctgcagcgccatgacggccgagctctggaagcgcaggtccgtcttgaagtcctgc 1560

                                                              
Query: 341  gcgatctcccggacgaggcgctgaaaggggagcttgcggatgagcagctc 390
            |||||||| || || |||||||| || || ||||||||||| ||||||||
Sbjct: 1559 gcgatctcgcgcaccaggcgctggaacggcagcttgcggatcagcagctc 1510



to top

>emb|X80330.1|CLH2A232 C.longicaudatus genes for histones H2a.2 and H3.2
          Length = 2927

 Score =  226 bits (114), Expect = 5e-56
 Identities = 201/230 (87%)
 Strand = Plus / Minus

                                                                        
Query: 161  gcgcgctccccgcggatgcggcgggcgagctggatgtccttgggcatgattgtgacgcgc 220
            |||||||||||||||||||| ||||| | ||||||||||||||||||||| |||||||||
Sbjct: 2762 gcgcgctccccgcggatgcgacgggccaactggatgtccttgggcatgatggtgacgcgc 2703

                                                                        
Query: 221  ttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtacgcctcggcg 280
            ||||||||||||||||| ||||||||||||||||| || || || ||||| ||||||   
Sbjct: 2702 ttggcgtggatggcgcacaggttggtgtcctcgaacagacccaccaggtaggcctcgctc 2643

                                                                        
Query: 281  gcctcctggagcgcggagacggcggaggactggaagcggaggtcggtcttgaagtcctgc 340
            |||||||| |||||   |||||| |||  ||||||||| ||||| |||||||||||||||
Sbjct: 2642 gcctcctgcagcgccatgacggccgagctctggaagcgcaggtccgtcttgaagtcctgc 2583

                                                              
Query: 341  gcgatctcccggacgaggcgctgaaaggggagcttgcggatgagcagctc 390
            |||||||| || || |||||||| || || ||||||||||| ||||||||
Sbjct: 2582 gcgatctcgcgcaccaggcgctggaacggcagcttgcggatcagcagctc 2533



to top

>dbj|AK134918.1| Mus musculus adult male olfactory brain cDNA, RIKEN full-length
            enriched library, clone:6430517B15
            product:unclassifiable, full insert sequence
          Length = 3217

 Score =  226 bits (114), Expect = 5e-56
 Identities = 201/230 (87%)
 Strand = Plus / Plus

                                                                        
Query: 161  gcgcgctccccgcggatgcggcgggcgagctggatgtccttgggcatgattgtgacgcgc 220
            ||||||||||| |||||||||||||| | ||||||||||||||||||||| |||||||| 
Sbjct: 1191 gcgcgctccccacggatgcggcgggccaactggatgtccttgggcatgatggtgacgcgt 1250

                                                                        
Query: 221  ttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtacgcctcggcg 280
            ||||||||||||||||| ||||||||||||||||| ||||| || ||||| ||||||   
Sbjct: 1251 ttggcgtggatggcgcacaggttggtgtcctcgaacagccccaccaggtaggcctcgctc 1310

                                                                        
Query: 281  gcctcctggagcgcggagacggcggaggactggaagcggaggtcggtcttgaagtcctgc 340
            |||||||| |||||   |||||| |||  ||||||||| ||||| |||||||||||||||
Sbjct: 1311 gcctcctgcagcgccatgacggccgagctctggaagcgcaggtccgtcttgaagtcctgc 1370

                                                              
Query: 341  gcgatctcccggacgaggcgctgaaaggggagcttgcggatgagcagctc 390
            |||||||| || || |||||||| || || ||||||||||| ||||||||
Sbjct: 1371 gcgatctcgcgcaccaggcgctggaacggcagcttgcggatcagcagctc 1420



to top

>gb|U62675.1|MMU62675 Mus musculus histone H3.2-616 (H3-616), and histone H2b-616
           (H2b-616) genes, complete cds
          Length = 2371

 Score =  226 bits (114), Expect = 5e-56
 Identities = 201/230 (87%)
 Strand = Plus / Minus

                                                                       
Query: 161 gcgcgctccccgcggatgcggcgggcgagctggatgtccttgggcatgattgtgacgcgc 220
           ||||||||||| |||||||||||||| | ||||||||||||||||||||| |||||||| 
Sbjct: 987 gcgcgctccccacggatgcggcgggccaactggatgtccttgggcatgatggtgacgcgt 928

                                                                       
Query: 221 ttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtacgcctcggcg 280
           ||||||||||||||||| ||||||||||||||||| ||||| || ||||| ||||||   
Sbjct: 927 ttggcgtggatggcgcacaggttggtgtcctcgaacagccccaccaggtaggcctcgctc 868

                                                                       
Query: 281 gcctcctggagcgcggagacggcggaggactggaagcggaggtcggtcttgaagtcctgc 340
           |||||||| |||||   |||||| |||  ||||||||| ||||| |||||||||||||||
Sbjct: 867 gcctcctgcagcgccatgacggccgagctctggaagcgcaggtccgtcttgaagtcctgc 808

                                                             
Query: 341 gcgatctcccggacgaggcgctgaaaggggagcttgcggatgagcagctc 390
           |||||||| || || |||||||| || || ||||||||||| ||||||||
Sbjct: 807 gcgatctcgcgcaccaggcgctggaacggcagcttgcggatcagcagctc 758



to top

>gb|U62674.1|MMU62674 Mus musculus histone H2a.2-615 (H2a-615),  and histone H3.2-615
            (H3-615) genes, complete cds
          Length = 2997

 Score =  226 bits (114), Expect = 5e-56
 Identities = 201/230 (87%)
 Strand = Plus / Minus

                                                                        
Query: 161  gcgcgctccccgcggatgcggcgggcgagctggatgtccttgggcatgattgtgacgcgc 220
            ||||||||||| |||||||||||||| | ||||||||||||||||||||| |||||||| 
Sbjct: 2722 gcgcgctccccacggatgcggcgggccaactggatgtccttgggcatgatggtgacgcgt 2663

                                                                        
Query: 221  ttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtacgcctcggcg 280
            ||||||||||||||||| ||||||||||||||||| ||||| || ||||| ||||||   
Sbjct: 2662 ttggcgtggatggcgcacaggttggtgtcctcgaacagccccaccaggtaggcctcgctc 2603

                                                                        
Query: 281  gcctcctggagcgcggagacggcggaggactggaagcggaggtcggtcttgaagtcctgc 340
            |||||||| |||||   |||||| |||  ||||||||| ||||| |||||||||||||||
Sbjct: 2602 gcctcctgcagcgccatgacggccgagctctggaagcgcaggtccgtcttgaagtcctgc 2543

                                                              
Query: 341  gcgatctcccggacgaggcgctgaaaggggagcttgcggatgagcagctc 390
            |||||||| || || |||||||| || || ||||||||||| ||||||||
Sbjct: 2542 gcgatctcgcgcaccaggcgctggaacggcagcttgcggatcagcagctc 2493



to top

>ref|NG_002616.1| Homo sapiens histone 2, H3b (HIST2H3B) pseudogene on chromosome 1
          Length = 1411

 Score =  226 bits (114), Expect = 5e-56
 Identities = 201/230 (87%)
 Strand = Plus / Minus

                                                                       
Query: 161 gcgcgctccccgcggatgcggcgggcgagctggatgtccttgggcatgattgtgacgcgc 220
           ||||||||||| |||||||||||||| | ||||||||||||||||||||| |||||||| 
Sbjct: 907 gcgcgctccccacggatgcggcgggccaactggatgtccttgggcatgatggtgacgcgt 848

                                                                       
Query: 221 ttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtacgcctcggcg 280
           ||||||||||||||||| ||||||||||||||||| ||||| || ||||| ||||||   
Sbjct: 847 ttggcgtggatggcgcacaggttggtgtcctcgaacagccccaccaggtaggcctcgctc 788

                                                                       
Query: 281 gcctcctggagcgcggagacggcggaggactggaagcggaggtcggtcttgaagtcctgc 340
           |||||||| |||||   |||||| |||  ||||||||| ||||| |||||||||||||||
Sbjct: 787 gcctcctgcagcgccatgacggccgagctctggaagcgcaggtccgtcttgaagtcctgc 728

                                                             
Query: 341 gcgatctcccggacgaggcgctgaaaggggagcttgcggatgagcagctc 390
           |||||||| || || |||||||| || || ||||||||||| ||||||||
Sbjct: 727 gcgatctcgcgcaccaggcgctggaacggcagcttgcggatcagcagctc 678



to top

>gb|BC094041.1| Mus musculus histone 2, H3c1, mRNA (cDNA clone MGC:102454
           IMAGE:5099464), complete cds
          Length = 1831

 Score =  226 bits (114), Expect = 5e-56
 Identities = 201/230 (87%)
 Strand = Plus / Minus

                                                                       
Query: 161 gcgcgctccccgcggatgcggcgggcgagctggatgtccttgggcatgattgtgacgcgc 220
           ||||||||||| |||||||||||||| | ||||||||||||||||||||| |||||||| 
Sbjct: 608 gcgcgctccccacggatgcggcgggccaactggatgtccttgggcatgatggtgacgcgt 549

                                                                       
Query: 221 ttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtacgcctcggcg 280
           ||||||||||||||||| ||||||||||||||||| ||||| || ||||| ||||||   
Sbjct: 548 ttggcgtggatggcgcacaggttggtgtcctcgaacagccccaccaggtaggcctcgctc 489

                                                                       
Query: 281 gcctcctggagcgcggagacggcggaggactggaagcggaggtcggtcttgaagtcctgc 340
           |||||||| |||||   |||||| |||  ||||||||| ||||| |||||||||||||||
Sbjct: 488 gcctcctgcagcgccatgacggccgagctctggaagcgcaggtccgtcttgaagtcctgc 429

                                                             
Query: 341 gcgatctcccggacgaggcgctgaaaggggagcttgcggatgagcagctc 390
           |||||||| || || |||||||| || || ||||||||||| ||||||||
Sbjct: 428 gcgatctcgcgcaccaggcgctggaacggcagcttgcggatcagcagctc 379



to top

>gb|AF531306.1| Homo sapiens histone H3 (HIST2H3B) pseudogene, complete sequence
          Length = 1411

 Score =  226 bits (114), Expect = 5e-56
 Identities = 201/230 (87%)
 Strand = Plus / Minus

                                                                       
Query: 161 gcgcgctccccgcggatgcggcgggcgagctggatgtccttgggcatgattgtgacgcgc 220
           ||||||||||| |||||||||||||| | ||||||||||||||||||||| |||||||| 
Sbjct: 907 gcgcgctccccacggatgcggcgggccaactggatgtccttgggcatgatggtgacgcgt 848

                                                                       
Query: 221 ttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtacgcctcggcg 280
           ||||||||||||||||| ||||||||||||||||| ||||| || ||||| ||||||   
Sbjct: 847 ttggcgtggatggcgcacaggttggtgtcctcgaacagccccaccaggtaggcctcgctc 788

                                                                       
Query: 281 gcctcctggagcgcggagacggcggaggactggaagcggaggtcggtcttgaagtcctgc 340
           |||||||| |||||   |||||| |||  ||||||||| ||||| |||||||||||||||
Sbjct: 787 gcctcctgcagcgccatgacggccgagctctggaagcgcaggtccgtcttgaagtcctgc 728

                                                             
Query: 341 gcgatctcccggacgaggcgctgaaaggggagcttgcggatgagcagctc 390
           |||||||| || || |||||||| || || ||||||||||| ||||||||
Sbjct: 727 gcgatctcgcgcaccaggcgctggaacggcagcttgcggatcagcagctc 678



to top

>ref|XM_227461.2| PREDICTED: Rattus norvegicus similar to histone protein Hist2h3c1
           (LOC310679), mRNA
          Length = 573

 Score =  226 bits (114), Expect = 5e-56
 Identities = 201/230 (87%)
 Strand = Plus / Minus

                                                                       
Query: 161 gcgcgctccccgcggatgcggcgggcgagctggatgtccttgggcatgattgtgacgcgc 220
           |||||||||||||||||||| ||||| | ||||||||||||||||||||| |||||||||
Sbjct: 569 gcgcgctccccgcggatgcgacgggccaactggatgtccttgggcatgatggtgacgcgc 510

                                                                       
Query: 221 ttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtacgcctcggcg 280
           ||||||||||||||||| ||||||||||||||||| || || || ||||| ||||||   
Sbjct: 509 ttggcgtggatggcgcacaggttggtgtcctcgaacagacccaccaggtaggcctcgctc 450

                                                                       
Query: 281 gcctcctggagcgcggagacggcggaggactggaagcggaggtcggtcttgaagtcctgc 340
           |||||||| |||||   |||||| |||  ||||||||| ||||| |||||||||||||||
Sbjct: 449 gcctcctgcagcgccatgacggccgagctctggaagcgcaggtccgtcttgaagtcctgc 390

                                                             
Query: 341 gcgatctcccggacgaggcgctgaaaggggagcttgcggatgagcagctc 390
           |||||||| || || |||||||| || || ||||||||||| ||||||||
Sbjct: 389 gcgatctcgcgcaccaggcgctggaacggcagcttgcggatcagcagctc 340



to top

>gb|AY158955.1| Mus musculus histone protein Hist2h3b gene, complete cds
          Length = 1411

 Score =  226 bits (114), Expect = 5e-56
 Identities = 201/230 (87%)
 Strand = Plus / Minus

                                                                       
Query: 161 gcgcgctccccgcggatgcggcgggcgagctggatgtccttgggcatgattgtgacgcgc 220
           ||||||||||| |||||||||||||| | ||||||||||||||||||||| |||||||| 
Sbjct: 907 gcgcgctccccacggatgcggcgggccaactggatgtccttgggcatgatggtgacgcgt 848

                                                                       
Query: 221 ttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtacgcctcggcg 280
           ||||||||||||||||| ||||||||||||||||| ||||| || ||||| ||||||   
Sbjct: 847 ttggcgtggatggcgcacaggttggtgtcctcgaacagccccaccaggtaggcctcgctc 788

                                                                       
Query: 281 gcctcctggagcgcggagacggcggaggactggaagcggaggtcggtcttgaagtcctgc 340
           |||||||| |||||   |||||| |||  ||||||||| ||||| |||||||||||||||
Sbjct: 787 gcctcctgcagcgccatgacggccgagctctggaagcgcaggtccgtcttgaagtcctgc 728

                                                             
Query: 341 gcgatctcccggacgaggcgctgaaaggggagcttgcggatgagcagctc 390
           |||||||| || || |||||||| || || ||||||||||| ||||||||
Sbjct: 727 gcgatctcgcgcaccaggcgctggaacggcagcttgcggatcagcagctc 678



to top

>gb|AY158954.1| Mus musculus histone protein Hist2h3c1 gene, complete cds
          Length = 1675

 Score =  226 bits (114), Expect = 5e-56
 Identities = 201/230 (87%)
 Strand = Plus / Minus

                                                                        
Query: 161  gcgcgctccccgcggatgcggcgggcgagctggatgtccttgggcatgattgtgacgcgc 220
            ||||||||||| |||||||||||||| | ||||||||||||||||||||| |||||||| 
Sbjct: 1093 gcgcgctccccacggatgcggcgggccaactggatgtccttgggcatgatggtgacgcgt 1034

                                                                        
Query: 221  ttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtacgcctcggcg 280
            ||||||||||||||||| ||||||||||||||||| ||||| || ||||| ||||||   
Sbjct: 1033 ttggcgtggatggcgcacaggttggtgtcctcgaacagccccaccaggtaggcctcgctc 974

                                                                        
Query: 281  gcctcctggagcgcggagacggcggaggactggaagcggaggtcggtcttgaagtcctgc 340
            |||||||| |||||   |||||| |||  ||||||||| ||||| |||||||||||||||
Sbjct: 973  gcctcctgcagcgccatgacggccgagctctggaagcgcaggtccgtcttgaagtcctgc 914

                                                              
Query: 341  gcgatctcccggacgaggcgctgaaaggggagcttgcggatgagcagctc 390
            |||||||| || || |||||||| || || ||||||||||| ||||||||
Sbjct: 913  gcgatctcgcgcaccaggcgctggaacggcagcttgcggatcagcagctc 864



to top

>gb|AY158941.1| Mus musculus histone protein Hist2h2bb gene, complete cds
          Length = 1500

 Score =  226 bits (114), Expect = 5e-56
 Identities = 201/230 (87%)
 Strand = Plus / Plus

                                                                       
Query: 161 gcgcgctccccgcggatgcggcgggcgagctggatgtccttgggcatgattgtgacgcgc 220
           ||||||||||| |||||||||||||| | ||||||||||||||||||||| |||||||| 
Sbjct: 514 gcgcgctccccacggatgcggcgggccaactggatgtccttgggcatgatggtgacgcgt 573

                                                                       
Query: 221 ttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtacgcctcggcg 280
           ||||||||||||||||| ||||||||||||||||| ||||| || ||||| ||||||   
Sbjct: 574 ttggcgtggatggcgcacaggttggtgtcctcgaacagccccaccaggtaggcctcgctc 633

                                                                       
Query: 281 gcctcctggagcgcggagacggcggaggactggaagcggaggtcggtcttgaagtcctgc 340
           |||||||| |||||   |||||| |||  ||||||||| ||||| |||||||||||||||
Sbjct: 634 gcctcctgcagcgccatgacggccgagctctggaagcgcaggtccgtcttgaagtcctgc 693

                                                             
Query: 341 gcgatctcccggacgaggcgctgaaaggggagcttgcggatgagcagctc 390
           |||||||| || || |||||||| || || ||||||||||| ||||||||
Sbjct: 694 gcgatctcgcgcaccaggcgctggaacggcagcttgcggatcagcagctc 743



to top

>gb|AC093350.15| Mus musculus chromosome 3, clone RP23-16G3, complete sequence
          Length = 200326

 Score =  226 bits (114), Expect = 5e-56
 Identities = 201/230 (87%)
 Strand = Plus / Minus

                                                                         
Query: 161   gcgcgctccccgcggatgcggcgggcgagctggatgtccttgggcatgattgtgacgcgc 220
             ||||||||||| |||||||||||||| | ||||||||||||||||||||| |||||||| 
Sbjct: 93739 gcgcgctccccacggatgcggcgggccaactggatgtccttgggcatgatggtgacgcgt 93680

                                                                         
Query: 221   ttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtacgcctcggcg 280
             ||||||||||||||||| ||||||||||||||||| ||||| || ||||| ||||||   
Sbjct: 93679 ttggcgtggatggcgcacaggttggtgtcctcgaacagccccaccaggtaggcctcgctc 93620

                                                                         
Query: 281   gcctcctggagcgcggagacggcggaggactggaagcggaggtcggtcttgaagtcctgc 340
             |||||||| |||||   |||||| |||  ||||||||| ||||| |||||||||||||||
Sbjct: 93619 gcctcctgcagcgccatgacggccgagctctggaagcgcaggtccgtcttgaagtcctgc 93560

                                                               
Query: 341   gcgatctcccggacgaggcgctgaaaggggagcttgcggatgagcagctc 390
             |||||||| || || |||||||| || || ||||||||||| ||||||||
Sbjct: 93559 gcgatctcgcgcaccaggcgctggaacggcagcttgcggatcagcagctc 93510



 Score =  226 bits (114), Expect = 5e-56
 Identities = 201/230 (87%)
 Strand = Plus / Minus

                                                                         
Query: 161   gcgcgctccccgcggatgcggcgggcgagctggatgtccttgggcatgattgtgacgcgc 220
             ||||||||||| |||||||||||||| | ||||||||||||||||||||| |||||||| 
Sbjct: 71931 gcgcgctccccacggatgcggcgggccaactggatgtccttgggcatgatggtgacgcgt 71872

                                                                         
Query: 221   ttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtacgcctcggcg 280
             ||||||||||||||||| ||||||||||||||||| ||||| || ||||| ||||||   
Sbjct: 71871 ttggcgtggatggcgcacaggttggtgtcctcgaacagccccaccaggtaggcctcgctc 71812

                                                                         
Query: 281   gcctcctggagcgcggagacggcggaggactggaagcggaggtcggtcttgaagtcctgc 340
             |||||||| |||||   |||||| |||  ||||||||| ||||| |||||||||||||||
Sbjct: 71811 gcctcctgcagcgccatgacggccgagctctggaagcgcaggtccgtcttgaagtcctgc 71752

                                                               
Query: 341   gcgatctcccggacgaggcgctgaaaggggagcttgcggatgagcagctc 390
             |||||||| || || |||||||| || || ||||||||||| ||||||||
Sbjct: 71751 gcgatctcgcgcaccaggcgctggaacggcagcttgcggatcagcagctc 71702



 Score =  226 bits (114), Expect = 5e-56
 Identities = 201/230 (87%)
 Strand = Plus / Plus

                                                                         
Query: 161   gcgcgctccccgcggatgcggcgggcgagctggatgtccttgggcatgattgtgacgcgc 220
             ||||||||||| |||||||||||||| | ||||||||||||||||||||| |||||||| 
Sbjct: 63174 gcgcgctccccacggatgcggcgggccaactggatgtccttgggcatgatggtgacgcgt 63233

                                                                         
Query: 221   ttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtacgcctcggcg 280
             ||||||||||||||||| ||||||||||||||||| ||||| || ||||| ||||||   
Sbjct: 63234 ttggcgtggatggcgcacaggttggtgtcctcgaacagccccaccaggtaggcctcgctc 63293

                                                                         
Query: 281   gcctcctggagcgcggagacggcggaggactggaagcggaggtcggtcttgaagtcctgc 340
             |||||||| |||||   |||||| |||  ||||||||| ||||| |||||||||||||||
Sbjct: 63294 gcctcctgcagcgccatgacggccgagctctggaagcgcaggtccgtcttgaagtcctgc 63353

                                                               
Query: 341   gcgatctcccggacgaggcgctgaaaggggagcttgcggatgagcagctc 390
             |||||||| || || |||||||| || || ||||||||||| ||||||||
Sbjct: 63354 gcgatctcgcgcaccaggcgctggaacggcagcttgcggatcagcagctc 63403



to top

>gb|AC125099.3| Mus musculus BAC clone RP24-201C14 from 3, complete sequence
          Length = 166720

 Score =  226 bits (114), Expect = 5e-56
 Identities = 201/230 (87%)
 Strand = Plus / Minus

                                                                         
Query: 161   gcgcgctccccgcggatgcggcgggcgagctggatgtccttgggcatgattgtgacgcgc 220
             ||||||||||| |||||||||||||| | ||||||||||||||||||||| |||||||| 
Sbjct: 37519 gcgcgctccccacggatgcggcgggccaactggatgtccttgggcatgatggtgacgcgt 37460

                                                                         
Query: 221   ttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtacgcctcggcg 280
             ||||||||||||||||| ||||||||||||||||| ||||| || ||||| ||||||   
Sbjct: 37459 ttggcgtggatggcgcacaggttggtgtcctcgaacagccccaccaggtaggcctcgctc 37400

                                                                         
Query: 281   gcctcctggagcgcggagacggcggaggactggaagcggaggtcggtcttgaagtcctgc 340
             |||||||| |||||   |||||| |||  ||||||||| ||||| |||||||||||||||
Sbjct: 37399 gcctcctgcagcgccatgacggccgagctctggaagcgcaggtccgtcttgaagtcctgc 37340

                                                               
Query: 341   gcgatctcccggacgaggcgctgaaaggggagcttgcggatgagcagctc 390
             |||||||| || || |||||||| || || ||||||||||| ||||||||
Sbjct: 37339 gcgatctcgcgcaccaggcgctggaacggcagcttgcggatcagcagctc 37290



 Score =  226 bits (114), Expect = 5e-56
 Identities = 201/230 (87%)
 Strand = Plus / Plus

                                                                         
Query: 161   gcgcgctccccgcggatgcggcgggcgagctggatgtccttgggcatgattgtgacgcgc 220
             ||||||||||| |||||||||||||| | ||||||||||||||||||||| |||||||| 
Sbjct: 28762 gcgcgctccccacggatgcggcgggccaactggatgtccttgggcatgatggtgacgcgt 28821

                                                                         
Query: 221   ttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtacgcctcggcg 280
             ||||||||||||||||| ||||||||||||||||| ||||| || ||||| ||||||   
Sbjct: 28822 ttggcgtggatggcgcacaggttggtgtcctcgaacagccccaccaggtaggcctcgctc 28881

                                                                         
Query: 281   gcctcctggagcgcggagacggcggaggactggaagcggaggtcggtcttgaagtcctgc 340
             |||||||| |||||   |||||| |||  ||||||||| ||||| |||||||||||||||
Sbjct: 28882 gcctcctgcagcgccatgacggccgagctctggaagcgcaggtccgtcttgaagtcctgc 28941

                                                               
Query: 341   gcgatctcccggacgaggcgctgaaaggggagcttgcggatgagcagctc 390
             |||||||| || || |||||||| || || ||||||||||| ||||||||
Sbjct: 28942 gcgatctcgcgcaccaggcgctggaacggcagcttgcggatcagcagctc 28991



 Score =  226 bits (114), Expect = 5e-56
 Identities = 201/230 (87%)
 Strand = Plus / Plus

                                                                        
Query: 161  gcgcgctccccgcggatgcggcgggcgagctggatgtccttgggcatgattgtgacgcgc 220
            ||||||||||| |||||||||||||| | ||||||||||||||||||||| |||||||| 
Sbjct: 6954 gcgcgctccccacggatgcggcgggccaactggatgtccttgggcatgatggtgacgcgt 7013

                                                                        
Query: 221  ttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtacgcctcggcg 280
            ||||||||||||||||| ||||||||||||||||| ||||| || ||||| ||||||   
Sbjct: 7014 ttggcgtggatggcgcacaggttggtgtcctcgaacagccccaccaggtaggcctcgctc 7073

                                                                        
Query: 281  gcctcctggagcgcggagacggcggaggactggaagcggaggtcggtcttgaagtcctgc 340
            |||||||| |||||   |||||| |||  ||||||||| ||||| |||||||||||||||
Sbjct: 7074 gcctcctgcagcgccatgacggccgagctctggaagcgcaggtccgtcttgaagtcctgc 7133

                                                              
Query: 341  gcgatctcccggacgaggcgctgaaaggggagcttgcggatgagcagctc 390
            |||||||| || || |||||||| || || ||||||||||| ||||||||
Sbjct: 7134 gcgatctcgcgcaccaggcgctggaacggcagcttgcggatcagcagctc 7183



to top

>ref|NM_178215.1| Mus musculus histone 2, H3b (Hist2h3b), mRNA
          Length = 411

 Score =  226 bits (114), Expect = 5e-56
 Identities = 201/230 (87%)
 Strand = Plus / Minus

                                                                       
Query: 161 gcgcgctccccgcggatgcggcgggcgagctggatgtccttgggcatgattgtgacgcgc 220
           ||||||||||| |||||||||||||| | ||||||||||||||||||||| |||||||| 
Sbjct: 407 gcgcgctccccacggatgcggcgggccaactggatgtccttgggcatgatggtgacgcgt 348

                                                                       
Query: 221 ttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtacgcctcggcg 280
           ||||||||||||||||| ||||||||||||||||| ||||| || ||||| ||||||   
Sbjct: 347 ttggcgtggatggcgcacaggttggtgtcctcgaacagccccaccaggtaggcctcgctc 288

                                                                       
Query: 281 gcctcctggagcgcggagacggcggaggactggaagcggaggtcggtcttgaagtcctgc 340
           |||||||| |||||   |||||| |||  ||||||||| ||||| |||||||||||||||
Sbjct: 287 gcctcctgcagcgccatgacggccgagctctggaagcgcaggtccgtcttgaagtcctgc 228

                                                             
Query: 341 gcgatctcccggacgaggcgctgaaaggggagcttgcggatgagcagctc 390
           |||||||| || || |||||||| || || ||||||||||| ||||||||
Sbjct: 227 gcgatctcgcgcaccaggcgctggaacggcagcttgcggatcagcagctc 178



to top

>gb|M32461.1|MUSHIS3C Mouse histone H3 (H3.2-614) gene, complete cds
          Length = 1110

 Score =  226 bits (114), Expect = 5e-56
 Identities = 201/230 (87%)
 Strand = Plus / Minus

                                                                       
Query: 161 gcgcgctccccgcggatgcggcgggcgagctggatgtccttgggcatgattgtgacgcgc 220
           ||||||||||| |||||||||||||| | ||||||||||||||||||||| |||||||| 
Sbjct: 746 gcgcgctccccacggatgcggcgggccaactggatgtccttgggcatgatggtgacgcgt 687

                                                                       
Query: 221 ttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtacgcctcggcg 280
           ||||||||||||||||| ||||||||||||||||| ||||| || ||||| ||||||   
Sbjct: 686 ttggcgtggatggcgcacaggttggtgtcctcgaacagccccaccaggtaggcctcgctc 627

                                                                       
Query: 281 gcctcctggagcgcggagacggcggaggactggaagcggaggtcggtcttgaagtcctgc 340
           |||||||| |||||   |||||| |||  ||||||||| ||||| |||||||||||||||
Sbjct: 626 gcctcctgcagcgccatgacggccgagctctggaagcgcaggtccgtcttgaagtcctgc 567

                                                             
Query: 341 gcgatctcccggacgaggcgctgaaaggggagcttgcggatgagcagctc 390
           |||||||| || || |||||||| || || ||||||||||| ||||||||
Sbjct: 566 gcgatctcgcgcaccaggcgctggaacggcagcttgcggatcagcagctc 517



to top

>gb|J01175.1|SULHISL34 Sea urchin (L.pictus) late-stage histone H3 and H4 genes
          Length = 2133

 Score =  226 bits (114), Expect = 5e-56
 Identities = 210/242 (86%)
 Strand = Plus / Minus

                                                                        
Query: 164  cgctccccgcggatgcggcgggcgagctggatgtccttgggcatgattgtgacgcgcttg 223
            ||||| || ||||| |||||||| ||||||||||||||||||||||| ||||| ||||||
Sbjct: 1917 cgctcgccacggatacggcgggcaagctggatgtccttgggcatgatggtgacacgcttg 1858

                                                                        
Query: 224  gcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtacgcctcggcggcc 283
            |||||||||||||| |||||||||||||||||||| ||||| | ||| || ||   ||||
Sbjct: 1857 gcgtggatggcgcaaaggttggtgtcctcgaagagaccgaccaagtaagcttccctggcc 1798

                                                                        
Query: 284  tcctggagcgcggagacggcggaggactggaagcggaggtcggtcttgaagtcctgcgcg 343
            || ||||| ||   ||||||||||  |||||||||||| ||||| ||||||||||| |||
Sbjct: 1797 tcttggagggccatgacggcggagctctggaagcggagctcggttttgaagtcctgagcg 1738

                                                                        
Query: 344  atctcccggacgaggcgctgaaaggggagcttgcggatgagcagctccgtgctcttctgg 403
            ||||| ||||| || ||||| |||||||||||||||||||  ||||| ||||||||||||
Sbjct: 1737 atctcacggaccagacgctggaaggggagcttgcggatgaaaagctcggtgctcttctgg 1678

              
Query: 404  ta 405
            ||
Sbjct: 1677 ta 1676



to top

>ref|NM_178206.2| Mus musculus histone 1, H3h (Hist1h3h), mRNA
          Length = 488

 Score =  224 bits (113), Expect = 2e-55
 Identities = 197/225 (87%)
 Strand = Plus / Minus

                                                                       
Query: 166 ctccccgcggatgcggcgggcgagctggatgtccttgggcatgattgtgacgcgcttggc 225
           ||||||||||||||||||||| ||||||||||||||||||||||| ||||| ||||||||
Sbjct: 433 ctccccgcggatgcggcgggccagctggatgtccttgggcatgatggtgacacgcttggc 374

                                                                       
Query: 226 gtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtacgcctcggcggcctc 285
           |||||||||||| |||||||||||||| || || || |||||||| |||||   ||||||
Sbjct: 373 gtggatggcgcacaggttggtgtcctcaaacagacccacgaggtaggcctcacaggcctc 314

                                                                       
Query: 286 ctggagcgcggagacggcggaggactggaagcggaggtcggtcttgaagtcctgcgcgat 345
           ||| || ||   |||||| |||  ||||||||| ||||||||||||||||||||||||||
Sbjct: 313 ctgcagagccatgacggccgagctctggaagcgcaggtcggtcttgaagtcctgcgcgat 254

                                                        
Query: 346 ctcccggacgaggcgctgaaaggggagcttgcggatgagcagctc 390
           ||| || || |||||||| || || ||||||||||| ||||||||
Sbjct: 253 ctcgcgcaccaggcgctggaacggcagcttgcggatcagcagctc 209



to top

>ref|XM_781054.1| PREDICTED: Strongylocentrotus purpuratus similar to CG31613-PA
           (LOC581030), mRNA
          Length = 411

 Score =  224 bits (113), Expect = 2e-55
 Identities = 203/233 (87%)
 Strand = Plus / Minus

                                                                       
Query: 173 cggatgcggcgggcgagctggatgtccttgggcatgattgtgacgcgcttggcgtggatg 232
           ||||| |||||||| ||||||||||||||||||||||| ||||| |||||||||||||||
Sbjct: 395 cggatacggcgggccagctggatgtccttgggcatgatggtgacacgcttggcgtggatg 336

                                                                       
Query: 233 gcgcagaggttggtgtcctcgaagagcccgacgaggtacgcctcggcggcctcctggagc 292
           ||||| |||||||||||||||||||| ||||| | ||| || |||   |||||||| || 
Sbjct: 335 gcgcacaggttggtgtcctcgaagagaccgaccaagtaggcttcgctagcctcctgaaga 276

                                                                       
Query: 293 gcggagacggcggaggactggaagcggaggtcggtcttgaagtcctgcgcgatctcccgg 352
           ||   |||||| |||  |||||| ||||| ||||||||||||||||| |||||||| |||
Sbjct: 275 gccatgacggcagagctctggaatcggagctcggtcttgaagtcctgagcgatctcacgg 216

                                                                
Query: 353 acgaggcgctgaaaggggagcttgcggatgagcagctccgtgctcttctggta 405
           || || ||||| |||||||||||||||||||| ||||| ||||||||||||||
Sbjct: 215 accagacgctggaaggggagcttgcggatgagaagctcggtgctcttctggta 163



to top

>emb|AL589651.8| Mouse DNA sequence from clone RP23-138F20 on chromosome 13 Contains five
              genes for olfactory receptors, a novel gene, the H1f5 gene
              for H1 histone family member 5, three genes and one
              pseudogene for H2a histone family members, four genes for
              H2b, two genes for H4, and two genes for H3 histone family
              members and seven CpG islands, complete sequence
          Length = 222823

 Score =  224 bits (113), Expect = 2e-55
 Identities = 197/225 (87%)
 Strand = Plus / Minus

                                                                          
Query: 166    ctccccgcggatgcggcgggcgagctggatgtccttgggcatgattgtgacgcgcttggc 225
              ||||||||||||||||||||| ||||||||||||||||||||||| ||||| ||||||||
Sbjct: 139050 ctccccgcggatgcggcgggccagctggatgtccttgggcatgatggtgacacgcttggc 138991

                                                                          
Query: 226    gtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtacgcctcggcggcctc 285
              |||||||||||| |||||||||||||| || || || |||||||| |||||   ||||||
Sbjct: 138990 gtggatggcgcacaggttggtgtcctcaaacagacccacgaggtaggcctcacaggcctc 138931

                                                                          
Query: 286    ctggagcgcggagacggcggaggactggaagcggaggtcggtcttgaagtcctgcgcgat 345
              ||| || ||   |||||| |||  ||||||||| ||||||||||||||||||||||||||
Sbjct: 138930 ctgcagagccatgacggccgagctctggaagcgcaggtcggtcttgaagtcctgcgcgat 138871

                                                           
Query: 346    ctcccggacgaggcgctgaaaggggagcttgcggatgagcagctc 390
              ||| || || |||||||| || || ||||||||||| ||||||||
Sbjct: 138870 ctcgcgcaccaggcgctggaacggcagcttgcggatcagcagctc 138826



 Score =  200 bits (101), Expect = 3e-48
 Identities = 194/225 (86%)
 Strand = Plus / Plus

                                                                          
Query: 166    ctccccgcggatgcggcgggcgagctggatgtccttgggcatgattgtgacgcgcttggc 225
              ||||||||| ||||| ||||| ||||||||||||||||||||||| ||||| ||||||||
Sbjct: 203959 ctccccgcgaatgcgacgggccagctggatgtccttgggcatgatggtgacacgcttggc 204018

                                                                          
Query: 226    gtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtacgcctcggcggcctc 285
              |||||||||||| |||||||||||||| || || || |||||||| |||||   ||||||
Sbjct: 204019 gtggatggcgcacaggttggtgtcctcaaacagacccacgaggtaggcctcacaggcctc 204078

                                                                          
Query: 286    ctggagcgcggagacggcggaggactggaagcggaggtcggtcttgaagtcctgcgcgat 345
              ||| || ||   ||| || |||  ||||||||| ||||||||||||||||||||||||||
Sbjct: 204079 ctgcagagccatgacagccgagctctggaagcgcaggtcggtcttgaagtcctgcgcgat 204138

                                                           
Query: 346    ctcccggacgaggcgctgaaaggggagcttgcggatgagcagctc 390
              ||| || || |||||||| || || ||||||||||| ||||||||
Sbjct: 204139 ctcgcgcaccaggcgctggaacggcagcttgcggatcagcagctc 204183



to top

>ref|XM_227460.3| PREDICTED: Rattus norvegicus histone 2, H3c2 (predicted)
           (Hist2h3c2_predicted), mRNA
          Length = 411

 Score =  224 bits (113), Expect = 2e-55
 Identities = 203/233 (87%)
 Strand = Plus / Minus

                                                                       
Query: 158 taggcgcgctccccgcggatgcggcgggcgagctggatgtccttgggcatgattgtgacg 217
           ||||||||||||||||||||||| ||||| | ||||||||||||||||||||| ||||||
Sbjct: 410 taggcgcgctccccgcggatgcgacgggccaactggatgtccttgggcatgatggtgacg 351

                                                                       
Query: 218 cgcttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtacgcctcg 277
           || ||||||||||||||||| ||||||||||||||||| || || || ||||| ||||||
Sbjct: 350 cgtttggcgtggatggcgcacaggttggtgtcctcgaacagacccaccaggtaggcctcg 291

                                                                       
Query: 278 gcggcctcctggagcgcggagacggcggaggactggaagcggaggtcggtcttgaagtcc 337
              |||||||| |||||   |||||| |||  ||||||||| ||||| ||||||||||||
Sbjct: 290 ctcgcctcctgcagcgccatgacggccgagctctggaagcgcaggtccgtcttgaagtcc 231

                                                                
Query: 338 tgcgcgatctcccggacgaggcgctgaaaggggagcttgcggatgagcagctc 390
           ||||||||||| || || |||||||| || || ||||||||||| ||||||||
Sbjct: 230 tgcgcgatctcgcgcaccaggcgctggaacggcagcttgcggatcagcagctc 178



to top

>gb|AY158944.1| Mus musculus histone protein Hist1h3h gene, complete cds
          Length = 1408

 Score =  224 bits (113), Expect = 2e-55
 Identities = 197/225 (87%)
 Strand = Plus / Minus

                                                                       
Query: 166 ctccccgcggatgcggcgggcgagctggatgtccttgggcatgattgtgacgcgcttggc 225
           ||||||||||||||||||||| ||||||||||||||||||||||| ||||| ||||||||
Sbjct: 902 ctccccgcggatgcggcgggccagctggatgtccttgggcatgatggtgacacgcttggc 843

                                                                       
Query: 226 gtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtacgcctcggcggcctc 285
           |||||||||||| |||||||||||||| || || || |||||||| |||||   ||||||
Sbjct: 842 gtggatggcgcacaggttggtgtcctcaaacagacccacgaggtaggcctcacaggcctc 783

                                                                       
Query: 286 ctggagcgcggagacggcggaggactggaagcggaggtcggtcttgaagtcctgcgcgat 345
           ||| || ||   |||||| |||  ||||||||| ||||||||||||||||||||||||||
Sbjct: 782 ctgcagagccatgacggccgagctctggaagcgcaggtcggtcttgaagtcctgcgcgat 723

                                                        
Query: 346 ctcccggacgaggcgctgaaaggggagcttgcggatgagcagctc 390
           ||| || || |||||||| || || ||||||||||| ||||||||
Sbjct: 722 ctcgcgcaccaggcgctggaacggcagcttgcggatcagcagctc 678



to top

>gb|AY338635.1| Chaquihua sp. EP080 histone 3 gene, partial cds
          Length = 313

 Score =  224 bits (113), Expect = 2e-55
 Identities = 181/204 (88%)
 Strand = Plus / Minus

                                                                       
Query: 202 gggcatgattgtgacgcgcttggcgtggatggcgcagaggttggtgtcctcgaagagccc 261
           |||||| || |||||||||||||||||||||||||| ||||||||||||||||| || ||
Sbjct: 313 gggcatnatggtgacgcgcttggcgtggatggcgcacaggttggtgtcctcgaacagtcc 254

                                                                       
Query: 262 gacgaggtacgcctcggcggcctcctggagcgcggagacggcggaggactggaagcggag 321
           ||||||||| ||||||  ||||||||| || ||   ||||||||||  ||||||||| ||
Sbjct: 253 gacgaggtaagcctcgctggcctcctgcagagccatgacggcggagctctggaagcgcag 194

                                                                       
Query: 322 gtcggtcttgaagtcctgcgcgatctcccggacgaggcgctgaaaggggagcttgcggat 381
            ||||||||||||||||| |||||||| |||||||| ||||| ||||| |||||||||||
Sbjct: 193 atcggtcttgaagtcctgagcgatctcgcggacgagacgctggaagggcagcttgcggat 134

                                   
Query: 382 gagcagctccgtgctcttctggta 405
            |||||||||||||||||||||||
Sbjct: 133 cagcagctccgtgctcttctggta 110



to top

>gb|AY338626.1| Coloburiscus humeralis histone 3 gene, partial cds
          Length = 345

 Score =  224 bits (113), Expect = 2e-55
 Identities = 181/204 (88%)
 Strand = Plus / Minus

                                                                       
Query: 202 gggcatgattgtgacgcgcttggcgtggatggcgcagaggttggtgtcctcgaagagccc 261
           ||||||||| |||||||||||||||||||||||||| |||||||||||||||||||| ||
Sbjct: 345 gggcatgatggtgacgcgcttggcgtggatggcgcacaggttggtgtcctcgaagagtcc 286

                                                                       
Query: 262 gacgaggtacgcctcggcggcctcctggagcgcggagacggcggaggactggaagcggag 321
            |||||||| ||||||  ||||||||| || ||   ||||||||||  ||||||||| ||
Sbjct: 285 nacgaggtaagcctcgctggcctcctgcagagccatgacggcggagctctggaagcgcag 226

                                                                       
Query: 322 gtcggtcttgaagtcctgcgcgatctcccggacgaggcgctgaaaggggagcttgcggat 381
           ||| |||||||||||||| |||||||| || ||||||||||| ||||| |||||||||||
Sbjct: 225 gtcagtcttgaagtcctgtgcgatctcacgcacgaggcgctggaagggcagcttgcggat 166

                                   
Query: 382 gagcagctccgtgctcttctggta 405
           ||||||||| || |||||||||||
Sbjct: 165 gagcagctcggtactcttctggta 142



to top

>gb|AY749744.1| Dipteromimus sp. EP150 histone H3 (H3) gene, partial cds
          Length = 375

 Score =  224 bits (113), Expect = 2e-55
 Identities = 185/209 (88%)
 Strand = Plus / Minus

                                                                       
Query: 197 tccttgggcatgattgtgacgcgcttggcgtggatggcgcagaggttggtgtcctcgaag 256
           |||||||||||||| |||||||||||||||||||||||||| ||||||||||||||||| 
Sbjct: 371 tccttgggcatgatggtgacgcgcttggcgtggatggcgcaaaggttggtgtcctcgaac 312

                                                                       
Query: 257 agcccgacgaggtacgcctcggcggcctcctggagcgcggagacggcggaggactggaag 316
           || ||||||||||| ||||||  ||||||||| |||||   |||||| |||  |||||||
Sbjct: 311 agaccgacgaggtaagcctcgctggcctcctgcagcgccatgacggcagagctctggaag 252

                                                                       
Query: 317 cggaggtcggtcttgaagtcctgcgcgatctcccggacgaggcgctgaaaggggagcttg 376
           || ||||| |||||||||||||| |||||||| || || || ||||| ||||| ||||||
Sbjct: 251 cgcaggtccgtcttgaagtcctgggcgatctcgcgcaccagccgctggaagggcagcttg 192

                                        
Query: 377 cggatgagcagctccgtgctcttctggta 405
           ||||| |||||||||||||||||||||||
Sbjct: 191 cggatcagcagctccgtgctcttctggta 163



to top

>gb|AY749709.1| Mystaxiops venatoris histone H3 (H3) gene, partial cds
          Length = 375

 Score =  224 bits (113), Expect = 2e-55
 Identities = 185/209 (88%)
 Strand = Plus / Minus

                                                                       
Query: 197 tccttgggcatgattgtgacgcgcttggcgtggatggcgcagaggttggtgtcctcgaag 256
           |||||||||||||| |||||||||||||||||||||||||| ||||||||||||||||||
Sbjct: 371 tccttgggcatgatggtgacgcgcttggcgtggatggcgcacaggttggtgtcctcgaag 312

                                                                       
Query: 257 agcccgacgaggtacgcctcggcggcctcctggagcgcggagacggcggaggactggaag 316
           || ||||| ||||| ||||||  ||||||||| || ||   |||||| |||  |||||||
Sbjct: 311 aggccgaccaggtaagcctcgctggcctcctgcagggccatgacggccgagctctggaag 252

                                                                       
Query: 317 cggaggtcggtcttgaagtcctgcgcgatctcccggacgaggcgctgaaaggggagcttg 376
           || |||||||||||||||||||| ||||| || || || || ||||| ||||| ||||||
Sbjct: 251 cgcaggtcggtcttgaagtcctgggcgatttcacgcaccagacgctggaagggcagcttg 192

                                        
Query: 377 cggatgagcagctccgtgctcttctggta 405
           |||||||||||||||||||||||||||||
Sbjct: 191 cggatgagcagctccgtgctcttctggta 163



to top

>gb|M32462.1|MUSHIS3D Mouse histone H3 (H3.1-291) gene, complete cds
          Length = 927

 Score =  224 bits (113), Expect = 2e-55
 Identities = 197/225 (87%)
 Strand = Plus / Minus

                                                                       
Query: 166 ctccccgcggatgcggcgggcgagctggatgtccttgggcatgattgtgacgcgcttggc 225
           ||||||||||||||||||||| ||||||||||||||||||||||| ||||| ||||||||
Sbjct: 740 ctccccgcggatgcggcgggccagctggatgtccttgggcatgatggtgacacgcttggc 681

                                                                       
Query: 226 gtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtacgcctcggcggcctc 285
           |||||||||||| |||||||||||||| || || || |||||||| |||||   ||||||
Sbjct: 680 gtggatggcgcacaggttggtgtcctcaaacagacccacgaggtaggcctcacaggcctc 621

                                                                       
Query: 286 ctggagcgcggagacggcggaggactggaagcggaggtcggtcttgaagtcctgcgcgat 345
           ||| || ||   |||||| |||  ||||||||| ||||||||||||||||||||||||||
Sbjct: 620 ctgcagagccatgacggccgagctctggaagcgcaggtcggtcttgaagtcctgcgcgat 561

                                                        
Query: 346 ctcccggacgaggcgctgaaaggggagcttgcggatgagcagctc 390
           ||| || || |||||||| || || ||||||||||| ||||||||
Sbjct: 560 ctcgcgcaccaggcgctggaacggcagcttgcggatcagcagctc 516



to top

>emb|X00593.1|LPH3H4 Lytechinus pictus H3 and H4 gene
          Length = 2029

 Score =  222 bits (112), Expect = 7e-55
 Identities = 214/248 (86%)
 Strand = Plus / Minus

                                                                        
Query: 158  taggcgcgctccccgcggatgcggcgggcgagctggatgtccttgggcatgattgtgacg 217
            ||||| ||||| || ||||| |||||||| |||||||||||||| |||||||| ||||| 
Sbjct: 1887 taggcacgctcgccacggatacggcgggcaagctggatgtcctttggcatgatggtgaca 1828

                                                                        
Query: 218  cgcttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtacgcctcg 277
            ||||| ||||||||||| || ||||||||||||||||| || ||||| | ||| || |||
Sbjct: 1827 cgcttagcgtggatggcacacaggttggtgtcctcgaaaagaccgaccaagtaagcttcg 1768

                                                                        
Query: 278  gcggcctcctggagcgcggagacggcggaggactggaagcggaggtcggtcttgaagtcc 337
              |||||||||||| ||   ||||||||||  |||||||||||| |||||||||||||||
Sbjct: 1767 ctggcctcctggagagccatgacggcggagctctggaagcggagctcggtcttgaagtcc 1708

                                                                        
Query: 338  tgcgcgatctcccggacgaggcgctgaaaggggagcttgcggatgagcagctccgtgctc 397
            || ||||| || ||||| || ||||| |||||||||||||||||||| ||||| ||||||
Sbjct: 1707 tgagcgatttcacggaccagacgctggaaggggagcttgcggatgagaagctcggtgctc 1648

                    
Query: 398  ttctggta 405
            ||||||||
Sbjct: 1647 ttctggta 1640



to top

>dbj|AB185072.1| Conocephalum conicum H3 gene for histone 3, complete cds, clone:
           YFS410
          Length = 500

 Score =  220 bits (111), Expect = 3e-54
 Identities = 210/243 (86%)
 Strand = Plus / Minus

                                                                       
Query: 163 gcgctccccgcggatgcggcgggcgagctggatgtccttgggcatgattgtgacgcgctt 222
           |||||| || |||| |||||||||||||||||||||||||| |  ||| ||||| |||||
Sbjct: 494 gcgctcgcctcggaggcggcgggcgagctggatgtccttggactggatggtgacacgctt 435

                                                                       
Query: 223 ggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtacgcctcggcggc 282
           ||||||||||||||| ||||||||||||||||||||   ||||||||| | |||| ||| 
Sbjct: 434 ggcgtggatggcgcacaggttggtgtcctcgaagagggagacgaggtaagactcgacgga 375

                                                                       
Query: 283 ctcctggagcgcggagacggcggaggactggaagcggaggtcggtcttgaagtcctgcgc 342
           ||||||||| ||   || |||||| |||||||||||||||||| ||||||||||||| ||
Sbjct: 374 ctcctggagagcaccgatggcggaagactggaagcggaggtcgctcttgaagtcctgggc 315

                                                                       
Query: 343 gatctcccggacgaggcgctgaaaggggagcttgcggatgagcagctccgtgctcttctg 402
            ||||| |||||||| ||||| ||||||||||||||||| || ||||| |||  ||||||
Sbjct: 314 aatctcacggacgagacgctggaaggggagcttgcggatcagaagctcggtggacttctg 255

              
Query: 403 gta 405
           |||
Sbjct: 254 gta 252



to top

>gb|BC015270.1| Mus musculus histone 2, H3c2, mRNA (cDNA clone MGC:18559
           IMAGE:4240748), complete cds
          Length = 1124

 Score =  218 bits (110), Expect = 1e-53
 Identities = 200/230 (86%)
 Strand = Plus / Minus

                                                                       
Query: 161 gcgcgctccccgcggatgcggcgggcgagctggatgtccttgggcatgattgtgacgcgc 220
           ||||||||||| |||||||||||||| | ||||||||||||||||||||| |||||||| 
Sbjct: 593 gcgcgctccccacggatgcggcgggccaactggatgtccttgggcatgatggtgacgcgt 534

                                                                       
Query: 221 ttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtacgcctcggcg 280
           ||||||||||||||||| ||||||||||||||||| ||||| || || || ||||||   
Sbjct: 533 ttggcgtggatggcgcacaggttggtgtcctcgaacagccccaccagataggcctcgctc 474

                                                                       
Query: 281 gcctcctggagcgcggagacggcggaggactggaagcggaggtcggtcttgaagtcctgc 340
           |||||||| |||||   |||||| |||  ||||||||| ||||| |||||||||||||||
Sbjct: 473 gcctcctgcagcgccatgacggccgagctctggaagcgcaggtccgtcttgaagtcctgc 414

                                                             
Query: 341 gcgatctcccggacgaggcgctgaaaggggagcttgcggatgagcagctc 390
           |||||||| || || |||||||| || || ||||||||||| ||||||||
Sbjct: 413 gcgatctcgcgcaccaggcgctggaacggcagcttgcggatcagcagctc 364



to top

>ref|NM_054045.2| Mus musculus histone 2, H3c2 (Hist2h3c2), mRNA
          Length = 1124

 Score =  218 bits (110), Expect = 1e-53
 Identities = 200/230 (86%)
 Strand = Plus / Minus

                                                                       
Query: 161 gcgcgctccccgcggatgcggcgggcgagctggatgtccttgggcatgattgtgacgcgc 220
           ||||||||||| |||||||||||||| | ||||||||||||||||||||| |||||||| 
Sbjct: 593 gcgcgctccccacggatgcggcgggccaactggatgtccttgggcatgatggtgacgcgt 534

                                                                       
Query: 221 ttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtacgcctcggcg 280
           ||||||||||||||||| ||||||||||||||||| ||||| || || || ||||||   
Sbjct: 533 ttggcgtggatggcgcacaggttggtgtcctcgaacagccccaccagataggcctcgctc 474

                                                                       
Query: 281 gcctcctggagcgcggagacggcggaggactggaagcggaggtcggtcttgaagtcctgc 340
           |||||||| |||||   |||||| |||  ||||||||| ||||| |||||||||||||||
Sbjct: 473 gcctcctgcagcgccatgacggccgagctctggaagcgcaggtccgtcttgaagtcctgc 414

                                                             
Query: 341 gcgatctcccggacgaggcgctgaaaggggagcttgcggatgagcagctc 390
           |||||||| || || |||||||| || || ||||||||||| ||||||||
Sbjct: 413 gcgatctcgcgcaccaggcgctggaacggcagcttgcggatcagcagctc 364



to top

>emb|X80327.1|MPMP323 M.pahari genes mpH323 and mph2a23
          Length = 2724

 Score =  218 bits (110), Expect = 1e-53
 Identities = 200/230 (86%)
 Strand = Plus / Minus

                                                                        
Query: 161  gcgcgctccccgcggatgcggcgggcgagctggatgtccttgggcatgattgtgacgcgc 220
            |||||||| || |||||||||||| | | ||||||||||||||||||||| |||||||||
Sbjct: 2548 gcgcgctcaccacggatgcggcggaccaactggatgtccttgggcatgatggtgacgcgc 2489

                                                                        
Query: 221  ttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtacgcctcggcg 280
            ||||||||||||||||| ||||||||||||||||| ||||| || ||||| ||||||   
Sbjct: 2488 ttggcgtggatggcgcacaggttggtgtcctcgaacagccccaccaggtaggcctcgctc 2429

                                                                        
Query: 281  gcctcctggagcgcggagacggcggaggactggaagcggaggtcggtcttgaagtcctgc 340
            |||||||| |||||   |||||| |||  ||||||||| ||||| |||||||||||||||
Sbjct: 2428 gcctcctgcagcgccatgacggccgagctctggaagcgcaggtccgtcttgaagtcctgc 2369

                                                              
Query: 341  gcgatctcccggacgaggcgctgaaaggggagcttgcggatgagcagctc 390
            |||||||| || || |||||||| || || ||||||||||| ||||||||
Sbjct: 2368 gcgatctcgcgcaccaggcgctggaacggcagcttgcggatcagcagctc 2319



to top

>gb|AY749738.1| Jubabaetis sp. EP139 histone H3 (H3) gene, partial cds
          Length = 375

 Score =  218 bits (110), Expect = 1e-53
 Identities = 184/209 (88%)
 Strand = Plus / Minus

                                                                       
Query: 197 tccttgggcatgattgtgacgcgcttggcgtggatggcgcagaggttggtgtcctcgaag 256
           |||||||||||||| |||||||||||||||||||||||||| | ||||||||||||||||
Sbjct: 371 tccttgggcatgatggtgacgcgcttggcgtggatggcgcacaagttggtgtcctcgaag 312

                                                                       
Query: 257 agcccgacgaggtacgcctcggcggcctcctggagcgcggagacggcggaggactggaag 316
           || ||||| | ||| ||||||  ||||||||| || ||   |||||| |||  |||||| 
Sbjct: 311 aggccgaccaagtaggcctcgctggcctcctgcagggccatgacggccgagctctggaaa 252

                                                                       
Query: 317 cggaggtcggtcttgaagtcctgcgcgatctcccggacgaggcgctgaaaggggagcttg 376
           || ||||||||||||||||||||||||||||| || ||||||||||| ||||| ||||||
Sbjct: 251 cgcaggtcggtcttgaagtcctgcgcgatctcgcgcacgaggcgctggaagggcagcttg 192

                                        
Query: 377 cggatgagcagctccgtgctcttctggta 405
           |||||||| ||||| ||||||||||||||
Sbjct: 191 cggatgagnagctcagtgctcttctggta 163



to top

>ref|NM_145073.2| Mus musculus histone 1, H3g (Hist1h3g), mRNA
          Length = 492

 Score =  216 bits (109), Expect = 4e-53
 Identities = 196/225 (87%)
 Strand = Plus / Minus

                                                                       
Query: 166 ctccccgcggatgcggcgggcgagctggatgtccttgggcatgattgtgacgcgcttggc 225
           ||||||||||||||| ||||| ||||||||||||||||||||||| ||||| ||||||||
Sbjct: 430 ctccccgcggatgcgacgggccagctggatgtccttgggcatgatggtgacacgcttggc 371

                                                                       
Query: 226 gtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtacgcctcggcggcctc 285
           |||||||||||| |||||||||||||| || || || |||||||| |||||   ||||||
Sbjct: 370 gtggatggcgcacaggttggtgtcctcaaacagacccacgaggtaggcctcacaggcctc 311

                                                                       
Query: 286 ctggagcgcggagacggcggaggactggaagcggaggtcggtcttgaagtcctgcgcgat 345
           ||| || ||   |||||| |||  ||||||||| ||||||||||||||||||||||||||
Sbjct: 310 ctgcagagccatgacggccgagctctggaagcgcaggtcggtcttgaagtcctgcgcgat 251

                                                        
Query: 346 ctcccggacgaggcgctgaaaggggagcttgcggatgagcagctc 390
           ||| || || |||||||| || || ||||||||||| ||||||||
Sbjct: 250 ctcgcgcaccaggcgctggaacggcagcttgcggatcagcagctc 206



to top

>gb|AC034285.6| Mus musculus chromosome 13, clone RP23-220G21, complete sequence
          Length = 209720

 Score =  216 bits (109), Expect = 4e-53
 Identities = 196/225 (87%)
 Strand = Plus / Plus

                                                                         
Query: 166   ctccccgcggatgcggcgggcgagctggatgtccttgggcatgattgtgacgcgcttggc 225
             ||||||||||||||| ||||| ||||||||||||||||||||||| ||||| ||||||||
Sbjct: 99531 ctccccgcggatgcgacgggccagctggatgtccttgggcatgatggtgacacgcttggc 99590

                                                                         
Query: 226   gtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtacgcctcggcggcctc 285
             |||||||||||| |||||||||||||| || || || |||||||| |||||   ||||||
Sbjct: 99591 gtggatggcgcacaggttggtgtcctcaaacagacccacgaggtaggcctcacaggcctc 99650

                                                                         
Query: 286   ctggagcgcggagacggcggaggactggaagcggaggtcggtcttgaagtcctgcgcgat 345
             ||| || ||   |||||| |||  ||||||||| ||||||||||||||||||||||||||
Sbjct: 99651 ctgcagagccatgacggccgagctctggaagcgcaggtcggtcttgaagtcctgcgcgat 99710

                                                          
Query: 346   ctcccggacgaggcgctgaaaggggagcttgcggatgagcagctc 390
             ||| || || |||||||| || || ||||||||||| ||||||||
Sbjct: 99711 ctcgcgcaccaggcgctggaacggcagcttgcggatcagcagctc 99755



 Score =  212 bits (107), Expect = 7e-52
 Identities = 197/227 (86%)
 Strand = Plus / Minus

                                                                         
Query: 164   cgctccccgcggatgcggcgggcgagctggatgtccttgggcatgattgtgacgcgcttg 223
             ||||| |||||||| |||||||| ||||||||||||||||||||||| ||||| ||||||
Sbjct: 73416 cgctcgccgcggatacggcgggccagctggatgtccttgggcatgatggtgacacgcttg 73357

                                                                         
Query: 224   gcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtacgcctcggcggcc 283
             |||||||||||||| |||||||||||||| || || || |||||||| ||||||   |||
Sbjct: 73356 gcgtggatggcgcacaggttggtgtcctcaaacagacccacgaggtaggcctcgctcgcc 73297

                                                                         
Query: 284   tcctggagcgcggagacggcggaggactggaagcggaggtcggtcttgaagtcctgcgcg 343
             ||||| || ||   |||||| |||  ||||||||| ||||||||||||||||||||||||
Sbjct: 73296 tcctgcagagccatgacggccgagctctggaagcgcaggtcggtcttgaagtcctgcgcg 73237

                                                            
Query: 344   atctcccggacgaggcgctgaaaggggagcttgcggatgagcagctc 390
             ||||| || || |||||||| || || ||||||||||| ||||||||
Sbjct: 73236 atctcgcgcaccaggcgctggaacggcagcttgcggatcagcagctc 73190



 Score =  204 bits (103), Expect = 2e-49
 Identities = 196/227 (86%)
 Strand = Plus / Plus

                                                                         
Query: 164   cgctccccgcggatgcggcgggcgagctggatgtccttgggcatgattgtgacgcgcttg 223
             ||||| |||||||| |||||||| ||||||||||||||||||||||| ||||| ||||||
Sbjct: 90490 cgctcgccgcggatacggcgggccagctggatgtccttgggcatgatggtgacacgcttg 90549

                                                                         
Query: 224   gcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtacgcctcggcggcc 283
             |||||||||||||| |||||||||||||| || || || || ||||| ||||||   |||
Sbjct: 90550 gcgtggatggcgcacaggttggtgtcctcaaacagacccacaaggtaggcctcgctcgcc 90609

                                                                         
Query: 284   tcctggagcgcggagacggcggaggactggaagcggaggtcggtcttgaagtcctgcgcg 343
             ||||| || ||   |||||| |||  ||||||||| ||||||||||||||||||||||||
Sbjct: 90610 tcctgcagagccatgacggccgagctctggaagcgcaggtcggtcttgaagtcctgcgcg 90669

                                                            
Query: 344   atctcccggacgaggcgctgaaaggggagcttgcggatgagcagctc 390
             ||||| || || |||||||| || || ||||||||||| ||||||||
Sbjct: 90670 atctcgcgcaccaggcgctggaacggcagcttgcggatcagcagctc 90716



 Score =  192 bits (97), Expect = 6e-46
 Identities = 193/225 (85%)
 Strand = Plus / Plus

                                                                         
Query: 166   ctccccgcggatgcggcgggcgagctggatgtccttgggcatgattgtgacgcgcttggc 225
             |||||| || ||||| ||||| ||||||||||||||||||||||| ||||| ||||||||
Sbjct: 59175 ctccccacgaatgcgacgggccagctggatgtccttgggcatgatggtgacacgcttggc 59234

                                                                         
Query: 226   gtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtacgcctcggcggcctc 285
             ||||||||| || |||||||||||||| || || || |||||||| ||||||   |||||
Sbjct: 59235 gtggatggcacacaggttggtgtcctcaaacagacccacgaggtaggcctcgctcgcctc 59294

                                                                         
Query: 286   ctggagcgcggagacggcggaggactggaagcggaggtcggtcttgaagtcctgcgcgat 345
             ||| || ||   |||||| |||  ||||||||| ||||||||||||||||||||||||||
Sbjct: 59295 ctgcagagccatgacggccgagctctggaagcgcaggtcggtcttgaagtcctgcgcgat 59354

                                                          
Query: 346   ctcccggacgaggcgctgaaaggggagcttgcggatgagcagctc 390
             ||| || || |||||||| || || ||||||||||| ||||||||
Sbjct: 59355 ctcgcgcaccaggcgctggaacggcagcttgcggatcagcagctc 59399



to top

>gb|AY181030.1| Toxoplasma gondii histone H3 mRNA, complete cds
          Length = 411

 Score =  216 bits (109), Expect = 4e-53
 Identities = 202/233 (86%)
 Strand = Plus / Minus

                                                                       
Query: 173 cggatgcggcgggcgagctggatgtccttgggcatgattgtgacgcgcttggcgtggatg 232
           ||||||||||| |||||||| ||||||||||||||||| ||||| |||||||||||||||
Sbjct: 395 cggatgcggcgagcgagctgaatgtccttgggcatgatggtgacacgcttggcgtggatg 336

                                                                       
Query: 233 gcgcagaggttggtgtcctcgaagagcccgacgaggtacgcctcggcggcctcctggagc 292
           ||||| | |||||||||||||||||||||||||||||| ||||| ||||| |||||||| 
Sbjct: 335 gcgcacaagttggtgtcctcgaagagcccgacgaggtaagcctcagcggcttcctggaga 276

                                                                       
Query: 293 gcggagacggcggaggactggaagcggaggtcggtcttgaagtcctgcgcgatctcccgg 352
           ||   ||| ||||| |||||||| || || ||||||||||||||||| |||||||| || 
Sbjct: 275 gcaaggacagcggacgactggaaacgcagatcggtcttgaagtcctgggcgatctcacgc 216

                                                                
Query: 353 acgaggcgctgaaaggggagcttgcggatgagcagctccgtgctcttctggta 405
           || || | ||| || ||||||||||||||||| || || |||  |||||||||
Sbjct: 215 acaagtctctggaaagggagcttgcggatgagaaggtcagtggacttctggta 163



to top

>emb|AL592149.8| Mouse DNA sequence from clone RP23-283N14 on chromosome 13 Contains a
             novel gene, the genes for three H1, four H2a, five H2b,
             four H3 and four H4 histone family members, the 3' end of
             a variant of the Hfe gene for hemochromatosis protein
             (Mr2) and ten CpG islands, complete sequence
          Length = 184730

 Score =  216 bits (109), Expect = 4e-53
 Identities = 196/225 (87%)
 Strand = Plus / Minus

                                                                         
Query: 166   ctccccgcggatgcggcgggcgagctggatgtccttgggcatgattgtgacgcgcttggc 225
             ||||||||||||||| ||||| ||||||||||||||||||||||| ||||| ||||||||
Sbjct: 16449 ctccccgcggatgcgacgggccagctggatgtccttgggcatgatggtgacacgcttggc 16390

                                                                         
Query: 226   gtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtacgcctcggcggcctc 285
             |||||||||||| |||||||||||||| || || || |||||||| |||||   ||||||
Sbjct: 16389 gtggatggcgcacaggttggtgtcctcaaacagacccacgaggtaggcctcacaggcctc 16330

                                                                         
Query: 286   ctggagcgcggagacggcggaggactggaagcggaggtcggtcttgaagtcctgcgcgat 345
             ||| || ||   |||||| |||  ||||||||| ||||||||||||||||||||||||||
Sbjct: 16329 ctgcagagccatgacggccgagctctggaagcgcaggtcggtcttgaagtcctgcgcgat 16270

                                                          
Query: 346   ctcccggacgaggcgctgaaaggggagcttgcggatgagcagctc 390
             ||| || || |||||||| || || ||||||||||| ||||||||
Sbjct: 16269 ctcgcgcaccaggcgctggaacggcagcttgcggatcagcagctc 16225



 Score =  212 bits (107), Expect = 7e-52
 Identities = 197/227 (86%)
 Strand = Plus / Plus

                                                                         
Query: 164   cgctccccgcggatgcggcgggcgagctggatgtccttgggcatgattgtgacgcgcttg 223
             ||||| |||||||| |||||||| ||||||||||||||||||||||| ||||| ||||||
Sbjct: 42568 cgctcgccgcggatacggcgggccagctggatgtccttgggcatgatggtgacacgcttg 42627

                                                                         
Query: 224   gcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtacgcctcggcggcc 283
             |||||||||||||| |||||||||||||| || || || |||||||| ||||||   |||
Sbjct: 42628 gcgtggatggcgcacaggttggtgtcctcaaacagacccacgaggtaggcctcgctcgcc 42687

                                                                         
Query: 284   tcctggagcgcggagacggcggaggactggaagcggaggtcggtcttgaagtcctgcgcg 343
             ||||| || ||   |||||| |||  ||||||||| ||||||||||||||||||||||||
Sbjct: 42688 tcctgcagagccatgacggccgagctctggaagcgcaggtcggtcttgaagtcctgcgcg 42747

                                                            
Query: 344   atctcccggacgaggcgctgaaaggggagcttgcggatgagcagctc 390
             ||||| || || |||||||| || || ||||||||||| ||||||||
Sbjct: 42748 atctcgcgcaccaggcgctggaacggcagcttgcggatcagcagctc 42794



 Score =  204 bits (103), Expect = 2e-49
 Identities = 196/227 (86%)
 Strand = Plus / Minus

                                                                         
Query: 164   cgctccccgcggatgcggcgggcgagctggatgtccttgggcatgattgtgacgcgcttg 223
             ||||| |||||||| |||||||| ||||||||||||||||||||||| ||||| ||||||
Sbjct: 25490 cgctcgccgcggatacggcgggccagctggatgtccttgggcatgatggtgacacgcttg 25431

                                                                         
Query: 224   gcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtacgcctcggcggcc 283
             |||||||||||||| |||||||||||||| || || || || ||||| ||||||   |||
Sbjct: 25430 gcgtggatggcgcacaggttggtgtcctcaaacagacccacaaggtaggcctcgctcgcc 25371

                                                                         
Query: 284   tcctggagcgcggagacggcggaggactggaagcggaggtcggtcttgaagtcctgcgcg 343
             ||||| || ||   |||||| |||  ||||||||| ||||||||||||||||||||||||
Sbjct: 25370 tcctgcagagccatgacggccgagctctggaagcgcaggtcggtcttgaagtcctgcgcg 25311

                                                            
Query: 344   atctcccggacgaggcgctgaaaggggagcttgcggatgagcagctc 390
             ||||| || || |||||||| || || ||||||||||| ||||||||
Sbjct: 25310 atctcgcgcaccaggcgctggaacggcagcttgcggatcagcagctc 25264



 Score =  192 bits (97), Expect = 6e-46
 Identities = 193/225 (85%)
 Strand = Plus / Minus

                                                                         
Query: 166   ctccccgcggatgcggcgggcgagctggatgtccttgggcatgattgtgacgcgcttggc 225
             |||||| || ||||| ||||| ||||||||||||||||||||||| ||||| ||||||||
Sbjct: 56809 ctccccacgaatgcgacgggccagctggatgtccttgggcatgatggtgacacgcttggc 56750

                                                                         
Query: 226   gtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtacgcctcggcggcctc 285
             ||||||||| || |||||||||||||| || || || |||||||| ||||||   |||||
Sbjct: 56749 gtggatggcacacaggttggtgtcctcaaacagacccacgaggtaggcctcgctcgcctc 56690

                                                                         
Query: 286   ctggagcgcggagacggcggaggactggaagcggaggtcggtcttgaagtcctgcgcgat 345
             ||| || ||   |||||| |||  ||||||||| ||||||||||||||||||||||||||
Sbjct: 56689 ctgcagagccatgacggccgagctctggaagcgcaggtcggtcttgaagtcctgcgcgat 56630

                                                          
Query: 346   ctcccggacgaggcgctgaaaggggagcttgcggatgagcagctc 390
             ||| || || |||||||| || || ||||||||||| ||||||||
Sbjct: 56629 ctcgcgcaccaggcgctggaacggcagcttgcggatcagcagctc 56585



to top

>gb|AY158946.1| Mus musculus histone protein Hist1h3g gene, complete cds
          Length = 1405

 Score =  216 bits (109), Expect = 4e-53
 Identities = 196/225 (87%)
 Strand = Plus / Minus

                                                                       
Query: 166 ctccccgcggatgcggcgggcgagctggatgtccttgggcatgattgtgacgcgcttggc 225
           ||||||||||||||| ||||| ||||||||||||||||||||||| ||||| ||||||||
Sbjct: 899 ctccccgcggatgcgacgggccagctggatgtccttgggcatgatggtgacacgcttggc 840

                                                                       
Query: 226 gtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtacgcctcggcggcctc 285
           |||||||||||| |||||||||||||| || || || |||||||| |||||   ||||||
Sbjct: 839 gtggatggcgcacaggttggtgtcctcaaacagacccacgaggtaggcctcacaggcctc 780

                                                                       
Query: 286 ctggagcgcggagacggcggaggactggaagcggaggtcggtcttgaagtcctgcgcgat 345
           ||| || ||   |||||| |||  ||||||||| ||||||||||||||||||||||||||
Sbjct: 779 ctgcagagccatgacggccgagctctggaagcgcaggtcggtcttgaagtcctgcgcgat 720

                                                        
Query: 346 ctcccggacgaggcgctgaaaggggagcttgcggatgagcagctc 390
           ||| || || |||||||| || || ||||||||||| ||||||||
Sbjct: 719 ctcgcgcaccaggcgctggaacggcagcttgcggatcagcagctc 675



to top

>emb|X01684.1|MMHISH31 Mouse gene (H3.1) for histone H3
          Length = 1244

 Score =  216 bits (109), Expect = 4e-53
 Identities = 196/225 (87%)
 Strand = Plus / Minus

                                                                       
Query: 166 ctccccgcggatgcggcgggcgagctggatgtccttgggcatgattgtgacgcgcttggc 225
           ||||||||||||||| ||||| ||||||||||||||||||||||| ||||| ||||||||
Sbjct: 754 ctccccgcggatgcgacgggccagctggatgtccttgggcatgatggtgacacgcttggc 695

                                                                       
Query: 226 gtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtacgcctcggcggcctc 285
           |||||||||||| |||||||||||||| || || || |||||||| |||||   ||||||
Sbjct: 694 gtggatggcgcacaggttggtgtcctcaaacagacccacgaggtaggcctcacaggcctc 635

                                                                       
Query: 286 ctggagcgcggagacggcggaggactggaagcggaggtcggtcttgaagtcctgcgcgat 345
           ||| || ||   |||||| |||  ||||||||| ||||||||||||||||||||||||||
Sbjct: 634 ctgcagagccatgacggccgagctctggaagcgcaggtcggtcttgaagtcctgcgcgat 575

                                                        
Query: 346 ctcccggacgaggcgctgaaaggggagcttgcggatgagcagctc 390
           ||| || || |||||||| || || ||||||||||| ||||||||
Sbjct: 574 ctcgcgcaccaggcgctggaacggcagcttgcggatcagcagctc 530



to top

>gb|AY749746.1| Proboscidoplocia sp. EP162 histone H3 (H3) gene, partial cds
          Length = 313

 Score =  216 bits (109), Expect = 4e-53
 Identities = 181/205 (88%)
 Strand = Plus / Minus

                                                                       
Query: 198 ccttgggcatgattgtgacgcgcttggcgtggatggcgcagaggttggtgtcctcgaaga 257
           ||||||||||||| ||||| |||||||||||||||||||| ||||||||||||||||| |
Sbjct: 313 ccttgggcatgatggtgacacgcttggcgtggatggcgcaaaggttggtgtcctcgaaca 254

                                                                       
Query: 258 gcccgacgaggtacgcctcggcggcctcctggagcgcggagacggcggaggactggaagc 317
           | ||||| ||||| ||||||   ||||||||||| ||   |||||| |||  ||||||||
Sbjct: 253 ggccgactaggtaggcctcgctagcctcctggagggccatgacggcagagctctggaagc 194

                                                                       
Query: 318 ggaggtcggtcttgaagtcctgcgcgatctcccggacgaggcgctgaaaggggagcttgc 377
           | |||||||||||||||||||| |||||||| |||||||||||||| ||||| |||||||
Sbjct: 193 gcaggtcggtcttgaagtcctgagcgatctcacggacgaggcgctggaagggcagcttgc 134

                                    
Query: 378 ggatgagcagctccgtgctcttctg 402
           |||||||||| || |||||||||||
Sbjct: 133 ggatgagcagttcagtgctcttctg 109



to top

>gb|AY749737.1| Platybaetis probus histone H3 (H3) gene, partial cds
          Length = 376

 Score =  216 bits (109), Expect = 4e-53
 Identities = 184/209 (88%)
 Strand = Plus / Minus

                                                                       
Query: 197 tccttgggcatgattgtgacgcgcttggcgtggatggcgcagaggttggtgtcctcgaag 256
           |||||||||||||| |||||||||||||||||||||||||| | ||||||||||||||||
Sbjct: 371 tccttgggcatgatggtgacgcgcttggcgtggatggcgcacaagttggtgtcctcgaag 312

                                                                       
Query: 257 agcccgacgaggtacgcctcggcggcctcctggagcgcggagacggcggaggactggaag 316
           || ||||||||||| ||||||  ||||||||| || ||    ||||| |||  |||||||
Sbjct: 311 aggccgacgaggtaggcctcgctggcctcctgcagggccatcacggccgagctctggaag 252

                                                                       
Query: 317 cggaggtcggtcttgaagtcctgcgcgatctcccggacgaggcgctgaaaggggagcttg 376
           || |||||||||||||||||||| |||||||| || ||||| ||||| || || ||||||
Sbjct: 251 cgcaggtcggtcttgaagtcctgagcgatctcacgcacgagccgctggaacggcagcttg 192

                                        
Query: 377 cggatgagcagctccgtgctcttctggta 405
           |||||||||||||| ||||||||||||||
Sbjct: 191 cggatgagcagctcggtgctcttctggta 163



to top

>gb|AY749708.1| Baetis tricaudatus histone H3 (H3) gene, partial cds
          Length = 375

 Score =  216 bits (109), Expect = 4e-53
 Identities = 184/209 (88%)
 Strand = Plus / Minus

                                                                       
Query: 197 tccttgggcatgattgtgacgcgcttggcgtggatggcgcagaggttggtgtcctcgaag 256
           |||||||||||||| |||||||||||||||||||||||||| ||||||||||||||||||
Sbjct: 371 tccttgggcatgatggtgacgcgcttggcgtggatggcgcacaggttggtgtcctcgaag 312

                                                                       
Query: 257 agcccgacgaggtacgcctcggcggcctcctggagcgcggagacggcggaggactggaag 316
           || ||||| ||||| ||||||  ||||||||| || ||    ||||| |||  |||||||
Sbjct: 311 aggccgaccaggtaagcctcgctggcctcctgcagggccatcacggccgagctctggaag 252

                                                                       
Query: 317 cggaggtcggtcttgaagtcctgcgcgatctcccggacgaggcgctgaaaggggagcttg 376
           || |||||||||||||||||||| |||||||| || || || ||||| ||||| ||||||
Sbjct: 251 cgcaggtcggtcttgaagtcctgggcgatctcacgcaccagacgctggaagggcagcttg 192

                                        
Query: 377 cggatgagcagctccgtgctcttctggta 405
           |||||||||||||| ||||||||||||||
Sbjct: 191 cggatgagcagctcggtgctcttctggta 163



to top

>gb|M32460.1|MUSHIS3B Mouse histone H3 (H3.1-221) gene, complete cds
          Length = 1125

 Score =  216 bits (109), Expect = 4e-53
 Identities = 196/225 (87%)
 Strand = Plus / Minus

                                                                       
Query: 166 ctccccgcggatgcggcgggcgagctggatgtccttgggcatgattgtgacgcgcttggc 225
           ||||||||||||||| ||||| ||||||||||||||||||||||| ||||| ||||||||
Sbjct: 754 ctccccgcggatgcgacgggccagctggatgtccttgggcatgatggtgacacgcttggc 695

                                                                       
Query: 226 gtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtacgcctcggcggcctc 285
           |||||||||||| |||||||||||||| || || || |||||||| |||||   ||||||
Sbjct: 694 gtggatggcgcacaggttggtgtcctcaaacagacccacgaggtaggcctcacaggcctc 635

                                                                       
Query: 286 ctggagcgcggagacggcggaggactggaagcggaggtcggtcttgaagtcctgcgcgat 345
           ||| || ||   |||||| |||  ||||||||| ||||||||||||||||||||||||||
Sbjct: 634 ctgcagagccatgacggccgagctctggaagcgcaggtcggtcttgaagtcctgcgcgat 575

                                                        
Query: 346 ctcccggacgaggcgctgaaaggggagcttgcggatgagcagctc 390
           ||| || || |||||||| || || ||||||||||| ||||||||
Sbjct: 574 ctcgcgcaccaggcgctggaacggcagcttgcggatcagcagctc 530



to top

>ref|XM_868935.1| PREDICTED: Bos taurus similar to histone 1, H2ai (predicted)
           (LOC616819), mRNA
          Length = 411

 Score =  214 bits (108), Expect = 2e-52
 Identities = 207/240 (86%)
 Strand = Plus / Minus

                                                                       
Query: 166 ctccccgcggatgcggcgggcgagctggatgtccttgggcatgattgtgacgcgcttggc 225
           |||||||||||||||||| || ||||||||||||||||||||||| ||||||||||||||
Sbjct: 402 ctccccgcggatgcggcgagcaagctggatgtccttgggcatgatagtgacgcgcttggc 343

                                                                       
Query: 226 gtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtacgcctcggcggcctc 285
           ||||||||| || ||||||||||| ||||||||||| || || || ||||||   |||||
Sbjct: 342 gtggatggcacacaggttggtgtcttcgaagagccccaccagataggcctcgcacgcctc 283

                                                                       
Query: 286 ctggagcgcggagacggcggaggactggaagcggaggtcggtcttgaagtcctgcgcgat 345
           ||| |||||    ||||| |||  ||||||||| ||||| ||||||||||||||||||||
Sbjct: 282 ctgcagcgccatcacggccgagctctggaagcgcaggtcagtcttgaagtcctgcgcgat 223

                                                                       
Query: 346 ctcccggacgaggcgctgaaaggggagcttgcggatgagcagctccgtgctcttctggta 405
           ||| || || || ||||| || || ||||||||||| ||||||||||||  |||||||||
Sbjct: 222 ctcgcgtaccagccgctggaacggcagcttgcggatcagcagctccgtggacttctggta 163



to top

>gb|AY338636.1| Calopteryx aequabilis histone 3 gene, partial cds
          Length = 345

 Score =  214 bits (108), Expect = 2e-52
 Identities = 180/204 (88%)
 Strand = Plus / Minus

                                                                       
Query: 202 gggcatgattgtgacgcgcttggcgtggatggcgcagaggttggtgtcctcgaagagccc 261
           ||||||||| |||||||||||||||||||| ||||| |||||||||||||||||||| ||
Sbjct: 345 gggcatgatggtgacgcgcttggcgtggatcgcgcacaggttggtgtcctcgaagagacc 286

                                                                       
Query: 262 gacgaggtacgcctcggcggcctcctggagcgcggagacggcggaggactggaagcggag 321
            |||||||| ||||||  |||||||||||| ||   |||||| |||  ||||||||||||
Sbjct: 285 cacgaggtaagcctcgctggcctcctggagtgccatgacggcagagctctggaagcggag 226

                                                                       
Query: 322 gtcggtcttgaagtcctgcgcgatctcccggacgaggcgctgaaaggggagcttgcggat 381
           |||||||||||| ||||| |||||||| ||||| |  ||||| ||||| |||||||||||
Sbjct: 225 gtcggtcttgaaatcctgagcgatctcacggaccaaacgctggaagggcagcttgcggat 166

                                   
Query: 382 gagcagctccgtgctcttctggta 405
           ||| ||||||||||||||||||||
Sbjct: 165 gaggagctccgtgctcttctggta 142



to top

>gb|AY338628.1| Isonychia sp. EP017 histone 3 gene, partial cds
          Length = 345

 Score =  214 bits (108), Expect = 2e-52
 Identities = 180/204 (88%)
 Strand = Plus / Minus

                                                                       
Query: 202 gggcatgattgtgacgcgcttggcgtggatggcgcagaggttggtgtcctcgaagagccc 261
           ||||||||| |||||||||||||||||||||||||| | |||||||||||||||||| ||
Sbjct: 345 gggcatgatggtgacgcgcttggcgtggatggcgcacaagttggtgtcctcgaagagacc 286

                                                                       
Query: 262 gacgaggtacgcctcggcggcctcctggagcgcggagacggcggaggactggaagcggag 321
            |||||||| ||||||   |||||||| || ||   ||||||||||  ||||||||| ||
Sbjct: 285 tacgaggtaagcctcgcttgcctcctgcagggccatgacggcggagctctggaagcgcag 226

                                                                       
Query: 322 gtcggtcttgaagtcctgcgcgatctcccggacgaggcgctgaaaggggagcttgcggat 381
           |||||||||||||||||| |||||||| || || |||||||| ||||| |||||||||||
Sbjct: 225 gtcggtcttgaagtcctgtgcgatctcacgcaccaggcgctggaagggcagcttgcggat 166

                                   
Query: 382 gagcagctccgtgctcttctggta 405
           ||||||||| ||||||||||||||
Sbjct: 165 gagcagctcagtgctcttctggta 142



to top

>gb|BC107285.1| Mus musculus histone 1, H3a, mRNA (cDNA clone IMAGE:40053006),
           partial cds
          Length = 417

 Score =  212 bits (107), Expect = 7e-52
 Identities = 197/227 (86%)
 Strand = Plus / Minus

                                                                       
Query: 164 cgctccccgcggatgcggcgggcgagctggatgtccttgggcatgattgtgacgcgcttg 223
           ||||| |||||||| |||||||| ||||||||||||||||||||||| ||||| ||||||
Sbjct: 402 cgctcgccgcggatacggcgggccagctggatgtccttgggcatgatggtgacacgcttg 343

                                                                       
Query: 224 gcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtacgcctcggcggcc 283
           |||||||||||||| |||||||||||||| || || || |||||||| |||||   ||||
Sbjct: 342 gcgtggatggcgcacaggttggtgtcctcaaacagacccacgaggtaggcctcacaggcc 283

                                                                       
Query: 284 tcctggagcgcggagacggcggaggactggaagcggaggtcggtcttgaagtcctgcgcg 343
           ||||| || ||   |||||| |||  ||||||||| ||||||||||||||||||||||||
Sbjct: 282 tcctgcagagccatgacggccgagctctggaagcgcaggtcggtcttgaagtcctgcgcg 223

                                                          
Query: 344 atctcccggacgaggcgctgaaaggggagcttgcggatgagcagctc 390
           ||||| || || |||||||| || || ||||||||||| ||||||||
Sbjct: 222 atctcgcgcaccaggcgctggaacggcagcttgcggatcagcagctc 176



to top

>ref|NM_178205.1| Mus musculus histone 1, H3e (Hist1h3e), mRNA
          Length = 411

 Score =  212 bits (107), Expect = 7e-52
 Identities = 197/227 (86%)
 Strand = Plus / Minus

                                                                       
Query: 164 cgctccccgcggatgcggcgggcgagctggatgtccttgggcatgattgtgacgcgcttg 223
           ||||| |||||||| |||||||| ||||||||||||||||||||||| ||||| ||||||
Sbjct: 404 cgctcgccgcggatacggcgggccagctggatgtccttgggcatgatggtgacacgcttg 345

                                                                       
Query: 224 gcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtacgcctcggcggcc 283
           |||||||||||||| |||||||||||||| || || || |||||||| ||||||   |||
Sbjct: 344 gcgtggatggcgcacaggttggtgtcctcaaacagacccacgaggtaggcctcgctcgcc 285

                                                                       
Query: 284 tcctggagcgcggagacggcggaggactggaagcggaggtcggtcttgaagtcctgcgcg 343
           ||||| || ||   |||||| |||  ||||||||| ||||||||||||||||||||||||
Sbjct: 284 tcctgcagagccatgacggccgagctctggaagcgcaggtcggtcttgaagtcctgcgcg 225

                                                          
Query: 344 atctcccggacgaggcgctgaaaggggagcttgcggatgagcagctc 390
           ||||| || || |||||||| || || ||||||||||| ||||||||
Sbjct: 224 atctcgcgcaccaggcgctggaacggcagcttgcggatcagcagctc 178



to top

>gb|DQ284377.1| Rana guentheri histone H3a gene, partial cds
          Length = 328

 Score =  212 bits (107), Expect = 7e-52
 Identities = 155/171 (90%)
 Strand = Plus / Minus

                                                                       
Query: 220 cttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtacgcctcggc 279
           |||||||||||||||||||||||||||||||||||||||||| ||||| || ||||||| 
Sbjct: 325 cttggcgtggatggcgcagaggttggtgtcctcgaagagccctacgagataagcctcgga 266

                                                                       
Query: 280 ggcctcctggagcgcggagacggcggaggactggaagcggaggtcggtcttgaagtcctg 339
           ||||||||| || ||   ||||||||||  ||||||||| ||||||||||||||||||||
Sbjct: 265 ggcctcctgcagagccatgacggcggagctctggaagcgcaggtcggtcttgaagtcctg 206

                                                              
Query: 340 cgcgatctcccggacgaggcgctgaaaggggagcttgcggatgagcagctc 390
            |||||||| |||||||||||||| ||||| ||||||||||||||||||||
Sbjct: 205 ggcgatctctcggacgaggcgctggaagggcagcttgcggatgagcagctc 155



to top

>gb|DQ284287.1| Rana guentheri histone H3a gene, partial cds
          Length = 328

 Score =  212 bits (107), Expect = 7e-52
 Identities = 155/171 (90%)
 Strand = Plus / Minus

                                                                       
Query: 220 cttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtacgcctcggc 279
           |||||||||||||||||||||||||||||||||||||||||| ||||| || ||||||| 
Sbjct: 325 cttggcgtggatggcgcagaggttggtgtcctcgaagagccctacgagataagcctcgga 266

                                                                       
Query: 280 ggcctcctggagcgcggagacggcggaggactggaagcggaggtcggtcttgaagtcctg 339
           ||||||||| || ||   ||||||||||  ||||||||| ||||||||||||||||||||
Sbjct: 265 ggcctcctgcagagccatgacggcggagctctggaagcgcaggtcggtcttgaagtcctg 206

                                                              
Query: 340 cgcgatctcccggacgaggcgctgaaaggggagcttgcggatgagcagctc 390
            |||||||| |||||||||||||| ||||| ||||||||||||||||||||
Sbjct: 205 ggcgatctctcggacgaggcgctggaagggcagcttgcggatgagcagctc 155



to top

>gb|DQ284223.1| Rana aurora histone H3a gene, partial cds
          Length = 328

 Score =  212 bits (107), Expect = 7e-52
 Identities = 155/171 (90%)
 Strand = Plus / Minus

                                                                       
Query: 220 cttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtacgcctcggc 279
           ||||||||||||||||||||||||||||||||||||||| || |||||||| ||||||| 
Sbjct: 325 cttggcgtggatggcgcagaggttggtgtcctcgaagagtcctacgaggtaagcctcgga 266

                                                                       
Query: 280 ggcctcctggagcgcggagacggcggaggactggaagcggaggtcggtcttgaagtcctg 339
           ||||||||| || ||   ||||||||||  ||||||||| ||||||||||||||||||||
Sbjct: 265 ggcctcctgcagagccatgacggcggagctctggaagcgcaggtcggtcttgaagtcctg 206

                                                              
Query: 340 cgcgatctcccggacgaggcgctgaaaggggagcttgcggatgagcagctc 390
            |||||||| |||||||||||||| ||||| ||||||||||||||||||||
Sbjct: 205 ggcgatctctcggacgaggcgctggaagggcagcttgcggatgagcagctc 155



to top

>gb|DQ284219.1| Rana clamitans histone H3a gene, partial cds
          Length = 328

 Score =  212 bits (107), Expect = 7e-52
 Identities = 155/171 (90%)
 Strand = Plus / Minus

                                                                       
Query: 220 cttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtacgcctcggc 279
           ||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||| | 
Sbjct: 325 cttggcgtggatggcgcagaggttggtgtcctcgaagagtccgacgaggtaagcctcaga 266

                                                                       
Query: 280 ggcctcctggagcgcggagacggcggaggactggaagcggaggtcggtcttgaagtcctg 339
           ||||||||| || ||   ||||||||||  ||||||||| ||||||||||||||||||||
Sbjct: 265 ggcctcctgcagagccatgacggcggagctctggaagcgcaggtcggtcttgaagtcctg 206

                                                              
Query: 340 cgcgatctcccggacgaggcgctgaaaggggagcttgcggatgagcagctc 390
            |||||||| |||||||||||||| ||||| ||||||||||||||||||||
Sbjct: 205 ggcgatctctcggacgaggcgctggaagggcagcttgcggatgagcagctc 155



to top

>gb|DQ284180.1| Staurois tuberilinguis histone H3a gene, partial cds
          Length = 328

 Score =  212 bits (107), Expect = 7e-52
 Identities = 155/171 (90%)
 Strand = Plus / Minus

                                                                       
Query: 220 cttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtacgcctcggc 279
           ||||||||||||||||||||||||||||||||||||||| |||||||| || ||||| ||
Sbjct: 325 cttggcgtggatggcgcagaggttggtgtcctcgaagagtccgacgagataagcctctgc 266

                                                                       
Query: 280 ggcctcctggagcgcggagacggcggaggactggaagcggaggtcggtcttgaagtcctg 339
           ||||||||| || ||   ||||||||||  ||||||||| ||||||||||||||||||||
Sbjct: 265 ggcctcctgcagagccatgacggcggagctctggaagcgcaggtcggtcttgaagtcctg 206

                                                              
Query: 340 cgcgatctcccggacgaggcgctgaaaggggagcttgcggatgagcagctc 390
            |||||||| |||||||||||||| ||||| ||||||||||||||||||||
Sbjct: 205 ggcgatctctcggacgaggcgctggaagggcagcttgcggatgagcagctc 155



to top

>gb|DQ284168.1| Pseudoamolops sauteri histone H3a gene, partial cds
          Length = 328

 Score =  212 bits (107), Expect = 7e-52
 Identities = 155/171 (90%)
 Strand = Plus / Minus

                                                                       
Query: 220 cttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtacgcctcggc 279
           ||||||||||||||||||||||||||||||||||||||| |||||||| || ||||||| 
Sbjct: 325 cttggcgtggatggcgcagaggttggtgtcctcgaagagtccgacgagataagcctcgga 266

                                                                       
Query: 280 ggcctcctggagcgcggagacggcggaggactggaagcggaggtcggtcttgaagtcctg 339
           ||||||||| || ||   ||||||||||  ||||||||| ||||||||||||||||||||
Sbjct: 265 ggcctcctgcagagccatgacggcggagctctggaagcgcaggtcggtcttgaagtcctg 206

                                                              
Query: 340 cgcgatctcccggacgaggcgctgaaaggggagcttgcggatgagcagctc 390
            |||||||| |||||||||||||| ||||| ||||||||||||||||||||
Sbjct: 205 ggcgatctctcggacgaggcgctggaagggcagcttgcggatgagcagctc 155



to top

>gb|U62671.1|MMU62671 Mus musculus histone H3.2-B (H3-B) gene, complete cds
          Length = 1100

 Score =  212 bits (107), Expect = 7e-52
 Identities = 197/227 (86%)
 Strand = Plus / Minus

                                                                       
Query: 164 cgctccccgcggatgcggcgggcgagctggatgtccttgggcatgattgtgacgcgcttg 223
           ||||| |||||||| |||||||| ||||||||||||||||||||||| ||||| ||||||
Sbjct: 890 cgctcgccgcggatacggcgggccagctggatgtccttgggcatgatggtgacacgcttg 831

                                                                       
Query: 224 gcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtacgcctcggcggcc 283
           |||||||||||||| |||||||||||||| || || || |||||||| ||||||   |||
Sbjct: 830 gcgtggatggcgcacaggttggtgtcctcaaacagacccacgaggtaggcctcgctcgcc 771

                                                                       
Query: 284 tcctggagcgcggagacggcggaggactggaagcggaggtcggtcttgaagtcctgcgcg 343
           ||||| || ||   |||||| |||  ||||||||| ||||||||||||||||||||||||
Sbjct: 770 tcctgcagagccatgacggccgagctctggaagcgcaggtcggtcttgaagtcctgcgcg 711

                                                          
Query: 344 atctcccggacgaggcgctgaaaggggagcttgcggatgagcagctc 390
           ||||| || || |||||||| || || ||||||||||| ||||||||
Sbjct: 710 atctcgcgcaccaggcgctggaacggcagcttgcggatcagcagctc 664



to top

>dbj|AB185075.1| Conocephalum conicum H3 gene for histone 3, complete cds, clone:
           YFS47
          Length = 500

 Score =  212 bits (107), Expect = 7e-52
 Identities = 209/243 (86%)
 Strand = Plus / Minus

                                                                       
Query: 163 gcgctccccgcggatgcggcgggcgagctggatgtccttgggcatgattgtgacgcgctt 222
           |||||| || |||| |||||||||||||||||||||||||| |  ||| ||||| |||||
Sbjct: 494 gcgctcgcctcggaggcggcgggcgagctggatgtccttggactggatggtgacacgctt 435

                                                                       
Query: 223 ggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtacgcctcggcggc 282
           ||||||||||||||| ||||||||||||||||||||   ||||||||| | |||| ||| 
Sbjct: 434 ggcgtggatggcgcacaggttggtgtcctcgaagagggagacgaggtaagactcgacgga 375

                                                                       
Query: 283 ctcctggagcgcggagacggcggaggactggaagcggaggtcggtcttgaagtcctgcgc 342
           ||||||||| ||   || |||||| |||||||||||||||||| ||||||| ||||| ||
Sbjct: 374 ctcctggagagcaccgatggcggaagactggaagcggaggtcgctcttgaaatcctgggc 315

                                                                       
Query: 343 gatctcccggacgaggcgctgaaaggggagcttgcggatgagcagctccgtgctcttctg 402
            ||||| |||||||| ||||| ||||||||||||||||| || ||||| |||  ||||||
Sbjct: 314 aatctcacggacgagacgctggaaggggagcttgcggatcagaagctcggtggacttctg 255

              
Query: 403 gta 405
           |||
Sbjct: 254 gta 252



to top

>gb|AY158948.1| Mus musculus histone protein Hist1h3e gene, complete cds
          Length = 1408

 Score =  212 bits (107), Expect = 7e-52
 Identities = 197/227 (86%)
 Strand = Plus / Minus

                                                                       
Query: 164 cgctccccgcggatgcggcgggcgagctggatgtccttgggcatgattgtgacgcgcttg 223
           ||||| |||||||| |||||||| ||||||||||||||||||||||| ||||| ||||||
Sbjct: 904 cgctcgccgcggatacggcgggccagctggatgtccttgggcatgatggtgacacgcttg 845

                                                                       
Query: 224 gcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtacgcctcggcggcc 283
           |||||||||||||| |||||||||||||| || || || |||||||| ||||||   |||
Sbjct: 844 gcgtggatggcgcacaggttggtgtcctcaaacagacccacgaggtaggcctcgctcgcc 785

                                                                       
Query: 284 tcctggagcgcggagacggcggaggactggaagcggaggtcggtcttgaagtcctgcgcg 343
           ||||| || ||   |||||| |||  ||||||||| ||||||||||||||||||||||||
Sbjct: 784 tcctgcagagccatgacggccgagctctggaagcgcaggtcggtcttgaagtcctgcgcg 725

                                                          
Query: 344 atctcccggacgaggcgctgaaaggggagcttgcggatgagcagctc 390
           ||||| || || |||||||| || || ||||||||||| ||||||||
Sbjct: 724 atctcgcgcaccaggcgctggaacggcagcttgcggatcagcagctc 678



to top

>gb|AY662892.1| Etroplus maculatus histone H3a gene, partial cds
          Length = 333

 Score =  212 bits (107), Expect = 7e-52
 Identities = 155/171 (90%)
 Strand = Plus / Minus

                                                                       
Query: 220 cttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtacgcctcggc 279
           |||||||||||||||||| |||||||||||||||||||||||||||||||| ||||||  
Sbjct: 329 cttggcgtggatggcgcacaggttggtgtcctcgaagagcccgacgaggtaagcctcgct 270

                                                                       
Query: 280 ggcctcctggagcgcggagacggcggaggactggaagcggaggtcggtcttgaagtcctg 339
           ||||||||| || ||   ||||||||||  ||||||||| ||||||||||||||||||||
Sbjct: 269 ggcctcctgcagagccatgacggcggagctctggaagcgcaggtcggtcttgaagtcctg 210

                                                              
Query: 340 cgcgatctcccggacgaggcgctgaaaggggagcttgcggatgagcagctc 390
            |||||||| |||||||||||||| ||||| ||||||||||||||||||||
Sbjct: 209 agcgatctcacggacgaggcgctggaagggcagcttgcggatgagcagctc 159



to top

>ref|NM_019469.1| Mus musculus histone 2, H3c1 (Hist2h3c1), transcript variant 1,
           mRNA
          Length = 411

 Score =  210 bits (106), Expect = 3e-51
 Identities = 199/230 (86%)
 Strand = Plus / Minus

                                                                       
Query: 161 gcgcgctccccgcggatgcggcgggcgagctggatgtccttgggcatgattgtgacgcgc 220
           ||||||||||| |||||||||||||| | ||||||||||||||||||||| |||||||| 
Sbjct: 407 gcgcgctccccacggatgcggcgggccaactggatgtccttgggcatgatggtgacgcgt 348

                                                                       
Query: 221 ttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtacgcctcggcg 280
           |||||||| |||||||| ||||||||||||||||| ||||| || ||||| ||||||   
Sbjct: 347 ttggcgtgcatggcgcacaggttggtgtcctcgaacagccccaccaggtaggcctcgctc 288

                                                                       
Query: 281 gcctcctggagcgcggagacggcggaggactggaagcggaggtcggtcttgaagtcctgc 340
           |||||||| |||||   |||||| |||  ||||||||| ||||| |||||||||||||||
Sbjct: 287 gcctcctgcagcgccatgacggccgagctctggaagcgcaggtccgtcttgaagtcctgc 228

                                                             
Query: 341 gcgatctcccggacgaggcgctgaaaggggagcttgcggatgagcagctc 390
           |||||||| || || | |||||| || || ||||||||||| ||||||||
Sbjct: 227 gcgatctcgcgcaccaagcgctggaacggcagcttgcggatcagcagctc 178



to top

>emb|X16148.1|MMHIS2A3 Mouse H2a and H3 histone genes
          Length = 3098

 Score =  210 bits (106), Expect = 3e-51
 Identities = 199/230 (86%)
 Strand = Plus / Minus

                                                                        
Query: 161  gcgcgctccccgcggatgcggcgggcgagctggatgtccttgggcatgattgtgacgcgc 220
            ||||||||||| |||||||||||||| | ||||||||||||||||||||| |||||||| 
Sbjct: 2579 gcgcgctccccacggatgcggcgggccaactggatgtccttgggcatgatggtgacgcgt 2520

                                                                        
Query: 221  ttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtacgcctcggcg 280
            |||||||| |||||||| ||||||||||||||||| ||||| || ||||| ||||||   
Sbjct: 2519 ttggcgtgcatggcgcacaggttggtgtcctcgaacagccccaccaggtaggcctcgctc 2460

                                                                        
Query: 281  gcctcctggagcgcggagacggcggaggactggaagcggaggtcggtcttgaagtcctgc 340
            |||||||| |||||   |||||| |||  ||||||||| ||||| |||||||||||||||
Sbjct: 2459 gcctcctgcagcgccatgacggccgagctctggaagcgcaggtccgtcttgaagtcctgc 2400

                                                              
Query: 341  gcgatctcccggacgaggcgctgaaaggggagcttgcggatgagcagctc 390
            |||||||| || || | |||||| || || ||||||||||| ||||||||
Sbjct: 2399 gcgatctcgcgcaccaagcgctggaacggcagcttgcggatcagcagctc 2350



to top

>emb|X03952.1|SPHISH34 Sea urchin (S. purpuratus) late embryonic H3 and H4 histone genes
          Length = 2506

 Score =  210 bits (106), Expect = 3e-51
 Identities = 208/242 (85%)
 Strand = Plus / Minus

                                                                        
Query: 164  cgctccccgcggatgcggcgggcgagctggatgtccttgggcatgattgtgacgcgcttg 223
            ||||| || |||||||||||||| |||||||||||||| |||||||| || || ||||||
Sbjct: 2409 cgctcgccacggatgcggcgggccagctggatgtcctttggcatgatggtaacacgcttg 2350

                                                                        
Query: 224  gcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtacgcctcggcggcc 283
            |||||||||||||| ||||||||||||||||| || | ||| | ||| || |||  ||||
Sbjct: 2349 gcgtggatggcgcaaaggttggtgtcctcgaaaagacggaccaagtaggcttcgctggcc 2290

                                                                        
Query: 284  tcctggagcgcggagacggcggaggactggaagcggaggtcggtcttgaagtcctgcgcg 343
            ||||| || ||   |||||| |||  |||||| ||||| ||||||||||||||||| |||
Sbjct: 2289 tcctgaagagccatgacggcagagctctggaaacggagctcggtcttgaagtcctgagcg 2230

                                                                        
Query: 344  atctcccggacgaggcgctgaaaggggagcttgcggatgagcagctccgtgctcttctgg 403
            ||||| ||||| || ||||| |||||||||||||||||||||||||| || |||||||||
Sbjct: 2229 atctcacggaccagacgctggaaggggagcttgcggatgagcagctcggtactcttctgg 2170

              
Query: 404  ta 405
            ||
Sbjct: 2169 ta 2168



to top

>gb|DQ284185.1| Chaperina fusca histone H3a gene, partial cds
          Length = 328

 Score =  210 bits (106), Expect = 3e-51
 Identities = 166/186 (89%)
 Strand = Plus / Minus

                                                                       
Query: 220 cttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtacgcctcggc 279
           ||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||||  
Sbjct: 325 cttggcgtggatggcgcagaggttggtgtcctcgaagagtccgacgaggtaagcctcgct 266

                                                                       
Query: 280 ggcctcctggagcgcggagacggcggaggactggaagcggaggtcggtcttgaagtcctg 339
           ||||||||| || ||   ||||||||||  ||||||||| ||||||||||||||||||||
Sbjct: 265 ggcctcctgcagggccatgacggcggagctctggaagcgcaggtcggtcttgaagtcctg 206

                                                                       
Query: 340 cgcgatctcccggacgaggcgctgaaaggggagcttgcggatgagcagctccgtgctctt 399
            ||||| || |||||||||||||| ||||| |||||||||||||||||||| |||  |||
Sbjct: 205 ggcgatttctcggacgaggcgctggaagggcagcttgcggatgagcagctcggtggactt 146

                 
Query: 400 ctggta 405
           ||||||
Sbjct: 145 ctggta 140



to top

>ref|NM_214547.1| Strongylocentrotus purpuratus late embryonic histone H3
           (LOC373340), mRNA
          Length = 411

 Score =  210 bits (106), Expect = 3e-51
 Identities = 208/242 (85%)
 Strand = Plus / Minus

                                                                       
Query: 164 cgctccccgcggatgcggcgggcgagctggatgtccttgggcatgattgtgacgcgcttg 223
           ||||| || |||||||||||||| |||||||||||||| |||||||| || || ||||||
Sbjct: 404 cgctcgccacggatgcggcgggccagctggatgtcctttggcatgatggtaacacgcttg 345

                                                                       
Query: 224 gcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtacgcctcggcggcc 283
           |||||||||||||| ||||||||||||||||| || | ||| | ||| || |||  ||||
Sbjct: 344 gcgtggatggcgcaaaggttggtgtcctcgaaaagacggaccaagtaggcttcgctggcc 285

                                                                       
Query: 284 tcctggagcgcggagacggcggaggactggaagcggaggtcggtcttgaagtcctgcgcg 343
           ||||| || ||   |||||| |||  |||||| ||||| ||||||||||||||||| |||
Sbjct: 284 tcctgaagagccatgacggcagagctctggaaacggagctcggtcttgaagtcctgagcg 225

                                                                       
Query: 344 atctcccggacgaggcgctgaaaggggagcttgcggatgagcagctccgtgctcttctgg 403
           ||||| ||||| || ||||| |||||||||||||||||||||||||| || |||||||||
Sbjct: 224 atctcacggaccagacgctggaaggggagcttgcggatgagcagctcggtactcttctgg 165

             
Query: 404 ta 405
           ||
Sbjct: 164 ta 163



to top

>ref|NM_178203.1| Mus musculus histone 1, H3b (Hist1h3b), mRNA
          Length = 411

 Score =  208 bits (105), Expect = 1e-50
 Identities = 195/225 (86%)
 Strand = Plus / Minus

                                                                       
Query: 166 ctccccgcggatgcggcgggcgagctggatgtccttgggcatgattgtgacgcgcttggc 225
           |||||| || ||||||||||||||||||||||||||||||||||| ||||| ||||||||
Sbjct: 402 ctccccacgaatgcggcgggcgagctggatgtccttgggcatgatggtgacacgcttggc 343

                                                                       
Query: 226 gtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtacgcctcggcggcctc 285
           |||||||||||| |||||||||||||| || || || || ||||| ||||||   |||||
Sbjct: 342 gtggatggcgcacaggttggtgtcctcaaacagacccacaaggtaggcctcgctcgcctc 283

                                                                       
Query: 286 ctggagcgcggagacggcggaggactggaagcggaggtcggtcttgaagtcctgcgcgat 345
           ||| || ||   |||||| |||  ||||||||| ||||||||||||||||||||||||||
Sbjct: 282 ctgcagagccatgacggccgagctctggaagcgcaggtcggtcttgaagtcctgcgcgat 223

                                                        
Query: 346 ctcccggacgaggcgctgaaaggggagcttgcggatgagcagctc 390
           ||| || || |||||||| || || ||||||||||| ||||||||
Sbjct: 222 ctcgcgcaccaggcgctggaacggcagcttgcggatcagcagctc 178



to top

>gb|AY788897.1| Mnais nawai histone 3 gene, partial cds
          Length = 328

 Score =  208 bits (105), Expect = 1e-50
 Identities = 168/189 (88%)
 Strand = Plus / Minus

                                                                       
Query: 217 gcgcttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtacgcctc 276
           ||||||||||||||||||||| |||||||||||||||||||| || |||||||| |||||
Sbjct: 328 gcgcttggcgtggatggcgcacaggttggtgtcctcgaagagacccacgaggtaagcctc 269

                                                                       
Query: 277 ggcggcctcctggagcgcggagacggcggaggactggaagcggaggtcggtcttgaagtc 336
           |  |||||||||||| ||   ||||||||||  |||||||||||| ||||||||||||||
Sbjct: 268 gctggcctcctggagtgccatgacggcggagctctggaagcggagatcggtcttgaagtc 209

                                                                       
Query: 337 ctgcgcgatctcccggacgaggcgctgaaaggggagcttgcggatgagcagctccgtgct 396
           ||| |||||||| ||||| | |||||| ||||| |||||||||||||| ||||| |||||
Sbjct: 208 ctgagcgatctcacggaccaagcgctggaagggcagcttgcggatgaggagctcggtgct 149

                    
Query: 397 cttctggta 405
           |||||||||
Sbjct: 148 cttctggta 140



to top

>emb|Y12290.1|MMHIST431 M.musculus genes encoding histone H4, histone H3 and histone H1.1
          Length = 5597

 Score =  208 bits (105), Expect = 1e-50
 Identities = 195/225 (86%)
 Strand = Plus / Plus

                                                                        
Query: 166  ctccccgcggatgcggcgggcgagctggatgtccttgggcatgattgtgacgcgcttggc 225
            ||||||||||||||||||||| || |||||||||||||||||||| ||||| ||||||||
Sbjct: 2135 ctccccgcggatgcggcgggccagttggatgtccttgggcatgatggtgacacgcttggc 2194

                                                                        
Query: 226  gtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtacgcctcggcggcctc 285
            |||||||||||| |||||||||||||| || || || || ||||| |||||   ||||||
Sbjct: 2195 gtggatggcgcacaggttggtgtcctcaaacagacccacaaggtaggcctcacaggcctc 2254

                                                                        
Query: 286  ctggagcgcggagacggcggaggactggaagcggaggtcggtcttgaagtcctgcgcgat 345
            ||| || ||   |||||| |||  ||||||||| ||||||||||||||||||||||||||
Sbjct: 2255 ctgcagagccatgacggccgagctctggaagcgcaggtcggtcttgaagtcctgcgcgat 2314

                                                         
Query: 346  ctcccggacgaggcgctgaaaggggagcttgcggatgagcagctc 390
            ||| || || |||||||| || || ||||||||||| ||||||||
Sbjct: 2315 ctcgcgcaccaggcgctggaacggcagcttgcggatcagcagctc 2359



to top

>emb|X80325.1|MPMPH315 M.pahari mpH315 gene
          Length = 974

 Score =  208 bits (105), Expect = 1e-50
 Identities = 195/225 (86%)
 Strand = Plus / Minus

                                                                       
Query: 166 ctccccgcggatgcggcgggcgagctggatgtccttgggcatgattgtgacgcgcttggc 225
           ||||||||||||||||||||| ||||||||||||||||||||||| ||||| ||||||||
Sbjct: 583 ctccccgcggatgcggcgggccagctggatgtccttgggcatgatggtgacacgcttggc 524

                                                                       
Query: 226 gtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtacgcctcggcggcctc 285
           |||||||||||| |||||||||||||| || || || || ||||| |||||   ||||||
Sbjct: 523 gtggatggcgcacaggttggtgtcctcaaacagacccacaaggtaggcctcacaggcctc 464

                                                                       
Query: 286 ctggagcgcggagacggcggaggactggaagcggaggtcggtcttgaagtcctgcgcgat 345
           ||| || ||   |||||| |||  ||||||||| ||||||||||||||||||||||||||
Sbjct: 463 ctgcagagccatgacggccgagctctggaagcgcaggtcggtcttgaagtcctgcgcgat 404

                                                        
Query: 346 ctcccggacgaggcgctgaaaggggagcttgcggatgagcagctc 390
           ||| || || || ||||| || || ||||||||||| ||||||||
Sbjct: 403 ctcgcgcactagccgctggaacggcagcttgcggatcagcagctc 359



to top

>emb|AL590388.4| Mouse DNA sequence from clone RP23-480B19 on chromosome 13 Contains the
              Slc17a1 gene for solute carrier family 17 (vesicular
              glutamate transporter) member 1, two genes for novel solute
              carrier family 17 (Slc17) members, two novel genes, the
              gene for a novel C3HC4 type zinc finger (ring finger)
              protein, the gene for an H2a, an H2b, two genes for H3 and
              two genes for H4 histone family members, a H2a histone
              family pseudogene, the H1f1 and  H1f2 genes for H1 histone
              family members 1 and 2, the H3f2 gene for H3 histone
              family, member 2 (H3.2), a novel pseudogene, the Hfe gene
              for hemochromatosis protein (Mr2) and two CpG islands,
              complete sequence
          Length = 186062

 Score =  208 bits (105), Expect = 1e-50
 Identities = 192/221 (86%)
 Strand = Plus / Minus

                                                                          
Query: 170    ccgcggatgcggcgggcgagctggatgtccttgggcatgattgtgacgcgcttggcgtgg 229
              ||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||||||
Sbjct: 143278 ccgcggatgcggcgggcgagctggatgtccttgggcatgatggtgacacgcttggcgtgg 143219

                                                                          
Query: 230    atggcgcagaggttggtgtcctcgaagagcccgacgaggtacgcctcggcggcctcctgg 289
              |||||||| |||||||||||||| || || || || ||||| ||||||   |||||||| 
Sbjct: 143218 atggcgcacaggttggtgtcctcaaacagacccacaaggtaggcctcgctcgcctcctgc 143159

                                                                          
Query: 290    agcgcggagacggcggaggactggaagcggaggtcggtcttgaagtcctgcgcgatctcc 349
              || ||   ||| || |||  ||||||||| ||||||||||||||||||||||||||||| 
Sbjct: 143158 agagccatgacagccgagctctggaagcgcaggtcggtcttgaagtcctgcgcgatctcg 143099

                                                       
Query: 350    cggacgaggcgctgaaaggggagcttgcggatgagcagctc 390
              || || |||||||| || || ||||||||||| ||||||||
Sbjct: 143098 cgcaccaggcgctggaacggcagcttgcggatcagcagctc 143058



 Score =  208 bits (105), Expect = 1e-50
 Identities = 195/225 (86%)
 Strand = Plus / Plus

                                                                          
Query: 166    ctccccgcggatgcggcgggcgagctggatgtccttgggcatgattgtgacgcgcttggc 225
              |||||| || ||||||||||||||||||||||||||||||||||| ||||| ||||||||
Sbjct: 135597 ctccccacgaatgcggcgggcgagctggatgtccttgggcatgatggtgacacgcttggc 135656

                                                                          
Query: 226    gtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtacgcctcggcggcctc 285
              |||||||||||| |||||||||||||| || || || || ||||| ||||||   |||||
Sbjct: 135657 gtggatggcgcacaggttggtgtcctcaaacagacccacaaggtaggcctcgctcgcctc 135716

                                                                          
Query: 286    ctggagcgcggagacggcggaggactggaagcggaggtcggtcttgaagtcctgcgcgat 345
              ||| || ||   |||||| |||  ||||||||| ||||||||||||||||||||||||||
Sbjct: 135717 ctgcagagccatgacggccgagctctggaagcgcaggtcggtcttgaagtcctgcgcgat 135776

                                                           
Query: 346    ctcccggacgaggcgctgaaaggggagcttgcggatgagcagctc 390
              ||| || || |||||||| || || ||||||||||| ||||||||
Sbjct: 135777 ctcgcgcaccaggcgctggaacggcagcttgcggatcagcagctc 135821



 Score =  208 bits (105), Expect = 1e-50
 Identities = 195/225 (86%)
 Strand = Plus / Minus

                                                                          
Query: 166    ctccccgcggatgcggcgggcgagctggatgtccttgggcatgattgtgacgcgcttggc 225
              ||||||||||||||||||||| || |||||||||||||||||||| ||||| ||||||||
Sbjct: 126426 ctccccgcggatgcggcgggccagttggatgtccttgggcatgatggtgacacgcttggc 126367

                                                                          
Query: 226    gtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtacgcctcggcggcctc 285
              |||||||||||| |||||||||||||| || || || || ||||| |||||   ||||||
Sbjct: 126366 gtggatggcgcacaggttggtgtcctcaaacagacccacaaggtaggcctcacaggcctc 126307

                                                                          
Query: 286    ctggagcgcggagacggcggaggactggaagcggaggtcggtcttgaagtcctgcgcgat 345
              ||| || ||   |||||| |||  ||||||||| ||||||||||||||||||||||||||
Sbjct: 126306 ctgcagagccatgacggccgagctctggaagcgcaggtcggtcttgaagtcctgcgcgat 126247

                                                           
Query: 346    ctcccggacgaggcgctgaaaggggagcttgcggatgagcagctc 390
              ||| || || |||||||| || || ||||||||||| ||||||||
Sbjct: 126246 ctcgcgcaccaggcgctggaacggcagcttgcggatcagcagctc 126202



to top

>gb|DQ284352.1| Rana chapaensis histone H3a gene, partial cds
          Length = 328

 Score =  208 bits (105), Expect = 1e-50
 Identities = 154/171 (90%)
 Strand = Plus / Minus

                                                                       
Query: 220 cttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtacgcctcggc 279
           ||||||||||||||||||||||||||||||||||||||| |||||||| || ||||||  
Sbjct: 325 cttggcgtggatggcgcagaggttggtgtcctcgaagaggccgacgagataagcctcgct 266

                                                                       
Query: 280 ggcctcctggagcgcggagacggcggaggactggaagcggaggtcggtcttgaagtcctg 339
           ||||||||| |||||   ||| ||||||  ||||||||| ||||||||||||||||||||
Sbjct: 265 ggcctcctgcagcgccatgacrgcggagctctggaagcgcaggtcggtcttgaagtcctg 206

                                                              
Query: 340 cgcgatctcccggacgaggcgctgaaaggggagcttgcggatgagcagctc 390
            |||||||| |||||||||||||| ||||| ||||||||||||||||||||
Sbjct: 205 ggcgatctcgcggacgaggcgctggaagggcagcttgcggatgagcagctc 155



to top

>gb|DQ284224.1| Rana muscosa histone H3a gene, partial cds
          Length = 328

 Score =  208 bits (105), Expect = 1e-50
 Identities = 154/171 (90%)
 Strand = Plus / Minus

                                                                       
Query: 220 cttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtacgcctcggc 279
           ||||||||||||||||||||||||||||||||||||||| || |||||||| ||||||| 
Sbjct: 325 cttggcgtggatggcgcagaggttggtgtcctcgaagagtcctacgaggtaagcctcgga 266

                                                                       
Query: 280 ggcctcctggagcgcggagacggcggaggactggaagcggaggtcggtcttgaagtcctg 339
           ||| ||||| || ||   ||||||||||  ||||||||| ||||||||||||||||||||
Sbjct: 265 ggcytcctgcagagccatgacggcggagctctggaagcgcaggtcggtcttgaagtcctg 206

                                                              
Query: 340 cgcgatctcccggacgaggcgctgaaaggggagcttgcggatgagcagctc 390
            |||||||| |||||||||||||| ||||| ||||||||||||||||||||
Sbjct: 205 ggcgatctctcggacgaggcgctggaagggcagcttgcggatgagcagctc 155



to top

>gb|AF370817.1|AF370817 Locusta migratoria histone H3 gene, partial cds
          Length = 327

 Score =  208 bits (105), Expect = 1e-50
 Identities = 168/189 (88%)
 Strand = Plus / Minus

                                                                       
Query: 217 gcgcttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtacgcctc 276
           ||||||||||||||||||||| ||||||||||| |||||||| ||||||||||| |||||
Sbjct: 327 gcgcttggcgtggatggcgcacaggttggtgtcttcgaagaggccgacgaggtaggcctc 268

                                                                       
Query: 277 ggcggcctcctggagcgcggagacggcggaggactggaagcggaggtcggtcttgaagtc 336
           |  ||| ||||| |||||   ||||||||||  ||||||||| |||||||||||||||||
Sbjct: 267 gctggcttcctgcagcgccatgacggcggagctctggaagcgcaggtcggtcttgaagtc 208

                                                                       
Query: 337 ctgcgcgatctcccggacgaggcgctgaaaggggagcttgcggatgagcagctccgtgct 396
           ||| |||||||| || ||||||||||| ||||| |||||||||||||||||||| |||||
Sbjct: 207 ctgtgcgatctctcgcacgaggcgctggaagggcagcttgcggatgagcagctcggtgct 148

                    
Query: 397 cttctggta 405
           ||| |||||
Sbjct: 147 cttttggta 139



to top

>dbj|AK006742.1| Mus musculus adult male testis cDNA, RIKEN full-length enriched
           library, clone:1700049H14 product:H3 HISTONE homolog
           [Rattus norvegicus], full insert sequence
          Length = 514

 Score =  208 bits (105), Expect = 1e-50
 Identities = 195/225 (86%)
 Strand = Plus / Minus

                                                                       
Query: 166 ctccccgcggatgcggcgggcgagctggatgtccttgggcatgattgtgacgcgcttggc 225
           ||||||||||||||||||||| || |||||||||||||||||||| ||||| ||||||||
Sbjct: 415 ctccccgcggatgcggcgggccagttggatgtccttgggcatgatggtgacacgcttggc 356

                                                                       
Query: 226 gtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtacgcctcggcggcctc 285
           |||||||||||| |||||||||||||| || || || || ||||| |||||   ||||||
Sbjct: 355 gtggatggcgcacaggttggtgtcctcaaacagacccacaaggtaggcctcacaggcctc 296

                                                                       
Query: 286 ctggagcgcggagacggcggaggactggaagcggaggtcggtcttgaagtcctgcgcgat 345
           ||| || ||   |||||| |||  ||||||||| ||||||||||||||||||||||||||
Sbjct: 295 ctgcagagccatgacggccgagctctggaagcgcaggtcggtcttgaagtcctgcgcgat 236

                                                        
Query: 346 ctcccggacgaggcgctgaaaggggagcttgcggatgagcagctc 390
           ||| || || |||||||| || || ||||||||||| ||||||||
Sbjct: 235 ctcgcgcaccaggcgctggaacggcagcttgcggatcagcagctc 191



to top

>gb|U62672.1|MMU62672 Mus musculus histone H3.1-D (H3-D) and histone H4-D (H4-D) genes,
           complete cds
          Length = 2321

 Score =  208 bits (105), Expect = 1e-50
 Identities = 195/225 (86%)
 Strand = Plus / Minus

                                                                       
Query: 166 ctccccgcggatgcggcgggcgagctggatgtccttgggcatgattgtgacgcgcttggc 225
           ||||||||||||||||||||| || |||||||||||||||||||| ||||| ||||||||
Sbjct: 753 ctccccgcggatgcggcgggccagttggatgtccttgggcatgatggtgacacgcttggc 694

                                                                       
Query: 226 gtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtacgcctcggcggcctc 285
           |||||||||||| |||||||||||||| || || || || ||||| |||||   ||||||
Sbjct: 693 gtggatggcgcacaggttggtgtcctcaaacagacccacaaggtaggcctcacaggcctc 634

                                                                       
Query: 286 ctggagcgcggagacggcggaggactggaagcggaggtcggtcttgaagtcctgcgcgat 345
           ||| || ||   |||||| |||  ||||||||| ||||||||||||||||||||||||||
Sbjct: 633 ctgcagagccatgacggccgagctctggaagcgcaggtcggtcttgaagtcctgcgcgat 574

                                                        
Query: 346 ctcccggacgaggcgctgaaaggggagcttgcggatgagcagctc 390
           ||| || || |||||||| || || ||||||||||| ||||||||
Sbjct: 573 ctcgcgcaccaggcgctggaacggcagcttgcggatcagcagctc 529



to top

>gb|AF404631.1| Lewia infectoria isolate CR31 histone gene, partial cds
          Length = 516

 Score =  208 bits (105), Expect = 1e-50
 Identities = 183/209 (87%)
 Strand = Plus / Minus

                                                                       
Query: 182 cgggcgagctggatgtccttgggcatgattgtgacgcgcttggcgtggatggcgcagagg 241
           |||||||||||||||||||||  |  ||| ||||| ||||||||||||||||||||||||
Sbjct: 514 cgggcgagctggatgtccttgctctggatggtgacacgcttggcgtggatggcgcagagg 455

                                                                       
Query: 242 ttggtgtcctcgaagagcccgacgaggtacgcctcggcggcctcctggagcgcggagacg 301
           ||||||||||||||||||  ||||||||| |||||| ||| |||||| || |||  || |
Sbjct: 454 ttggtgtcctcgaagagcgagacgaggtaggcctcgacggactcctgaagagcgccgatg 395

                                                                       
Query: 302 gcggaggactggaagcggaggtcggtcttgaagtcctgcgcgatctcccggacgaggcgc 361
           |||||||||||||||||||| || | |||||||||||| |||||||| ||||| || |||
Sbjct: 394 gcggaggactggaagcggagatccgacttgaagtcctgggcgatctcacggacaagacgc 335

                                        
Query: 362 tgaaaggggagcttgcggatgagcagctc 390
           || ||||| |||||||||||||| |||||
Sbjct: 334 tggaagggcagcttgcggatgaggagctc 306



to top

>gb|AY158952.1| Mus musculus histone protein Hist1h3a gene, complete cds
          Length = 1408

 Score =  208 bits (105), Expect = 1e-50
 Identities = 195/225 (86%)
 Strand = Plus / Minus

                                                                       
Query: 166 ctccccgcggatgcggcgggcgagctggatgtccttgggcatgattgtgacgcgcttggc 225
           ||||||||||||||||||||| || |||||||||||||||||||| ||||| ||||||||
Sbjct: 902 ctccccgcggatgcggcgggccagttggatgtccttgggcatgatggtgacacgcttggc 843

                                                                       
Query: 226 gtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtacgcctcggcggcctc 285
           |||||||||||| |||||||||||||| || || || || ||||| |||||   ||||||
Sbjct: 842 gtggatggcgcacaggttggtgtcctcaaacagacccacaaggtaggcctcacaggcctc 783

                                                                       
Query: 286 ctggagcgcggagacggcggaggactggaagcggaggtcggtcttgaagtcctgcgcgat 345
           ||| || ||   |||||| |||  ||||||||| ||||||||||||||||||||||||||
Sbjct: 782 ctgcagagccatgacggccgagctctggaagcgcaggtcggtcttgaagtcctgcgcgat 723

                                                        
Query: 346 ctcccggacgaggcgctgaaaggggagcttgcggatgagcagctc 390
           ||| || || |||||||| || || ||||||||||| ||||||||
Sbjct: 722 ctcgcgcaccaggcgctggaacggcagcttgcggatcagcagctc 678



to top

>gb|AY158951.1| Mus musculus histone protein Hist1h3b gene, complete cds
          Length = 1411

 Score =  208 bits (105), Expect = 1e-50
 Identities = 195/225 (86%)
 Strand = Plus / Minus

                                                                       
Query: 166 ctccccgcggatgcggcgggcgagctggatgtccttgggcatgattgtgacgcgcttggc 225
           |||||| || ||||||||||||||||||||||||||||||||||| ||||| ||||||||
Sbjct: 902 ctccccacgaatgcggcgggcgagctggatgtccttgggcatgatggtgacacgcttggc 843

                                                                       
Query: 226 gtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtacgcctcggcggcctc 285
           |||||||||||| |||||||||||||| || || || || ||||| ||||||   |||||
Sbjct: 842 gtggatggcgcacaggttggtgtcctcaaacagacccacaaggtaggcctcgctcgcctc 783

                                                                       
Query: 286 ctggagcgcggagacggcggaggactggaagcggaggtcggtcttgaagtcctgcgcgat 345
           ||| || ||   |||||| |||  ||||||||| ||||||||||||||||||||||||||
Sbjct: 782 ctgcagagccatgacggccgagctctggaagcgcaggtcggtcttgaagtcctgcgcgat 723

                                                        
Query: 346 ctcccggacgaggcgctgaaaggggagcttgcggatgagcagctc 390
           ||| || || |||||||| || || ||||||||||| ||||||||
Sbjct: 722 ctcgcgcaccaggcgctggaacggcagcttgcggatcagcagctc 678



to top

>ref|XM_524859.1| PREDICTED: Pan troglodytes LOC469476 (LOC469476), mRNA
          Length = 576

 Score =  206 bits (104), Expect = 4e-50
 Identities = 203/236 (86%)
 Strand = Plus / Minus

                                                                       
Query: 158 taggcgcgctccccgcggatgcggcgggcgagctggatgtccttgggcatgattgtgacg 217
           ||||| ||||||||||||||||||||||| | ||||||||||||||||||||| || |||
Sbjct: 575 taggcccgctccccgcggatgcggcgggccaactggatgtccttgggcatgatggtcacg 516

                                                                       
Query: 218 cgcttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtacgcctcg 277
           |||||||| ||||||||||| ||||| ||||| ||||| ||||| || ||||| ||||||
Sbjct: 515 cgcttggcatggatggcgcacaggttcgtgtcttcgaacagccccaccaggtaggcctcg 456

                                                                       
Query: 278 gcggcctcctggagcgcggagacggcggaggactggaagcggaggtcggtcttgaagtcc 337
             ||||||||| |||||    ||||| |||  ||||||||| ||||| ||||| ||||||
Sbjct: 455 ctggcctcctgcagcgccatcacggccgagctctggaagcgcaggtccgtcttaaagtcc 396

                                                                   
Query: 338 tgcgcgatctcccggacgaggcgctgaaaggggagcttgcggatgagcagctccgt 393
           ||||||||||| || || || ||||| ||||| ||||||||||| |||||||||||
Sbjct: 395 tgcgcgatctcgcgtaccagccgctggaagggcagcttgcggatcagcagctccgt 340



to top

>emb|AL591493.14| Human DNA sequence from clone RP11-196G18 on chromosome 1 Contains a
             ubiquitin-conjugating enzyme E2D 1 (UBC4/5 homolog, yeast)
             (UBE2D1) pseudogene, the FCGR1A gene for Fc fragment of
             IgG, high affinity Ia, receptor for (CD64), a novel gene
             similar to histone 2, H2be (HIST2H2BE), a novel gene
             similar to histone 2, H3c (HIST2H3C), the HIST2H4 gene for
             histone 2, H4, the HIST2H3C gene for histone 2, H3c, the
             HIST2H2AA gene for histone 2, H2aa, a histone 2, H2bd
             pseudogene (HIST2H2BD), a histone 2, H2bc pseudogene
             (HIST2H2BC), a novel gene similar to histone 2, H2aa
             (HIST2H2AA), a novel gene similar to histone 2, H3c
             (HIST2H3C), a novel gene similar to histone 1, H4
             (HIST2H4), the HIST2H2BE gene for histone 2, H2be, the
             HIST2H2AC gene for histone 2, H2ac, the HIST2H2AB gene for
             histone 2, H2ab, a novel protein similar to histone 2, a
             novel gene, the SV2A gene for synaptic vesicle
             glycoprotein 2A, the 3' end of the SF3B4 gene for splicing
             factor 3b, subunit 4, 49kDa and five CpG islands, complete
             sequence
          Length = 188956

 Score =  206 bits (104), Expect = 4e-50
 Identities = 203/236 (86%)
 Strand = Plus / Plus

                                                                         
Query: 158   taggcgcgctccccgcggatgcggcgggcgagctggatgtccttgggcatgattgtgacg 217
             ||||| ||||||||||||||||||||||| | ||||||||||||||||||||| || |||
Sbjct: 74987 taggcccgctccccgcggatgcggcgggccaactggatgtccttgggcatgatggtcacg 75046

                                                                         
Query: 218   cgcttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtacgcctcg 277
             |||||||| ||||||||||| ||||| ||||| ||||| ||||| || ||||| ||||||
Sbjct: 75047 cgcttggcatggatggcgcacaggttcgtgtcttcgaacagccccaccaggtaggcctcg 75106

                                                                         
Query: 278   gcggcctcctggagcgcggagacggcggaggactggaagcggaggtcggtcttgaagtcc 337
               ||||||||| |||||    ||||| |||  ||||||||| ||||| ||||| ||||||
Sbjct: 75107 ctggcctcctgcagcgccatcacggccgagctctggaagcgcaggtccgtcttaaagtcc 75166

                                                                     
Query: 338   tgcgcgatctcccggacgaggcgctgaaaggggagcttgcggatgagcagctccgt 393
             ||||||||||| || || || ||||| ||||| ||||||||||| |||||||||||
Sbjct: 75167 tgcgcgatctcgcgtaccagccgctggaagggcagcttgcggatcagcagctccgt 75222



 Score =  202 bits (102), Expect = 7e-49
 Identities = 207/242 (85%)
 Strand = Plus / Minus

                                                                          
Query: 164    cgctccccgcggatgcggcgggcgagctggatgtccttgggcatgattgtgacgcgcttg 223
              ||||| || |||||||||||||| |||||||||||||||||||| || || |||||||||
Sbjct: 114780 cgctctccacggatgcggcgggccagctggatgtccttgggcataatggtcacgcgcttg 114721

                                                                          
Query: 224    gcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtacgcctcggcggcc 283
              |||||||||||||| ||||| ||||| ||||| ||||| || ||||| ||||||  ||||
Sbjct: 114720 gcgtggatggcgcacaggttcgtgtcttcgaacagccccaccaggtaggcctcgctggcc 114661

                                                                          
Query: 284    tcctggagcgcggagacggcggaggactggaagcggaggtcggtcttgaagtcctgcgcg 343
              ||||| |||||    ||||| |||  ||||||||| ||||| ||||| ||||||||||||
Sbjct: 114660 tcctgcagcgccatcacggccgagctctggaagcgcaggtccgtcttaaagtcctgcgcg 114601

                                                                          
Query: 344    atctcccggacgaggcgctgaaaggggagcttgcggatgagcagctccgtgctcttctgg 403
              ||||| || || || ||||| ||||| ||||||||||| ||||||||||||  |||||||
Sbjct: 114600 atctcgcgtaccagccgctggaagggcagcttgcggatcagcagctccgtggacttctgg 114541

                
Query: 404    ta 405
              ||
Sbjct: 114540 ta 114539



 Score =  202 bits (102), Expect = 7e-49
 Identities = 207/242 (85%)
 Strand = Plus / Plus

                                                                          
Query: 164    cgctccccgcggatgcggcgggcgagctggatgtccttgggcatgattgtgacgcgcttg 223
              ||||| || |||||||||||||| |||||||||||||||||||| || || |||||||||
Sbjct: 102486 cgctctccacggatgcggcgggccagctggatgtccttgggcataatggtcacgcgcttg 102545

                                                                          
Query: 224    gcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtacgcctcggcggcc 283
              |||||||||||||| ||||| ||||| ||||| ||||| || ||||| ||||||  ||||
Sbjct: 102546 gcgtggatggcgcacaggttcgtgtcttcgaacagccccaccaggtaggcctcgctggcc 102605

                                                                          
Query: 284    tcctggagcgcggagacggcggaggactggaagcggaggtcggtcttgaagtcctgcgcg 343
              ||||| |||||    ||||| |||  ||||||||| ||||| ||||| ||||||||||||
Sbjct: 102606 tcctgcagcgccatcacggccgagctctggaagcgcaggtccgtcttaaagtcctgcgcg 102665

                                                                          
Query: 344    atctcccggacgaggcgctgaaaggggagcttgcggatgagcagctccgtgctcttctgg 403
              ||||| || || || ||||| ||||| ||||||||||| ||||||||||||  |||||||
Sbjct: 102666 atctcgcgtaccagccgctggaagggcagcttgcggatcagcagctccgtggacttctgg 102725

                
Query: 404    ta 405
              ||
Sbjct: 102726 ta 102727



to top

>ref|XM_497711.2| PREDICTED: Homo sapiens similar to H3 histone, family 2 isoform 2
           (LOC653604), mRNA
          Length = 543

 Score =  206 bits (104), Expect = 4e-50
 Identities = 203/236 (86%)
 Strand = Plus / Minus

                                                                       
Query: 158 taggcgcgctccccgcggatgcggcgggcgagctggatgtccttgggcatgattgtgacg 217
           ||||| ||||||||||||||||||||||| | ||||||||||||||||||||| || |||
Sbjct: 542 taggcccgctccccgcggatgcggcgggccaactggatgtccttgggcatgatggtcacg 483

                                                                       
Query: 218 cgcttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtacgcctcg 277
           |||||||| ||||||||||| ||||| ||||| ||||| ||||| || ||||| ||||||
Sbjct: 482 cgcttggcatggatggcgcacaggttcgtgtcttcgaacagccccaccaggtaggcctcg 423

                                                                       
Query: 278 gcggcctcctggagcgcggagacggcggaggactggaagcggaggtcggtcttgaagtcc 337
             ||||||||| |||||    ||||| |||  ||||||||| ||||| ||||| ||||||
Sbjct: 422 ctggcctcctgcagcgccatcacggccgagctctggaagcgcaggtccgtcttaaagtcc 363

                                                                   
Query: 338 tgcgcgatctcccggacgaggcgctgaaaggggagcttgcggatgagcagctccgt 393
           ||||||||||| || || || ||||| ||||| ||||||||||| |||||||||||
Sbjct: 362 tgcgcgatctcgcgtaccagccgctggaagggcagcttgcggatcagcagctccgt 307



to top

>gb|AY338619.1| Baetis sp. Eph11 histone 3 gene, partial cds
          Length = 345

 Score =  206 bits (104), Expect = 4e-50
 Identities = 179/204 (87%)
 Strand = Plus / Minus

                                                                       
Query: 202 gggcatgattgtgacgcgcttggcgtggatggcgcagaggttggtgtcctcgaagagccc 261
           ||||||||| |||||||||||||||||||||||||| | |||||||||||||||||| ||
Sbjct: 345 gggcatgatggtgacgcgcttggcgtggatggcgcacaagttggtgtcctcgaagagacc 286

                                                                       
Query: 262 gacgaggtacgcctcggcggcctcctggagcgcggagacggcggaggactggaagcggag 321
           ||||||||| ||||||  ||||||||| || ||   |||||| |||  ||||||||| ||
Sbjct: 285 gacgaggtaggcctcgctggcctcctgcagggccatgacggccgagctctggaagcgcag 226

                                                                       
Query: 322 gtcggtcttgaagtcctgcgcgatctcccggacgaggcgctgaaaggggagcttgcggat 381
           |||||||||||||||||||||||| || || || || ||||| ||||| |||||||||||
Sbjct: 225 gtcggtcttgaagtcctgcgcgatttcacgcaccagacgctggaagggcagcttgcggat 166

                                   
Query: 382 gagcagctccgtgctcttctggta 405
            |||||||| ||||||||||||||
Sbjct: 165 cagcagctcagtgctcttctggta 142



to top

>gb|AY749740.1| Isonychia sp. EP142 histone H3 (H3) gene, partial cds
          Length = 374

 Score =  206 bits (104), Expect = 4e-50
 Identities = 179/204 (87%)
 Strand = Plus / Minus

                                                                       
Query: 202 gggcatgattgtgacgcgcttggcgtggatggcgcagaggttggtgtcctcgaagagccc 261
           ||||||||| |||||||||||||||||||||||||| | ||||||||||||||| || ||
Sbjct: 368 gggcatgatggtgacgcgcttggcgtggatggcgcacaagttggtgtcctcgaacagacc 309

                                                                       
Query: 262 gacgaggtacgcctcggcggcctcctggagcgcggagacggcggaggactggaagcggag 321
            |||||||| ||||||  ||||||||| || ||   |||||| |||  ||||||||| ||
Sbjct: 308 cacgaggtaagcctcgctggcctcctgcagggccatgacggccgagctctggaagcgaag 249

                                                                       
Query: 322 gtcggtcttgaagtcctgcgcgatctcccggacgaggcgctgaaaggggagcttgcggat 381
           |||||||||||||||||| |||||||| || || |||||||| ||||| |||||||||||
Sbjct: 248 gtcggtcttgaagtcctgtgcgatctcacgcaccaggcgctggaagggcagcttgcggat 189

                                   
Query: 382 gagcagctccgtgctcttctggta 405
           ||||||||| ||||||||||||||
Sbjct: 188 gagcagctcagtgctcttctggta 165



to top

>gb|M14396.1|CIIHISH3A Duck H3.4 variant histone gene
          Length = 921

 Score =  206 bits (104), Expect = 4e-50
 Identities = 200/232 (86%)
 Strand = Plus / Minus

                                                                       
Query: 159 aggcgcgctccccgcggatgcggcgggcgagctggatgtccttgggcatgattgtgacgc 218
           ||||||||||||||||||||||||||| |||||||||||||||||||||||| | |||||
Sbjct: 749 aggcgcgctccccgcggatgcggcgggtgagctggatgtccttgggcatgatggagacgc 690

                                                                       
Query: 219 gcttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtacgcctcgg 278
           ||||||| |||||||||||||||||||||||||| |||||||| || ||||| |||||| 
Sbjct: 689 gcttggcatggatggcgcagaggttggtgtcctcaaagagccccaccaggtaggcctcgc 630

                                                                       
Query: 279 cggcctcctggagcgcggagacggcggaggactggaagcggaggtcggtcttgaagtcct 338
            ||||||||| || ||    ||||| ||   ||||||||| || ||||||||||||||||
Sbjct: 629 tggcctcctgcagtgccatcacggctgaactctggaagcgcagatcggtcttgaagtcct 570

                                                               
Query: 339 gcgcgatctcccggacgaggcgctgaaaggggagcttgcggatgagcagctc 390
           | || ||||| || || || ||||| ||||| ||||||| ||| ||||||||
Sbjct: 569 gtgcaatctcgcgcaccagccgctggaagggcagcttgcagatcagcagctc 518



to top

>ref|NM_013548.2| Mus musculus histone 1, H3f (Hist1h3f), mRNA
          Length = 1851

 Score =  204 bits (103), Expect = 2e-49
 Identities = 196/227 (86%)
 Strand = Plus / Minus

                                                                       
Query: 164 cgctccccgcggatgcggcgggcgagctggatgtccttgggcatgattgtgacgcgcttg 223
           ||||| |||||||| |||||||| ||||||||||||||||||||||| ||||| ||||||
Sbjct: 924 cgctcgccgcggatacggcgggccagctggatgtccttgggcatgatggtgacacgcttg 865

                                                                       
Query: 224 gcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtacgcctcggcggcc 283
           |||||||||||||| |||||||||||||| || || || || ||||| ||||||   |||
Sbjct: 864 gcgtggatggcgcacaggttggtgtcctcaaacagacccacaaggtaggcctcgctcgcc 805

                                                                       
Query: 284 tcctggagcgcggagacggcggaggactggaagcggaggtcggtcttgaagtcctgcgcg 343
           ||||| || ||   |||||| |||  ||||||||| ||||||||||||||||||||||||
Sbjct: 804 tcctgcagagccatgacggccgagctctggaagcgcaggtcggtcttgaagtcctgcgcg 745

                                                          
Query: 344 atctcccggacgaggcgctgaaaggggagcttgcggatgagcagctc 390
           ||||| || || |||||||| || || ||||||||||| ||||||||
Sbjct: 744 atctcgcgcaccaggcgctggaacggcagcttgcggatcagcagctc 698



to top

>gb|AC151366.3| Aotus nancymaae clone CH258-105B22, complete sequence
          Length = 188026

 Score =  204 bits (103), Expect = 2e-49
 Identities = 202/235 (85%)
 Strand = Plus / Plus

                                                                          
Query: 156    cctaggcgcgctccccgcggatgcggcgggcgagctggatgtccttgggcatgattgtga 215
              ||||||| ||||||||||||||||||||||| ||||||||||||||||||||||| || |
Sbjct: 183192 cctaggcccgctccccgcggatgcggcgggccagctggatgtccttgggcatgatagtca 183251

                                                                          
Query: 216    cgcgcttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtacgcct 275
              |||||||||||||||||||||| ||||| ||||| ||||| ||||| || ||||| ||||
Sbjct: 183252 cgcgcttggcgtggatggcgcacaggttcgtgtcttcgaacagccccaccaggtaggcct 183311

                                                                          
Query: 276    cggcggcctcctggagcgcggagacggcggaggactggaagcggaggtcggtcttgaagt 335
              ||  ||||||||| |||||    ||||| |||  ||||||||| ||||| ||||| ||||
Sbjct: 183312 cgctggcctcctgcagcgccatcacggccgagctctggaagcgcaggtccgtcttaaagt 183371

                                                                     
Query: 336    cctgcgcgatctcccggacgaggcgctgaaaggggagcttgcggatgagcagctc 390
              ||||||| ||||| || || || ||||| || || ||||||||||| ||||||||
Sbjct: 183372 cctgcgctatctcgcgcaccagtcgctggaaaggcagcttgcggatcagcagctc 183426



to top

>ref|XM_950910.1| Neurospora crassa OR74A HISTONE H3 (NCU01635.1) partial mRNA
          Length = 411

 Score =  204 bits (103), Expect = 2e-49
 Identities = 208/243 (85%)
 Strand = Plus / Minus

                                                                       
Query: 163 gcgctccccgcggatgcggcgggcgagctggatgtccttgggcatgattgtgacgcgctt 222
           |||||| ||||||| |||||||||||||||||||||||||  |  ||| ||||| |||||
Sbjct: 405 gcgctcaccgcggaggcggcgggcgagctggatgtccttgctctggatggtgacacgctt 346

                                                                       
Query: 223 ggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtacgcctcggcggc 282
            |||||||| ||||||||||||||||||||||||||   ||||||||| | |||| ||| 
Sbjct: 345 agcgtggatagcgcagaggttggtgtcctcgaagagagagacgaggtaagactcgacgga 286

                                                                       
Query: 283 ctcctggagcgcggagacggcggaggactggaagcggaggtcggtcttgaagtcctgcgc 342
           ||||||||| |||  || ||| |||  ||||||||||||||||| |||||||||||| ||
Sbjct: 285 ctcctggagagcgccgatggcagagctctggaagcggaggtcggacttgaagtcctgggc 226

                                                                       
Query: 343 gatctcccggacgaggcgctgaaaggggagcttgcggatgagcagctccgtgctcttctg 402
            ||||| |||||||| ||||| ||||||||||||||||| || ||||| |||  ||||||
Sbjct: 225 aatctcacggacgagacgctggaaggggagcttgcggatcagaagctcagtggacttctg 166

              
Query: 403 gta 405
           |||
Sbjct: 165 gta 163



to top

>ref|XM_328073.1| Neurospora crassa OR74A HISTONE H3 (NCU01635.1) partial mRNA
          Length = 411

 Score =  204 bits (103), Expect = 2e-49
 Identities = 208/243 (85%)
 Strand = Plus / Minus

                                                                       
Query: 163 gcgctccccgcggatgcggcgggcgagctggatgtccttgggcatgattgtgacgcgctt 222
           |||||| ||||||| |||||||||||||||||||||||||  |  ||| ||||| |||||
Sbjct: 405 gcgctcaccgcggaggcggcgggcgagctggatgtccttgctctggatggtgacacgctt 346

                                                                       
Query: 223 ggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtacgcctcggcggc 282
            |||||||| ||||||||||||||||||||||||||   ||||||||| | |||| ||| 
Sbjct: 345 agcgtggatagcgcagaggttggtgtcctcgaagagagagacgaggtaagactcgacgga 286

                                                                       
Query: 283 ctcctggagcgcggagacggcggaggactggaagcggaggtcggtcttgaagtcctgcgc 342
           ||||||||| |||  || ||| |||  ||||||||||||||||| |||||||||||| ||
Sbjct: 285 ctcctggagagcgccgatggcagagctctggaagcggaggtcggacttgaagtcctgggc 226

                                                                       
Query: 343 gatctcccggacgaggcgctgaaaggggagcttgcggatgagcagctccgtgctcttctg 402
            ||||| |||||||| ||||| ||||||||||||||||| || ||||| |||  ||||||
Sbjct: 225 aatctcacggacgagacgctggaaggggagcttgcggatcagaagctcagtggacttctg 166

              
Query: 403 gta 405
           |||
Sbjct: 165 gta 163



to top

>gb|BC103549.1| Mus musculus histone 1, H3f, mRNA (cDNA clone MGC:123925
           IMAGE:40044771), complete cds
          Length = 1003

 Score =  204 bits (103), Expect = 2e-49
 Identities = 196/227 (86%)
 Strand = Plus / Minus

                                                                       
Query: 164 cgctccccgcggatgcggcgggcgagctggatgtccttgggcatgattgtgacgcgcttg 223
           ||||| |||||||| |||||||| ||||||||||||||||||||||| ||||| ||||||
Sbjct: 837 cgctcgccgcggatacggcgggccagctggatgtccttgggcatgatggtgacacgcttg 778

                                                                       
Query: 224 gcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtacgcctcggcggcc 283
           |||||||||||||| |||||||||||||| || || || || ||||| ||||||   |||
Sbjct: 777 gcgtggatggcgcacaggttggtgtcctcaaacagacccacaaggtaggcctcgctcgcc 718

                                                                       
Query: 284 tcctggagcgcggagacggcggaggactggaagcggaggtcggtcttgaagtcctgcgcg 343
           ||||| || ||   |||||| |||  ||||||||| ||||||||||||||||||||||||
Sbjct: 717 tcctgcagagccatgacggccgagctctggaagcgcaggtcggtcttgaagtcctgcgcg 658

                                                          
Query: 344 atctcccggacgaggcgctgaaaggggagcttgcggatgagcagctc 390
           ||||| || || |||||||| || || ||||||||||| ||||||||
Sbjct: 657 atctcgcgcaccaggcgctggaacggcagcttgcggatcagcagctc 611



to top

>gb|DQ284309.1| Rana maculata histone H3a gene, partial cds
          Length = 328

 Score =  204 bits (103), Expect = 2e-49
 Identities = 154/171 (90%)
 Strand = Plus / Minus

                                                                       
Query: 220 cttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtacgcctcggc 279
           |||||| |||||||||||||||||||||||||||||||| ||||||||||| ||||| | 
Sbjct: 325 cttggcatggatggcgcagaggttggtgtcctcgaagagtccgacgaggtaagcctcaga 266

                                                                       
Query: 280 ggcctcctggagcgcggagacggcggaggactggaagcggaggtcggtcttgaagtcctg 339
           ||||||||| || ||   ||||||||||  ||||||||| ||||||||||||||||||||
Sbjct: 265 ggcctcctgcagagccatgacggcggagctctggaagcgcaggtcggtcttgaagtcctg 206

                                                              
Query: 340 cgcgatctcccggacgaggcgctgaaaggggagcttgcggatgagcagctc 390
            |||||||| |||||||||||||| ||||| ||||||||||||||||||||
Sbjct: 205 ggcgatctctcggacgaggcgctggaagggcagcttgcggatgagcagctc 155



to top

>gb|DQ284280.1| Rana warszewitschii histone H3a gene, partial cds
          Length = 328

 Score =  204 bits (103), Expect = 2e-49
 Identities = 154/171 (90%)
 Strand = Plus / Minus

                                                                       
Query: 220 cttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtacgcctcggc 279
           ||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||| | 
Sbjct: 325 cttggcgtggatggcgcagaggttggtgtcctcgaagagtccgacgaggtaagcctcaga 266

                                                                       
Query: 280 ggcctcctggagcgcggagacggcggaggactggaagcggaggtcggtcttgaagtcctg 339
           ||||||||| |  ||   ||||||||||  ||||||||| ||||||||||||||||||||
Sbjct: 265 ggcctcctgcaaagccatgacggcggagctctggaagcgcaggtcggtcttgaagtcctg 206

                                                              
Query: 340 cgcgatctcccggacgaggcgctgaaaggggagcttgcggatgagcagctc 390
            |||||||| |||||||||||||| ||||| ||||||||||||||||||||
Sbjct: 205 ggcgatctctcggacgaggcgctggaagggcagcttgcggatgagcagctc 155



to top

>gb|DQ284267.1| Rana grahami histone H3a gene, partial cds
          Length = 328

 Score =  204 bits (103), Expect = 2e-49
 Identities = 154/171 (90%)
 Strand = Plus / Minus

                                                                       
Query: 220 cttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtacgcctcggc 279
           ||||||||||||||||||||||||||||||||||||||| || ||||| || ||||||| 
Sbjct: 325 cttggcgtggatggcgcagaggttggtgtcctcgaagagtcctacgagataagcctcgga 266

                                                                       
Query: 280 ggcctcctggagcgcggagacggcggaggactggaagcggaggtcggtcttgaagtcctg 339
           ||||||||| || ||   ||||||||||  ||||||||| ||||||||||||||||||||
Sbjct: 265 ggcctcctgcagagccatgacggcggagctctggaagcgcaggtcggtcttgaagtcctg 206

                                                              
Query: 340 cgcgatctcccggacgaggcgctgaaaggggagcttgcggatgagcagctc 390
            |||||||| |||||||||||||| ||||| ||||||||||||||||||||
Sbjct: 205 ggcgatctctcggacgaggcgctggaagggcagcttgcggatgagcagctc 155



to top

>gb|DQ284245.1| Rana johnsi histone H3a gene, partial cds
          Length = 328

 Score =  204 bits (103), Expect = 2e-49
 Identities = 154/171 (90%)
 Strand = Plus / Minus

                                                                       
Query: 220 cttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtacgcctcggc 279
           ||||||||||||||||||||||||||||||||||||||| |||||||| || ||||||| 
Sbjct: 325 cttggcgtggatggcgcagaggttggtgtcctcgaagagtccgacgagataagcctcgga 266

                                                                       
Query: 280 ggcctcctggagcgcggagacggcggaggactggaagcggaggtcggtcttgaagtcctg 339
           ||||||||| || ||   ||||||||||  ||||||||| ||||||||||||||||||||
Sbjct: 265 ggcctcctgcagagccatgacggcggagctctggaagcgcaggtcggtcttgaagtcctg 206

                                                              
Query: 340 cgcgatctcccggacgaggcgctgaaaggggagcttgcggatgagcagctc 390
            |||||||| |||||||||||||| ||||| || |||||||||||||||||
Sbjct: 205 ggcgatctctcggacgaggcgctggaagggcagtttgcggatgagcagctc 155



to top

>gb|DQ284242.1| Batrachylodes vertebralis histone H3a gene, partial cds
          Length = 328

 Score =  204 bits (103), Expect = 2e-49
 Identities = 154/171 (90%)
 Strand = Plus / Minus

                                                                       
Query: 220 cttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtacgcctcggc 279
           |||||||||||||||||| |||||||||||||||||||||||||| || || ||||||  
Sbjct: 325 cttggcgtggatggcgcacaggttggtgtcctcgaagagcccgaccagataagcctcgct 266

                                                                       
Query: 280 ggcctcctggagcgcggagacggcggaggactggaagcggaggtcggtcttgaagtcctg 339
           ||||||||| |||||   ||||||||||  ||||||||| ||||||||||||||||||||
Sbjct: 265 ggcctcctgcagcgccatgacggcggagctctggaagcgcaggtcggtcttgaagtcctg 206

                                                              
Query: 340 cgcgatctcccggacgaggcgctgaaaggggagcttgcggatgagcagctc 390
            |||||||| |||||||||||||| ||||| ||||||||||||||||||||
Sbjct: 205 ggcgatctcgcggacgaggcgctggaagggcagcttgcggatgagcagctc 155



to top

>gb|DQ284177.1| Rana japonica histone H3a gene, partial cds
          Length = 328

 Score =  204 bits (103), Expect = 2e-49
 Identities = 154/171 (90%)
 Strand = Plus / Minus

                                                                       
Query: 220 cttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtacgcctcggc 279
           ||||||||||||||||||||||||||||||||||||||| |||||||| || ||||||| 
Sbjct: 325 cttggcgtggatggcgcagaggttggtgtcctcgaagagtccgacgagataagcctcgga 266

                                                                       
Query: 280 ggcctcctggagcgcggagacggcggaggactggaagcggaggtcggtcttgaagtcctg 339
           ||||||||| || ||   ||||||||||  ||||||||| ||||||||||||||||||||
Sbjct: 265 ggcctcctgcagagccatgacggcggagctctggaagcgcaggtcggtcttgaagtcctg 206

                                                              
Query: 340 cgcgatctcccggacgaggcgctgaaaggggagcttgcggatgagcagctc 390
            |||||||| |||||||||||||| ||||| ||||||||||| ||||||||
Sbjct: 205 ggcgatctctcggacgaggcgctggaagggcagcttgcggatcagcagctc 155



to top

>dbj|AK010121.1| Mus musculus adult male tongue cDNA, RIKEN full-length enriched
           library, clone:2310069A13 product:HISTONE H3-VI homolog
           [Gallus gallus], full insert sequence
          Length = 852

 Score =  204 bits (103), Expect = 2e-49
 Identities = 196/227 (86%)
 Strand = Plus / Minus

                                                                       
Query: 164 cgctccccgcggatgcggcgggcgagctggatgtccttgggcatgattgtgacgcgcttg 223
           ||||| |||||||| |||||||| ||||||||||||||||||||||| ||||| ||||||
Sbjct: 426 cgctcgccgcggatacggcgggccagctggatgtccttgggcatgatggtgacacgcttg 367

                                                                       
Query: 224 gcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtacgcctcggcggcc 283
           |||||||||||||| |||||||||||||| || || || || ||||| ||||||   |||
Sbjct: 366 gcgtggatggcgcacaggttggtgtcctcaaacagacccacaaggtaggcctcgctcgcc 307

                                                                       
Query: 284 tcctggagcgcggagacggcggaggactggaagcggaggtcggtcttgaagtcctgcgcg 343
           ||||| || ||   |||||| |||  ||||||||| ||||||||||||||||||||||||
Sbjct: 306 tcctgcagagccatgacggccgagctctggaagcgcaggtcggtcttgaagtcctgcgcg 247

                                                          
Query: 344 atctcccggacgaggcgctgaaaggggagcttgcggatgagcagctc 390
           ||||| || || |||||||| || || ||||||||||| ||||||||
Sbjct: 246 atctcgcgcaccaggcgctggaacggcagcttgcggatcagcagctc 200



to top

>dbj|AB185074.1| Conocephalum conicum H3 gene for histone 3, complete cds, clone:
           YFS46
          Length = 500

 Score =  204 bits (103), Expect = 2e-49
 Identities = 208/243 (85%)
 Strand = Plus / Minus

                                                                       
Query: 163 gcgctccccgcggatgcggcgggcgagctggatgtccttgggcatgattgtgacgcgctt 222
           |||||| || |||| |||||||||||||||||||||||||| |  ||| ||||| | |||
Sbjct: 494 gcgctcgcctcggaggcggcgggcgagctggatgtccttggactggatggtgacaccctt 435

                                                                       
Query: 223 ggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtacgcctcggcggc 282
           ||||||||||||||| ||||||||||||||||||||   ||||||||| | |||| ||| 
Sbjct: 434 ggcgtggatggcgcacaggttggtgtcctcgaagagggagacgaggtaagactcgacgga 375

                                                                       
Query: 283 ctcctggagcgcggagacggcggaggactggaagcggaggtcggtcttgaagtcctgcgc 342
           ||||||||| ||   || |||||| |||||||||||||||||| ||||||||||||| ||
Sbjct: 374 ctcctggagagcaccgatggcggaagactggaagcggaggtcgctcttgaagtcctgggc 315

                                                                       
Query: 343 gatctcccggacgaggcgctgaaaggggagcttgcggatgagcagctccgtgctcttctg 402
            ||||| |||||||  ||||| ||||||||||||||||| || ||||| |||  ||||||
Sbjct: 314 aatctcacggacgaaacgctggaaggggagcttgcggatcagaagctcggtggacttctg 255

              
Query: 403 gta 405
           |||
Sbjct: 254 gta 252



to top

>gb|AY158947.1| Mus musculus histone protein Hist1h3f gene, complete cds
          Length = 1851

 Score =  204 bits (103), Expect = 2e-49
 Identities = 196/227 (86%)
 Strand = Plus / Minus

                                                                       
Query: 164 cgctccccgcggatgcggcgggcgagctggatgtccttgggcatgattgtgacgcgcttg 223
           ||||| |||||||| |||||||| ||||||||||||||||||||||| ||||| ||||||
Sbjct: 924 cgctcgccgcggatacggcgggccagctggatgtccttgggcatgatggtgacacgcttg 865

                                                                       
Query: 224 gcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtacgcctcggcggcc 283
           |||||||||||||| |||||||||||||| || || || || ||||| ||||||   |||
Sbjct: 864 gcgtggatggcgcacaggttggtgtcctcaaacagacccacaaggtaggcctcgctcgcc 805

                                                                       
Query: 284 tcctggagcgcggagacggcggaggactggaagcggaggtcggtcttgaagtcctgcgcg 343
           ||||| || ||   |||||| |||  ||||||||| ||||||||||||||||||||||||
Sbjct: 804 tcctgcagagccatgacggccgagctctggaagcgcaggtcggtcttgaagtcctgcgcg 745

                                                          
Query: 344 atctcccggacgaggcgctgaaaggggagcttgcggatgagcagctc 390
           ||||| || || |||||||| || || ||||||||||| ||||||||
Sbjct: 744 atctcgcgcaccaggcgctggaacggcagcttgcggatcagcagctc 698



to top

>gb|AY662898.1| Paretroplus cf. kieneri 'Amboaboa' histone H3a gene, partial cds
          Length = 333

 Score =  204 bits (103), Expect = 2e-49
 Identities = 154/171 (90%)
 Strand = Plus / Minus

                                                                       
Query: 220 cttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtacgcctcggc 279
           ||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||  
Sbjct: 329 cttggcgtggatggcgcagaggttggtgtcctcgaagagcccgaccaggtaagcctcgct 270

                                                                       
Query: 280 ggcctcctggagcgcggagacggcggaggactggaagcggaggtcggtcttgaagtcctg 339
           ||||||||| || ||   ||||||||||  ||||||||| ||||||||||||||||||||
Sbjct: 269 ggcctcctgcagagccatgacggcggagctctggaagcgcaggtcggtcttgaagtcctg 210

                                                              
Query: 340 cgcgatctcccggacgaggcgctgaaaggggagcttgcggatgagcagctc 390
            |||||||| ||||| |||||||| ||||| ||||||||||||||||||||
Sbjct: 209 agcgatctcgcggaccaggcgctggaagggcagcttgcggatgagcagctc 159



to top

>gb|BC101955.1| Mus musculus histone 1, H3f, mRNA (cDNA clone MGC:123923
           IMAGE:40044769), complete cds
          Length = 1004

 Score =  204 bits (103), Expect = 2e-49
 Identities = 196/227 (86%)
 Strand = Plus / Minus

                                                                       
Query: 164 cgctccccgcggatgcggcgggcgagctggatgtccttgggcatgattgtgacgcgcttg 223
           ||||| |||||||| |||||||| ||||||||||||||||||||||| ||||| ||||||
Sbjct: 837 cgctcgccgcggatacggcgggccagctggatgtccttgggcatgatggtgacacgcttg 778

                                                                       
Query: 224 gcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtacgcctcggcggcc 283
           |||||||||||||| |||||||||||||| || || || || ||||| ||||||   |||
Sbjct: 777 gcgtggatggcgcacaggttggtgtcctcaaacagacccacaaggtaggcctcgctcgcc 718

                                                                       
Query: 284 tcctggagcgcggagacggcggaggactggaagcggaggtcggtcttgaagtcctgcgcg 343
           ||||| || ||   |||||| |||  ||||||||| ||||||||||||||||||||||||
Sbjct: 717 tcctgcagagccatgacggccgagctctggaagcgcaggtcggtcttgaagtcctgcgcg 658

                                                          
Query: 344 atctcccggacgaggcgctgaaaggggagcttgcggatgagcagctc 390
           ||||| || || |||||||| || || ||||||||||| ||||||||
Sbjct: 657 atctcgcgcaccaggcgctggaacggcagcttgcggatcagcagctc 611



to top

>gb|BC101956.1| Mus musculus histone 1, H3f, mRNA (cDNA clone MGC:123922
           IMAGE:40044765), complete cds
          Length = 1004

 Score =  204 bits (103), Expect = 2e-49
 Identities = 196/227 (86%)
 Strand = Plus / Minus

                                                                       
Query: 164 cgctccccgcggatgcggcgggcgagctggatgtccttgggcatgattgtgacgcgcttg 223
           ||||| |||||||| |||||||| ||||||||||||||||||||||| ||||| ||||||
Sbjct: 837 cgctcgccgcggatacggcgggccagctggatgtccttgggcatgatggtgacacgcttg 778

                                                                       
Query: 224 gcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtacgcctcggcggcc 283
           |||||||||||||| |||||||||||||| || || || || ||||| ||||||   |||
Sbjct: 777 gcgtggatggcgcacaggttggtgtcctcaaacagacccacaaggtaggcctcgctcgcc 718

                                                                       
Query: 284 tcctggagcgcggagacggcggaggactggaagcggaggtcggtcttgaagtcctgcgcg 343
           ||||| || ||   |||||| |||  ||||||||| ||||||||||||||||||||||||
Sbjct: 717 tcctgcagagccatgacggccgagctctggaagcgcaggtcggtcttgaagtcctgcgcg 658

                                                          
Query: 344 atctcccggacgaggcgctgaaaggggagcttgcggatgagcagctc 390
           ||||| || || |||||||| || || ||||||||||| ||||||||
Sbjct: 657 atctcgcgcaccaggcgctggaacggcagcttgcggatcagcagctc 611



to top

>gb|BC101954.1| Mus musculus histone 1, H3f, mRNA (cDNA clone MGC:123924
           IMAGE:40044770), complete cds
          Length = 1004

 Score =  204 bits (103), Expect = 2e-49
 Identities = 196/227 (86%)
 Strand = Plus / Minus

                                                                       
Query: 164 cgctccccgcggatgcggcgggcgagctggatgtccttgggcatgattgtgacgcgcttg 223
           ||||| |||||||| |||||||| ||||||||||||||||||||||| ||||| ||||||
Sbjct: 837 cgctcgccgcggatacggcgggccagctggatgtccttgggcatgatggtgacacgcttg 778

                                                                       
Query: 224 gcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtacgcctcggcggcc 283
           |||||||||||||| |||||||||||||| || || || || ||||| ||||||   |||
Sbjct: 777 gcgtggatggcgcacaggttggtgtcctcaaacagacccacaaggtaggcctcgctcgcc 718

                                                                       
Query: 284 tcctggagcgcggagacggcggaggactggaagcggaggtcggtcttgaagtcctgcgcg 343
           ||||| || ||   |||||| |||  ||||||||| ||||||||||||||||||||||||
Sbjct: 717 tcctgcagagccatgacggccgagctctggaagcgcaggtcggtcttgaagtcctgcgcg 658

                                                          
Query: 344 atctcccggacgaggcgctgaaaggggagcttgcggatgagcagctc 390
           ||||| || || |||||||| || || ||||||||||| ||||||||
Sbjct: 657 atctcgcgcaccaggcgctggaacggcagcttgcggatcagcagctc 611



to top

>gb|M32459.1|MUSHIS3A Mouse histone H3 (H3.2-221) gene, complete cds
          Length = 982

 Score =  204 bits (103), Expect = 2e-49
 Identities = 196/227 (86%)
 Strand = Plus / Minus

                                                                       
Query: 164 cgctccccgcggatgcggcgggcgagctggatgtccttgggcatgattgtgacgcgcttg 223
           ||||| |||||||| |||||||| ||||||||||||||||||||||| ||||| ||||||
Sbjct: 812 cgctcgccgcggatacggcgggccagctggatgtccttgggcatgatggtgacacgcttg 753

                                                                       
Query: 224 gcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtacgcctcggcggcc 283
           |||||||||||||| |||||||||||||| || || || || ||||| ||||||   |||
Sbjct: 752 gcgtggatggcgcacaggttggtgtcctcaaacagacccacaaggtaggcctcgctcgcc 693

                                                                       
Query: 284 tcctggagcgcggagacggcggaggactggaagcggaggtcggtcttgaagtcctgcgcg 343
           ||||| || ||   |||||| |||  ||||||||| ||||||||||||||||||||||||
Sbjct: 692 tcctgcagagccatgacggccgagctctggaagcgcaggtcggtcttgaagtcctgcgcg 633

                                                          
Query: 344 atctcccggacgaggcgctgaaaggggagcttgcggatgagcagctc 390
           ||||| || || |||||||| || || ||||||||||| ||||||||
Sbjct: 632 atctcgcgcaccaggcgctggaacggcagcttgcggatcagcagctc 586



to top

>ref|NM_021059.2| Homo sapiens histone 2, H3c (HIST2H3C), mRNA
          Length = 507

 Score =  202 bits (102), Expect = 7e-49
 Identities = 207/242 (85%)
 Strand = Plus / Minus

                                                                       
Query: 164 cgctccccgcggatgcggcgggcgagctggatgtccttgggcatgattgtgacgcgcttg 223
           ||||| || |||||||||||||| |||||||||||||||||||| || || |||||||||
Sbjct: 440 cgctctccacggatgcggcgggccagctggatgtccttgggcataatggtcacgcgcttg 381

                                                                       
Query: 224 gcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtacgcctcggcggcc 283
           |||||||||||||| ||||| ||||| ||||| ||||| || ||||| ||||||  ||||
Sbjct: 380 gcgtggatggcgcacaggttcgtgtcttcgaacagccccaccaggtaggcctcgctggcc 321

                                                                       
Query: 284 tcctggagcgcggagacggcggaggactggaagcggaggtcggtcttgaagtcctgcgcg 343
           ||||| |||||    ||||| |||  ||||||||| ||||| ||||| ||||||||||||
Sbjct: 320 tcctgcagcgccatcacggccgagctctggaagcgcaggtccgtcttaaagtcctgcgcg 261

                                                                       
Query: 344 atctcccggacgaggcgctgaaaggggagcttgcggatgagcagctccgtgctcttctgg 403
           ||||| || || || ||||| ||||| ||||||||||| ||||||||||||  |||||||
Sbjct: 260 atctcgcgtaccagccgctggaagggcagcttgcggatcagcagctccgtggacttctgg 201

             
Query: 404 ta 405
           ||
Sbjct: 200 ta 199



to top

>gb|AY648851.1| Homo sapiens histone H3/o gene, complete cds
          Length = 1227

 Score =  202 bits (102), Expect = 7e-49
 Identities = 207/242 (85%)
 Strand = Plus / Minus

                                                                       
Query: 164 cgctccccgcggatgcggcgggcgagctggatgtccttgggcatgattgtgacgcgcttg 223
           ||||| || |||||||||||||| |||||||||||||||||||| || || |||||||||
Sbjct: 813 cgctctccacggatgcggcgggccagctggatgtccttgggcataatggtcacgcgcttg 754

                                                                       
Query: 224 gcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtacgcctcggcggcc 283
           |||||||||||||| ||||| ||||| ||||| ||||| || ||||| ||||||  ||||
Sbjct: 753 gcgtggatggcgcacaggttcgtgtcttcgaacagccccaccaggtaggcctcgctggcc 694

                                                                       
Query: 284 tcctggagcgcggagacggcggaggactggaagcggaggtcggtcttgaagtcctgcgcg 343
           ||||| |||||    ||||| |||  ||||||||| ||||| ||||| ||||||||||||
Sbjct: 693 tcctgcagcgccatcacggccgagctctggaagcgcaggtccgtcttaaagtcctgcgcg 634

                                                                       
Query: 344 atctcccggacgaggcgctgaaaggggagcttgcggatgagcagctccgtgctcttctgg 403
           ||||| || || || ||||| ||||| ||||||||||| ||||||||||||  |||||||
Sbjct: 633 atctcgcgtaccagccgctggaagggcagcttgcggatcagcagctccgtggacttctgg 574

             
Query: 404 ta 405
           ||
Sbjct: 573 ta 572



to top

>gb|BC063540.1| Homo sapiens cDNA clone IMAGE:4523373, **** WARNING: chimeric clone
           ****
          Length = 1047

 Score =  202 bits (102), Expect = 7e-49
 Identities = 207/242 (85%)
 Strand = Plus / Minus

                                                                       
Query: 164 cgctccccgcggatgcggcgggcgagctggatgtccttgggcatgattgtgacgcgcttg 223
           ||||| || |||||||||||||| |||||||||||||||||||| || || |||||||||
Sbjct: 417 cgctctccacggatgcggcgggccagctggatgtccttgggcataatggtcacgcgcttg 358

                                                                       
Query: 224 gcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtacgcctcggcggcc 283
           |||||||||||||| ||||| ||||| ||||| ||||| || ||||| ||||||  ||||
Sbjct: 357 gcgtggatggcgcacaggttcgtgtcttcgaacagccccaccaggtaggcctcgctggcc 298

                                                                       
Query: 284 tcctggagcgcggagacggcggaggactggaagcggaggtcggtcttgaagtcctgcgcg 343
           ||||| |||||    ||||| |||  ||||||||| ||||| ||||| ||||||||||||
Sbjct: 297 tcctgcagcgccatcacggccgagctctggaagcgcaggtccgtcttaaagtcctgcgcg 238

                                                                       
Query: 344 atctcccggacgaggcgctgaaaggggagcttgcggatgagcagctccgtgctcttctgg 403
           ||||| || || || ||||| ||||| ||||||||||| ||||||||||||  |||||||
Sbjct: 237 atctcgcgtaccagccgctggaagggcagcttgcggatcagcagctccgtggacttctgg 178

             
Query: 404 ta 405
           ||
Sbjct: 177 ta 176



to top

>gb|BC015544.1| Homo sapiens histone 2, H3c, mRNA (cDNA clone IMAGE:3913365)
          Length = 1672

 Score =  202 bits (102), Expect = 7e-49
 Identities = 207/242 (85%)
 Strand = Plus / Minus

                                                                       
Query: 164 cgctccccgcggatgcggcgggcgagctggatgtccttgggcatgattgtgacgcgcttg 223
           ||||| || |||||||||||||| |||||||||||||||||||| || || |||||||||
Sbjct: 440 cgctctccacggatgcggcgggccagctggatgtccttgggcataatggtcacgcgcttg 381

                                                                       
Query: 224 gcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtacgcctcggcggcc 283
           |||||||||||||| ||||| ||||| ||||| ||||| || ||||| ||||||  ||||
Sbjct: 380 gcgtggatggcgcacaggttcgtgtcttcgaacagccccaccaggtaggcctcgctggcc 321

                                                                       
Query: 284 tcctggagcgcggagacggcggaggactggaagcggaggtcggtcttgaagtcctgcgcg 343
           ||||| |||||    ||||| |||  ||||||||| ||||| ||||| ||||||||||||
Sbjct: 320 tcctgcagcgccatcacggccgagctctggaagcgcaggtccgtcttaaagtcctgcgcg 261

                                                                       
Query: 344 atctcccggacgaggcgctgaaaggggagcttgcggatgagcagctccgtgctcttctgg 403
           ||||| || || || ||||| ||||| ||||||||||| ||||||||||||  |||||||
Sbjct: 260 atctcgcgtaccagccgctggaagggcagcttgcggatcagcagctccgtggacttctgg 201

             
Query: 404 ta 405
           ||
Sbjct: 200 ta 199



to top

>emb|X53330.1|PDHISTCL P.dumerilii histone gene cluster for core histones H2A, H2B, H3 and
            H4
          Length = 6052

 Score =  202 bits (102), Expect = 7e-49
 Identities = 189/218 (86%)
 Strand = Plus / Plus

                                                                        
Query: 173  cggatgcggcgggcgagctggatgtccttgggcatgattgtgacgcgcttggcgtggatg 232
            ||||| |||||||| | ||||||||||||||||||||| ||||| |||||||||||||||
Sbjct: 4159 cggatacggcgggccaactggatgtccttgggcatgatggtgactcgcttggcgtggatg 4218

                                                                        
Query: 233  gcgcagaggttggtgtcctcgaagagcccgacgaggtacgcctcggcggcctcctggagc 292
            ||||| | |||||||||||| ||||| || || | ||| ||||| | |||||||||||| 
Sbjct: 4219 gcgcacaagttggtgtcctcaaagagaccaaccaagtaagcctcagaggcctcctggaga 4278

                                                                        
Query: 293  gcggagacggcggaggactggaagcggaggtcggtcttgaagtcctgcgcgatctcccgg 352
            ||   |||||| ||||||||||| || |||||||||||||||||||| |||||||| |||
Sbjct: 4279 gccatgacggcagaggactggaatcgcaggtcggtcttgaagtcctgggcgatctcacgg 4338

                                                  
Query: 353  acgaggcgctgaaaggggagcttgcggatgagcagctc 390
            || || ||||| ||||| |||||||||||||| |||||
Sbjct: 4339 accagacgctggaagggcagcttgcggatgaggagctc 4376



to top

>gb|DQ284094.1| Synapturanus mirandaribeiroi histone H3a gene, partial cds
          Length = 328

 Score =  202 bits (102), Expect = 7e-49
 Identities = 165/186 (88%)
 Strand = Plus / Minus

                                                                       
Query: 220 cttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtacgcctcggc 279
           ||||||||||||||||||||||||||||||||||||||| ||||| ||||| ||||||  
Sbjct: 325 cttggcgtggatggcgcagaggttggtgtcctcgaagagtccgaccaggtaagcctcgct 266

                                                                       
Query: 280 ggcctcctggagcgcggagacggcggaggactggaagcggaggtcggtcttgaagtcctg 339
           ||||||||| || ||   ||||||||||  ||||||||| ||||||||||||||||||||
Sbjct: 265 ggcctcctgcagagccatgacggcggagctctggaagcgcaggtcggtcttgaagtcctg 206

                                                                       
Query: 340 cgcgatctcccggacgaggcgctgaaaggggagcttgcggatgagcagctccgtgctctt 399
            |||||||||| |||||||||||| ||||| ||||||||||| |||||||| |||  |||
Sbjct: 205 ggcgatctccctgacgaggcgctggaagggcagcttgcggatcagcagctcggtggactt 146

                 
Query: 400 ctggta 405
           ||||||
Sbjct: 145 ctggta 140



to top

>gb|DQ284081.1| Leptobrachium chapaense histone H3a gene, partial cds
          Length = 328

 Score =  202 bits (102), Expect = 7e-49
 Identities = 165/186 (88%)
 Strand = Plus / Minus

                                                                       
Query: 220 cttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtacgcctcggc 279
           ||||||||||||||| || |||||||||||||||||||| ||||| ||||| ||||||  
Sbjct: 325 cttggcgtggatggcacacaggttggtgtcctcgaagagkccgaccaggtaagcctcgct 266

                                                                       
Query: 280 ggcctcctggagcgcggagacggcggaggactggaagcggaggtcggtcttgaagtcctg 339
           ||||||||| || ||   ||||||||||  ||||||||| ||||||||||||||||||||
Sbjct: 265 ggcctcctgcagagccatgacggcggagctctggaagcgcaggtcggtcttgaagtcctg 206

                                                                       
Query: 340 cgcgatctcccggacgaggcgctgaaaggggagcttgcggatgagcagctccgtgctctt 399
           ||||||||||||||| |||||||| ||||| |||||||||||||||||||| |||  |||
Sbjct: 205 cgcgatctcccggaccaggcgctggaagggcagcttgcggatgagcagctcggtggactt 146

                 
Query: 400 ctggta 405
           ||||||
Sbjct: 145 ctggta 140



to top

>ref|XM_928391.1| PREDICTED: Homo sapiens similar to CG31613-PA (LOC653611), mRNA
          Length = 824

 Score =  202 bits (102), Expect = 7e-49
 Identities = 207/242 (85%)
 Strand = Plus / Minus

                                                                       
Query: 164 cgctccccgcggatgcggcgggcgagctggatgtccttgggcatgattgtgacgcgcttg 223
           ||||| || |||||||||||||| |||||||||||||||||||| || || |||||||||
Sbjct: 693 cgctctccacggatgcggcgggccagctggatgtccttgggcataatggtcacgcgcttg 634

                                                                       
Query: 224 gcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtacgcctcggcggcc 283
           |||||||||||||| ||||| ||||| ||||| ||||| || ||||| ||||||  ||||
Sbjct: 633 gcgtggatggcgcacaggttcgtgtcttcgaacagccccaccaggtaggcctcgctggcc 574

                                                                       
Query: 284 tcctggagcgcggagacggcggaggactggaagcggaggtcggtcttgaagtcctgcgcg 343
           ||||| |||||    ||||| |||  ||||||||| ||||| ||||| ||||||||||||
Sbjct: 573 tcctgcagcgccatcacggccgagctctggaagcgcaggtccgtcttaaagtcctgcgcg 514

                                                                       
Query: 344 atctcccggacgaggcgctgaaaggggagcttgcggatgagcagctccgtgctcttctgg 403
           ||||| || || || ||||| ||||| ||||||||||| ||||||||||||  |||||||
Sbjct: 513 atctcgcgtaccagccgctggaagggcagcttgcggatcagcagctccgtggacttctgg 454

             
Query: 404 ta 405
           ||
Sbjct: 453 ta 452



to top

>ref|NG_002617.1| Homo sapiens histone 2, H3a (HIST2H3A) pseudogene on chromosome 1
          Length = 1323

 Score =  202 bits (102), Expect = 7e-49
 Identities = 207/242 (85%)
 Strand = Plus / Minus

                                                                       
Query: 164 cgctccccgcggatgcggcgggcgagctggatgtccttgggcatgattgtgacgcgcttg 223
           ||||| || |||||||||||||| |||||||||||||||||||| || || |||||||||
Sbjct: 927 cgctctccacggatgcggcgggccagctggatgtccttgggcataatggtcacgcgcttg 868

                                                                       
Query: 224 gcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtacgcctcggcggcc 283
           |||||||||||||| ||||| ||||| ||||| ||||| || ||||| ||||||  ||||
Sbjct: 867 gcgtggatggcgcacaggttcgtgtcttcgaacagccccaccaggtaggcctcgctggcc 808

                                                                       
Query: 284 tcctggagcgcggagacggcggaggactggaagcggaggtcggtcttgaagtcctgcgcg 343
           ||||| |||||    ||||| |||  ||||||||| ||||| ||||| ||||||||||||
Sbjct: 807 tcctgcagcgccatcacggccgagctctggaagcgcaggtccgtcttaaagtcctgcgcg 748

                                                                       
Query: 344 atctcccggacgaggcgctgaaaggggagcttgcggatgagcagctccgtgctcttctgg 403
           ||||| || || || ||||| ||||| ||||||||||| ||||||||||||  |||||||
Sbjct: 747 atctcgcgtaccagccgctggaagggcagcttgcggatcagcagctccgtggacttctgg 688

             
Query: 404 ta 405
           ||
Sbjct: 687 ta 686



to top

>ref|NM_001005464.1| Homo sapiens histone H3/o (H3/o), mRNA
          Length = 411

 Score =  202 bits (102), Expect = 7e-49
 Identities = 207/242 (85%)
 Strand = Plus / Minus

                                                                       
Query: 164 cgctccccgcggatgcggcgggcgagctggatgtccttgggcatgattgtgacgcgcttg 223
           ||||| || |||||||||||||| |||||||||||||||||||| || || |||||||||
Sbjct: 404 cgctctccacggatgcggcgggccagctggatgtccttgggcataatggtcacgcgcttg 345

                                                                       
Query: 224 gcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtacgcctcggcggcc 283
           |||||||||||||| ||||| ||||| ||||| ||||| || ||||| ||||||  ||||
Sbjct: 344 gcgtggatggcgcacaggttcgtgtcttcgaacagccccaccaggtaggcctcgctggcc 285

                                                                       
Query: 284 tcctggagcgcggagacggcggaggactggaagcggaggtcggtcttgaagtcctgcgcg 343
           ||||| |||||    ||||| |||  ||||||||| ||||| ||||| ||||||||||||
Sbjct: 284 tcctgcagcgccatcacggccgagctctggaagcgcaggtccgtcttaaagtcctgcgcg 225

                                                                       
Query: 344 atctcccggacgaggcgctgaaaggggagcttgcggatgagcagctccgtgctcttctgg 403
           ||||| || || || ||||| ||||| ||||||||||| ||||||||||||  |||||||
Sbjct: 224 atctcgcgtaccagccgctggaagggcagcttgcggatcagcagctccgtggacttctgg 165

             
Query: 404 ta 405
           ||
Sbjct: 164 ta 163



to top

>gb|BC074969.2| Homo sapiens histone H3/o, mRNA (cDNA clone IMAGE:30915509),
           partial cds
          Length = 481

 Score =  202 bits (102), Expect = 7e-49
 Identities = 207/242 (85%)
 Strand = Plus / Minus

                                                                       
Query: 164 cgctccccgcggatgcggcgggcgagctggatgtccttgggcatgattgtgacgcgcttg 223
           ||||| || |||||||||||||| |||||||||||||||||||| || || |||||||||
Sbjct: 432 cgctctccacggatgcggcgggccagctggatgtccttgggcataatggtcacgcgcttg 373

                                                                       
Query: 224 gcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtacgcctcggcggcc 283
           |||||||||||||| ||||| ||||| ||||| ||||| || ||||| ||||||  ||||
Sbjct: 372 gcgtggatggcgcacaggttcgtgtcttcgaacagccccaccaggtaggcctcgctggcc 313

                                                                       
Query: 284 tcctggagcgcggagacggcggaggactggaagcggaggtcggtcttgaagtcctgcgcg 343
           ||||| |||||    ||||| |||  ||||||||| ||||| ||||| ||||||||||||
Sbjct: 312 tcctgcagcgccatcacggccgagctctggaagcgcaggtccgtcttaaagtcctgcgcg 253

                                                                       
Query: 344 atctcccggacgaggcgctgaaaggggagcttgcggatgagcagctccgtgctcttctgg 403
           ||||| || || || ||||| ||||| ||||||||||| ||||||||||||  |||||||
Sbjct: 252 atctcgcgtaccagccgctggaagggcagcttgcggatcagcagctccgtggacttctgg 193

             
Query: 404 ta 405
           ||
Sbjct: 192 ta 191



to top

>gb|AF531307.1| Homo sapiens histone H3 (HIST2H3C) gene, complete cds
          Length = 1227

 Score =  202 bits (102), Expect = 7e-49
 Identities = 207/242 (85%)
 Strand = Plus / Minus

                                                                       
Query: 164 cgctccccgcggatgcggcgggcgagctggatgtccttgggcatgattgtgacgcgcttg 223
           ||||| || |||||||||||||| |||||||||||||||||||| || || |||||||||
Sbjct: 813 cgctctccacggatgcggcgggccagctggatgtccttgggcataatggtcacgcgcttg 754

                                                                       
Query: 224 gcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtacgcctcggcggcc 283
           |||||||||||||| ||||| ||||| ||||| ||||| || ||||| ||||||  ||||
Sbjct: 753 gcgtggatggcgcacaggttcgtgtcttcgaacagccccaccaggtaggcctcgctggcc 694

                                                                       
Query: 284 tcctggagcgcggagacggcggaggactggaagcggaggtcggtcttgaagtcctgcgcg 343
           ||||| |||||    ||||| |||  ||||||||| ||||| ||||| ||||||||||||
Sbjct: 693 tcctgcagcgccatcacggccgagctctggaagcgcaggtccgtcttaaagtcctgcgcg 634

                                                                       
Query: 344 atctcccggacgaggcgctgaaaggggagcttgcggatgagcagctccgtgctcttctgg 403
           ||||| || || || ||||| ||||| ||||||||||| ||||||||||||  |||||||
Sbjct: 633 atctcgcgtaccagccgctggaagggcagcttgcggatcagcagctccgtggacttctgg 574

             
Query: 404 ta 405
           ||
Sbjct: 573 ta 572



to top

>gb|AF531305.1| Homo sapiens histone H3 (HIST2H3A) pseudogene, complete sequence
          Length = 1323

 Score =  202 bits (102), Expect = 7e-49
 Identities = 207/242 (85%)
 Strand = Plus / Minus

                                                                       
Query: 164 cgctccccgcggatgcggcgggcgagctggatgtccttgggcatgattgtgacgcgcttg 223
           ||||| || |||||||||||||| |||||||||||||||||||| || || |||||||||
Sbjct: 927 cgctctccacggatgcggcgggccagctggatgtccttgggcataatggtcacgcgcttg 868

                                                                       
Query: 224 gcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtacgcctcggcggcc 283
           |||||||||||||| ||||| ||||| ||||| ||||| || ||||| ||||||  ||||
Sbjct: 867 gcgtggatggcgcacaggttcgtgtcttcgaacagccccaccaggtaggcctcgctggcc 808

                                                                       
Query: 284 tcctggagcgcggagacggcggaggactggaagcggaggtcggtcttgaagtcctgcgcg 343
           ||||| |||||    ||||| |||  ||||||||| ||||| ||||| ||||||||||||
Sbjct: 807 tcctgcagcgccatcacggccgagctctggaagcgcaggtccgtcttaaagtcctgcgcg 748

                                                                       
Query: 344 atctcccggacgaggcgctgaaaggggagcttgcggatgagcagctccgtgctcttctgg 403
           ||||| || || || ||||| ||||| ||||||||||| ||||||||||||  |||||||
Sbjct: 747 atctcgcgtaccagccgctggaagggcagcttgcggatcagcagctccgtggacttctgg 688

             
Query: 404 ta 405
           ||
Sbjct: 687 ta 686



to top

>emb|CR760429.2| Xenopus tropicalis finished cDNA, clone TNeu057j11
          Length = 538

 Score =  202 bits (102), Expect = 7e-49
 Identities = 183/210 (87%)
 Strand = Plus / Minus

                                                                       
Query: 181 gcgggcgagctggatgtccttgggcatgattgtgacgcgcttggcgtggatggcgcagag 240
           |||||| ||||||||||||||||||||||| ||||| | |||||||||||||||||| ||
Sbjct: 405 gcgggccagctggatgtccttgggcatgatggtgaccctcttggcgtggatggcgcacag 346

                                                                       
Query: 241 gttggtgtcctcgaagagcccgacgaggtacgcctcggcggcctcctggagcgcggagac 300
           |||||||||||| ||||| ||||| || || ||||||  ||||||||| || ||   |||
Sbjct: 345 gttggtgtcctcaaagagaccgaccagataagcctcgctggcctcctgcagagccatgac 286

                                                                       
Query: 301 ggcggaggactggaagcggaggtcggtcttgaagtcctgcgcgatctcccggacgaggcg 360
           ||| |||  ||||||||| |||||||||||||||||||| |||||||||||||| |||||
Sbjct: 285 ggctgagctctggaagcgcaggtcggtcttgaagtcctgagcgatctcccggaccaggcg 226

                                         
Query: 361 ctgaaaggggagcttgcggatgagcagctc 390
           ||| || || || |||||||||||||||||
Sbjct: 225 ctggaaaggcagtttgcggatgagcagctc 196



to top

>ref|NM_013550.3| Mus musculus histone 1, H3a (Hist1h3a), mRNA
          Length = 535

 Score =  200 bits (101), Expect = 3e-48
 Identities = 194/225 (86%)
 Strand = Plus / Minus

                                                                       
Query: 166 ctccccgcggatgcggcgggcgagctggatgtccttgggcatgattgtgacgcgcttggc 225
           ||||||||||||||||||||| || |||||||||||||||||||| ||||| ||||||||
Sbjct: 436 ctccccgcggatgcggcgggccagttggatgtccttgggcatgatggtgacacgcttggc 377

                                                                       
Query: 226 gtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtacgcctcggcggcctc 285
           |||||||||||| |||||||||||||| || || || || ||||| |||||   ||||||
Sbjct: 376 gtggatggcgcacaggttggtgtcctcaaacagacccacaaggtaggcctcacaggcctc 317

                                                                       
Query: 286 ctggagcgcggagacggcggaggactggaagcggaggtcggtcttgaagtcctgcgcgat 345
           ||| |  ||   |||||| |||  ||||||||| ||||||||||||||||||||||||||
Sbjct: 316 ctgcaaagccatgacggccgagctctggaagcgcaggtcggtcttgaagtcctgcgcgat 257

                                                        
Query: 346 ctcccggacgaggcgctgaaaggggagcttgcggatgagcagctc 390
           ||| || || |||||||| || || ||||||||||| ||||||||
Sbjct: 256 ctcgcgcaccaggcgctggaacggcagcttgcggatcagcagctc 212



to top

>gb|BC107287.1| Mus musculus histone 1, H3a, mRNA (cDNA clone IMAGE:40053019),
           partial cds
          Length = 415

 Score =  200 bits (101), Expect = 3e-48
 Identities = 194/225 (86%)
 Strand = Plus / Minus

                                                                       
Query: 166 ctccccgcggatgcggcgggcgagctggatgtccttgggcatgattgtgacgcgcttggc 225
           ||||||||| ||||| ||||| ||||||||||||||||||||||| ||||| ||||||||
Sbjct: 398 ctccccgcgaatgcgacgggccagctggatgtccttgggcatgatggtgacacgcttggc 339

                                                                       
Query: 226 gtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtacgcctcggcggcctc 285
           |||||||||||| |||||||||||||| || || || |||||||| |||||   ||||||
Sbjct: 338 gtggatggcgcacaggttggtgtcctcaaacagacccacgaggtaggcctcacaggcctc 279

                                                                       
Query: 286 ctggagcgcggagacggcggaggactggaagcggaggtcggtcttgaagtcctgcgcgat 345
           ||| || ||   ||| || |||  ||||||||| ||||||||||||||||||||||||||
Sbjct: 278 ctgcagagccatgacagccgagctctggaagcgcaggtcggtcttgaagtcctgcgcgat 219

                                                        
Query: 346 ctcccggacgaggcgctgaaaggggagcttgcggatgagcagctc 390
           ||| || || |||||||| || || ||||||||||| ||||||||
Sbjct: 218 ctcgcgcaccaggcgctggaacggcagcttgcggatcagcagctc 174



to top

>emb|X80324.1|MPMPH3110 M.pahari mpH3110 gene
          Length = 990

 Score =  200 bits (101), Expect = 3e-48
 Identities = 194/225 (86%)
 Strand = Plus / Minus

                                                                       
Query: 166 ctccccgcggatgcggcgggcgagctggatgtccttgggcatgattgtgacgcgcttggc 225
           ||||||||||||||||||||| |||||||||||||| |||||||| ||||| ||||||||
Sbjct: 842 ctccccgcggatgcggcgggccagctggatgtccttaggcatgatggtgacacgcttggc 783

                                                                       
Query: 226 gtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtacgcctcggcggcctc 285
           |||||||||||| |||||||||||||| || || || || ||||| |||||   ||||||
Sbjct: 782 gtggatggcgcacaggttggtgtcctcaaacagacccacaaggtaggcctcacaggcctc 723

                                                                       
Query: 286 ctggagcgcggagacggcggaggactggaagcggaggtcggtcttgaagtcctgcgcgat 345
           ||| || ||   |||||| |||  ||||||||| |||||||||||||||||||| |||||
Sbjct: 722 ctgcagagccatgacggccgagctctggaagcgcaggtcggtcttgaagtcctgtgcgat 663

                                                        
Query: 346 ctcccggacgaggcgctgaaaggggagcttgcggatgagcagctc 390
           ||| || || |||||||| || || ||||||||||| ||||||||
Sbjct: 662 ctcgcgcaccaggcgctggaacggcagcttgcggatcagcagctc 618



to top

>emb|X13675.1|MSHIS3C2 Medicago sativa mRNA for histone H3 clone pH3c-3
          Length = 513

 Score =  200 bits (101), Expect = 3e-48
 Identities = 200/233 (85%)
 Strand = Plus / Minus

                                                                       
Query: 185 gcgagctggatgtccttgggcatgattgtgacgcgcttggcgtggatggcgcagaggttg 244
           ||||||||||| ||||| |||||||| ||||| |||||||| || |||||||||||||| 
Sbjct: 344 gcgagctggatatccttaggcatgatagtgacacgcttggcatgaatggcgcagaggtta 285

                                                                       
Query: 245 gtgtcctcgaagagcccgacgaggtacgcctcggcggcctcctggagcgcggagacggcg 304
           || ||||| ||||| |||||||| || |||||||| || || || || || || ||||||
Sbjct: 284 gtatcctcaaagagaccgacgagataagcctcggccgcttcttgcagtgccgacacggcg 225

                                                                       
Query: 305 gaggactggaagcggaggtcggtcttgaagtcctgcgcgatctcccggacgaggcgctga 364
           |||  |||||| ||||| || |||||||| ||||| |||||||| ||||| || ||||| 
Sbjct: 224 gagctctggaaacggagatcagtcttgaaatcctgagcgatctcacggacaagacgctgg 165

                                                                
Query: 365 aaggggagcttgcggatgagcagctccgtgctcttctggtacttgcggatctc 417
           |||||||| ||||||||||| ||||| ||||||||||||||||||||||||||
Sbjct: 164 aaggggagtttgcggatgaggagctcagtgctcttctggtacttgcggatctc 112



to top

>gb|AY521731.1| Hydropsyche sp. BYU_ACTR020 histone H3 (H3) gene, partial cds
          Length = 354

 Score =  200 bits (101), Expect = 3e-48
 Identities = 188/217 (86%)
 Strand = Plus / Minus

                                                                       
Query: 202 gggcatgattgtgacgcgcttggcgtggatggcgcagaggttggtgtcctcgaagagccc 261
           ||||||||| |||||||||||||||||||| ||||| ||||| ||||||||||| || ||
Sbjct: 354 gggcatgatggtgacgcgcttggcgtggatcgcgcacaggttcgtgtcctcgaacaggcc 295

                                                                       
Query: 262 gacgaggtacgcctcggcggcctcctggagcgcggagacggcggaggactggaagcggag 321
           ||||||||||||||||  ||||||||| || ||   |||||| |||  ||||||||||||
Sbjct: 294 gacgaggtacgcctcgctggcctcctgcagggccatgacggccgagctctggaagcggag 235

                                                                       
Query: 322 gtcggtcttgaagtcctgcgcgatctcccggacgaggcgctgaaaggggagcttgcggat 381
           |||||||||||||||||| |||||||| || || || ||||| ||||| |||||||||||
Sbjct: 234 gtcggtcttgaagtcctgggcgatctcgcgcaccagacgctggaagggcagcttgcggat 175

                                                
Query: 382 gagcagctccgtgctcttctggtacttgcggatctcc 418
            || ||||| ||||||||||||||   ||||||||||
Sbjct: 174 caggagctcggtgctcttctggtagcggcggatctcc 138



to top

>gb|DQ284356.1| Fejervarya limnocharis histone H3a gene, partial cds
          Length = 328

 Score =  200 bits (101), Expect = 3e-48
 Identities = 153/171 (89%)
 Strand = Plus / Minus

                                                                       
Query: 220 cttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtacgcctcggc 279
           ||||||||||||||||||||||||||||||||||||||| || ||||| || ||||||| 
Sbjct: 325 cttggcgtggatggcgcagaggttggtgtcctcgaagagtcctacgagataagcctcgga 266

                                                                       
Query: 280 ggcctcctggagcgcggagacggcggaggactggaagcggaggtcggtcttgaagtcctg 339
           ||||||||| || ||   ||||||||||  ||||||||| ||||||||||||||||||||
Sbjct: 265 ggcctcctgcagagccatgacggcggagctctggaagcgcaggtcggtcttgaagtcctg 206

                                                              
Query: 340 cgcgatctcccggacgaggcgctgaaaggggagcttgcggatgagcagctc 390
            |||||||| |||||||||||||| ||||| ||||||||||| ||||||||
Sbjct: 205 ggcgatctctcggacgaggcgctggaagggcagcttgcggatragcagctc 155



to top

>gb|DQ284170.1| Rana temporaria histone H3a gene, partial cds
          Length = 328

 Score =  200 bits (101), Expect = 3e-48
 Identities = 153/171 (89%)
 Strand = Plus / Minus

                                                                       
Query: 220 cttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtacgcctcggc 279
           ||||||||||||||||||||||||||||||||||||||| || ||||| || ||||||| 
Sbjct: 325 cttggcgtggatggcgcagaggttggtgtcctcgaagagtcctacgagataagcctcgga 266

                                                                       
Query: 280 ggcctcctggagcgcggagacggcggaggactggaagcggaggtcggtcttgaagtcctg 339
           ||||||||| || ||   ||||||||||  |||||| || ||||||||||||||||||||
Sbjct: 265 ggcctcctgcagagccatgacggcggagctctggaarcgcaggtcggtcttgaagtcctg 206

                                                              
Query: 340 cgcgatctcccggacgaggcgctgaaaggggagcttgcggatgagcagctc 390
            |||||||| |||||||||||||| ||||| ||||||||||||||||||||
Sbjct: 205 ggcgatctctcggacgaggcgctggaagggcagcttgcggatgagcagctc 155



to top

>dbj|AK155722.1| Mus musculus B6-derived CD11 +ve dendritic cells cDNA, RIKEN
           full-length enriched library, clone:F730210F11
           product:histone 1, H3h, full insert sequence
          Length = 1806

 Score =  200 bits (101), Expect = 3e-48
 Identities = 194/225 (86%)
 Strand = Plus / Minus

                                                                       
Query: 166 ctccccgcggatgcggcgggcgagctggatgtccttgggcatgattgtgacgcgcttggc 225
           ||||||||| ||||| ||||| ||||||||||||||||||||||| ||||| ||||||||
Sbjct: 430 ctccccgcgaatgcgacgggccagctggatgtccttgggcatgatggtgacacgcttggc 371

                                                                       
Query: 226 gtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtacgcctcggcggcctc 285
           |||||||||||| |||||||||||||| || || || |||||||| |||||   ||||||
Sbjct: 370 gtggatggcgcacaggttggtgtcctcaaacagacccacgaggtaggcctcacaggcctc 311

                                                                       
Query: 286 ctggagcgcggagacggcggaggactggaagcggaggtcggtcttgaagtcctgcgcgat 345
           ||| || ||   ||| || |||  ||||||||| ||||||||||||||||||||||||||
Sbjct: 310 ctgcagagccatgacagccgagctctggaagcgcaggtcggtcttgaagtcctgcgcgat 251

                                                        
Query: 346 ctcccggacgaggcgctgaaaggggagcttgcggatgagcagctc 390
           ||| || || |||||||| || || ||||||||||| ||||||||
Sbjct: 250 ctcgcgcaccaggcgctggaacggcagcttgcggatcagcagctc 206



to top

>gb|U62670.1|MMU62670 Mus musculus histone H3.1-I (H3-I) gene, complete cds
          Length = 727

 Score =  200 bits (101), Expect = 3e-48
 Identities = 194/225 (86%)
 Strand = Plus / Minus

                                                                       
Query: 166 ctccccgcggatgcggcgggcgagctggatgtccttgggcatgattgtgacgcgcttggc 225
           ||||||||| ||||| ||||| ||||||||||||||||||||||| ||||| ||||||||
Sbjct: 548 ctccccgcgaatgcgacgggccagctggatgtccttgggcatgatggtgacacgcttggc 489

                                                                       
Query: 226 gtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtacgcctcggcggcctc 285
           |||||||||||| |||||||||||||| || || || |||||||| |||||   ||||||
Sbjct: 488 gtggatggcgcacaggttggtgtcctcaaacagacccacgaggtaggcctcacaggcctc 429

                                                                       
Query: 286 ctggagcgcggagacggcggaggactggaagcggaggtcggtcttgaagtcctgcgcgat 345
           ||| || ||   ||| || |||  ||||||||| ||||||||||||||||||||||||||
Sbjct: 428 ctgcagagccatgacagccgagctctggaagcgcaggtcggtcttgaagtcctgcgcgat 369

                                                        
Query: 346 ctcccggacgaggcgctgaaaggggagcttgcggatgagcagctc 390
           ||| || || |||||||| || || ||||||||||| ||||||||
Sbjct: 368 ctcgcgcaccaggcgctggaacggcagcttgcggatcagcagctc 324



to top

>dbj|AK018952.1| Mus musculus adult male testis cDNA, RIKEN full-length enriched
           library, clone:1700111A06 product:H3 HISTONE homolog
           [Rattus norvegicus], full insert sequence
          Length = 535

 Score =  200 bits (101), Expect = 3e-48
 Identities = 194/225 (86%)
 Strand = Plus / Minus

                                                                       
Query: 166 ctccccgcggatgcggcgggcgagctggatgtccttgggcatgattgtgacgcgcttggc 225
           ||||||||||||||||||||| || |||||||||||||||||||| ||||| ||||||||
Sbjct: 436 ctccccgcggatgcggcgggccagttggatgtccttgggcatgatggtgacacgcttggc 377

                                                                       
Query: 226 gtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtacgcctcggcggcctc 285
           |||||||||||| |||||||||||||| || || || || ||||| |||||   ||||||
Sbjct: 376 gtggatggcgcacaggttggtgtcctcaaacagacccacaaggtaggcctcacaggcctc 317

                                                                       
Query: 286 ctggagcgcggagacggcggaggactggaagcggaggtcggtcttgaagtcctgcgcgat 345
           ||| |  ||   |||||| |||  ||||||||| ||||||||||||||||||||||||||
Sbjct: 316 ctgcaaagccatgacggccgagctctggaagcgcaggtcggtcttgaagtcctgcgcgat 257

                                                        
Query: 346 ctcccggacgaggcgctgaaaggggagcttgcggatgagcagctc 390
           ||| || || |||||||| || || ||||||||||| ||||||||
Sbjct: 256 ctcgcgcaccaggcgctggaacggcagcttgcggatcagcagctc 212



to top

>gb|AY158945.1| Mus musculus histone protein Hist1h3i gene, complete cds
          Length = 1408

 Score =  200 bits (101), Expect = 3e-48
 Identities = 194/225 (86%)
 Strand = Plus / Minus

                                                                       
Query: 166 ctccccgcggatgcggcgggcgagctggatgtccttgggcatgattgtgacgcgcttggc 225
           ||||||||| ||||| ||||| ||||||||||||||||||||||| ||||| ||||||||
Sbjct: 902 ctccccgcgaatgcgacgggccagctggatgtccttgggcatgatggtgacacgcttggc 843

                                                                       
Query: 226 gtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtacgcctcggcggcctc 285
           |||||||||||| |||||||||||||| || || || |||||||| |||||   ||||||
Sbjct: 842 gtggatggcgcacaggttggtgtcctcaaacagacccacgaggtaggcctcacaggcctc 783

                                                                       
Query: 286 ctggagcgcggagacggcggaggactggaagcggaggtcggtcttgaagtcctgcgcgat 345
           ||| || ||   ||| || |||  ||||||||| ||||||||||||||||||||||||||
Sbjct: 782 ctgcagagccatgacagccgagctctggaagcgcaggtcggtcttgaagtcctgcgcgat 723

                                                        
Query: 346 ctcccggacgaggcgctgaaaggggagcttgcggatgagcagctc 390
           ||| || || |||||||| || || ||||||||||| ||||||||
Sbjct: 722 ctcgcgcaccaggcgctggaacggcagcttgcggatcagcagctc 678



to top

>ref|XM_560604.1| Anopheles gambiae str. PEST ENSANGP00000025641
           (ENSANGG00000024840), partial mRNA
          Length = 411

 Score =  200 bits (101), Expect = 3e-48
 Identities = 200/233 (85%)
 Strand = Plus / Minus

                                                                       
Query: 158 taggcgcgctccccgcggatgcggcgggcgagctggatgtccttgggcatgattgtgacg 217
           ||||| ||||| ||||| ||||| ||||| ||||||||||||||||||||||| ||||||
Sbjct: 410 taggcacgctctccgcgaatgcgacgggccagctggatgtccttgggcatgatggtgacg 351

                                                                       
Query: 218 cgcttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtacgcctcg 277
           |||||||||||||||||||| || || ||||| ||||| || || || ||||||||||||
Sbjct: 350 cgcttggcgtggatggcgcacagattcgtgtcttcgaacagaccaaccaggtacgcctcg 291

                                                                       
Query: 278 gcggcctcctggagcgcggagacggcggaggactggaagcggaggtcggtcttgaagtcc 337
             ||| ||||| |||||   |||||| |||  |||||||||||| || ||||||||||||
Sbjct: 290 ctggcttcctgcagcgccatgacggctgagctctggaagcggagatcagtcttgaagtcc 231

                                                                
Query: 338 tgcgcgatctcccggacgaggcgctgaaaggggagcttgcggatgagcagctc 390
           || |||||||| || || | |||||| ||||| ||||||||||||||||||||
Sbjct: 230 tgggcgatctcacgcaccaagcgctggaagggcagcttgcggatgagcagctc 178



to top

>ref|XM_318362.1| Anopheles gambiae str. PEST ENSANGP00000016005
           (ENSANGG00000013516), partial mRNA
          Length = 411

 Score =  200 bits (101), Expect = 3e-48
 Identities = 200/233 (85%)
 Strand = Plus / Minus

                                                                       
Query: 158 taggcgcgctccccgcggatgcggcgggcgagctggatgtccttgggcatgattgtgacg 217
           ||||| ||||| ||||||||||| ||||| ||||||||||||||||||||||| ||||||
Sbjct: 410 taggcacgctctccgcggatgcgacgggccagctggatgtccttgggcatgatggtgacg 351

                                                                       
Query: 218 cgcttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtacgcctcg 277
           |||||||||||||||||||| || || ||||| ||||| || || || || |||||||||
Sbjct: 350 cgcttggcgtggatggcgcacagattcgtgtcttcgaacagaccaaccagatacgcctcg 291

                                                                       
Query: 278 gcggcctcctggagcgcggagacggcggaggactggaagcggaggtcggtcttgaagtcc 337
             ||| ||||| |||||   |||||| |||  |||||||||||| || ||||||||||||
Sbjct: 290 ctggcttcctgcagcgccatgacggctgagctctggaagcggagatcagtcttgaagtcc 231

                                                                
Query: 338 tgcgcgatctcccggacgaggcgctgaaaggggagcttgcggatgagcagctc 390
           || |||||||| || || | |||||| ||||| ||||||||||||||||||||
Sbjct: 230 tgggcgatctcacgcaccaagcgctggaagggcagcttgcggatgagcagctc 178



to top

>ref|XM_307081.1| Anopheles gambiae str. PEST ENSANGP00000001387
           (ENSANGG00000001186), partial mRNA
          Length = 408

 Score =  200 bits (101), Expect = 3e-48
 Identities = 200/233 (85%)
 Strand = Plus / Minus

                                                                       
Query: 158 taggcgcgctccccgcggatgcggcgggcgagctggatgtccttgggcatgattgtgacg 217
           ||||| ||||| ||||||||||| ||||| ||||||||||||||||||||||| ||||||
Sbjct: 407 taggcacgctctccgcggatgcgacgggccagctggatgtccttgggcatgatggtgacg 348

                                                                       
Query: 218 cgcttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtacgcctcg 277
           |||||||||||||||||||| || || ||||| ||||| || || || || |||||||||
Sbjct: 347 cgcttggcgtggatggcgcacagattcgtgtcttcgaacagaccaaccagatacgcctcg 288

                                                                       
Query: 278 gcggcctcctggagcgcggagacggcggaggactggaagcggaggtcggtcttgaagtcc 337
             ||| ||||| |||||   |||||| |||  |||||||||||| || ||||||||||||
Sbjct: 287 ctggcttcctgcagcgccatgacggctgagctctggaagcggagatcagtcttgaagtcc 228

                                                                
Query: 338 tgcgcgatctcccggacgaggcgctgaaaggggagcttgcggatgagcagctc 390
           || |||||||| || || | |||||| ||||| ||||||||||||||||||||
Sbjct: 227 tgggcgatctcacgcaccaagcgctggaagggcagcttgcggatgagcagctc 175



to top

>ref|XM_305996.1| Anopheles gambiae str. PEST ENSANGP00000012784
           (ENSANGG00000010295), partial mRNA
          Length = 411

 Score =  200 bits (101), Expect = 3e-48
 Identities = 200/233 (85%)
 Strand = Plus / Minus

                                                                       
Query: 158 taggcgcgctccccgcggatgcggcgggcgagctggatgtccttgggcatgattgtgacg 217
           ||||| ||||| ||||||||||| ||||| ||||||||||||||||||||||| ||||||
Sbjct: 410 taggcacgctctccgcggatgcgacgggccagctggatgtccttgggcatgatggtgacg 351

                                                                       
Query: 218 cgcttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtacgcctcg 277
           |||||||||||||||||||| || || ||||| ||||| || || || || |||||||||
Sbjct: 350 cgcttggcgtggatggcgcacagattcgtgtcttcgaacagaccaaccagatacgcctcg 291

                                                                       
Query: 278 gcggcctcctggagcgcggagacggcggaggactggaagcggaggtcggtcttgaagtcc 337
             ||| ||||| |||||   |||||| |||  |||||||||||| || ||||||||||||
Sbjct: 290 ctggcttcctgcagcgccatgacggctgagctctggaagcggagatcagtcttgaagtcc 231

                                                                
Query: 338 tgcgcgatctcccggacgaggcgctgaaaggggagcttgcggatgagcagctc 390
           || |||||||| || || | |||||| ||||| ||||||||||||||||||||
Sbjct: 230 tgggcgatctcacgcaccaagcgctggaagggcagcttgcggatgagcagctc 178



to top

>gb|AY662905.1| Paretroplus sp. 'Kamoro' histone H3a gene, partial cds
          Length = 333

 Score =  200 bits (101), Expect = 3e-48
 Identities = 152/171 (88%)
 Strand = Plus / Minus

                                                                       
Query: 220 cttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtacgcctcggc 279
           |||||||||||||||||| ||||||||||||||||| |||||||| ||||| ||||||  
Sbjct: 329 cttggcgtggatggcgcasaggttggtgtcctcgaasagcccgaccaggtaagcctcgct 270

                                                                       
Query: 280 ggcctcctggagcgcggagacggcggaggactggaagcggaggtcggtcttgaagtcctg 339
           ||||||||| || ||   ||||||||||  ||||||||| ||||||||||||||||||||
Sbjct: 269 ggcctcctgcagagccatgacggcggagctctggaagcgcaggtcggtcttgaagtcctg 210

                                                              
Query: 340 cgcgatctcccggacgaggcgctgaaaggggagcttgcggatgagcagctc 390
            |||||||| ||||| |||||||| ||||| ||||||||||||||||||||
Sbjct: 209 agcgatctcscggaccaggcgctggaagggcagcttgcggatgagcagctc 159



to top

>ref|NM_178207.2| Mus musculus histone 1, H3i (Hist1h3i), mRNA
          Length = 483

 Score =  200 bits (101), Expect = 3e-48
 Identities = 194/225 (86%)
 Strand = Plus / Minus

                                                                       
Query: 166 ctccccgcggatgcggcgggcgagctggatgtccttgggcatgattgtgacgcgcttggc 225
           ||||||||| ||||| ||||| ||||||||||||||||||||||| ||||| ||||||||
Sbjct: 429 ctccccgcgaatgcgacgggccagctggatgtccttgggcatgatggtgacacgcttggc 370

                                                                       
Query: 226 gtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtacgcctcggcggcctc 285
           |||||||||||| |||||||||||||| || || || |||||||| |||||   ||||||
Sbjct: 369 gtggatggcgcacaggttggtgtcctcaaacagacccacgaggtaggcctcacaggcctc 310

                                                                       
Query: 286 ctggagcgcggagacggcggaggactggaagcggaggtcggtcttgaagtcctgcgcgat 345
           ||| || ||   ||| || |||  ||||||||| ||||||||||||||||||||||||||
Sbjct: 309 ctgcagagccatgacagccgagctctggaagcgcaggtcggtcttgaagtcctgcgcgat 250

                                                        
Query: 346 ctcccggacgaggcgctgaaaggggagcttgcggatgagcagctc 390
           ||| || || |||||||| || || ||||||||||| ||||||||
Sbjct: 249 ctcgcgcaccaggcgctggaacggcagcttgcggatcagcagctc 205



to top

>gb|AY749729.1| Edmundsius agilis histone H3 (H3) gene, partial cds
          Length = 377

 Score =  200 bits (101), Expect = 3e-48
 Identities = 182/209 (87%)
 Strand = Plus / Minus

                                                                       
Query: 197 tccttgggcatgattgtgacgcgcttggcgtggatggcgcagaggttggtgtcctcgaag 256
           |||||||||||||| |||||||||||||||||||||||||| || |||||||||||||||
Sbjct: 371 tccttgggcatgatggtgacgcgcttggcgtggatggcgcacagattggtgtcctcgaag 312

                                                                       
Query: 257 agcccgacgaggtacgcctcggcggcctcctggagcgcggagacggcggaggactggaag 316
           || ||||| | ||| ||||||  |||||||||||| ||   |||||| |||  |||||||
Sbjct: 311 agaccgaccaagtaagcctcgctggcctcctggagtgccatgacggcagagctctggaag 252

                                                                       
Query: 317 cggaggtcggtcttgaagtcctgcgcgatctcccggacgaggcgctgaaaggggagcttg 376
           || || ||||||||||||||||| || ||||| || ||||||||||| || || ||||||
Sbjct: 251 cgcagatcggtcttgaagtcctgggcaatctcacgcacgaggcgctggaaaggcagcttg 192

                                        
Query: 377 cggatgagcagctccgtgctcttctggta 405
           ||||| |||||||| ||||||||||||||
Sbjct: 191 cggatcagcagctcagtgctcttctggta 163



to top

>gb|AY749723.1| Siphlaenigma janae histone H3 (H3) gene, partial cds
          Length = 377

 Score =  200 bits (101), Expect = 3e-48
 Identities = 182/209 (87%)
 Strand = Plus / Minus

                                                                       
Query: 197 tccttgggcatgattgtgacgcgcttggcgtggatggcgcagaggttggtgtcctcgaag 256
           |||||||||||||| |||||||||||||||||||| ||||| ||||||||||||||||| 
Sbjct: 371 tccttgggcatgatggtgacgcgcttggcgtggatcgcgcacaggttggtgtcctcgaac 312

                                                                       
Query: 257 agcccgacgaggtacgcctcggcggcctcctggagcgcggagacggcggaggactggaag 316
           || || || ||||| ||||||  ||||||||| || ||   ||||||||||  |||||||
Sbjct: 311 agacccaccaggtaagcctcgctggcctcctgcagagccatgacggcggagctctggaag 252

                                                                       
Query: 317 cggaggtcggtcttgaagtcctgcgcgatctcccggacgaggcgctgaaaggggagcttg 376
           || |||||||||||||||||||| |||||||| || || || ||||| ||||| ||||||
Sbjct: 251 cgcaggtcggtcttgaagtcctgggcgatctcacgcaccagacgctggaagggcagcttg 192

                                        
Query: 377 cggatgagcagctccgtgctcttctggta 405
           |||||||| ||||| ||||||||||||||
Sbjct: 191 cggatgaggagctcagtgctcttctggta 163



to top

>gb|AY749718.1| Siphlonurus sp. EP084 histone H3 (H3) gene, partial cds
          Length = 357

 Score =  200 bits (101), Expect = 3e-48
 Identities = 182/209 (87%)
 Strand = Plus / Minus

                                                                       
Query: 197 tccttgggcatgattgtgacgcgcttggcgtggatggcgcagaggttggtgtcctcgaag 256
           |||||||||||||| ||||| |||||||||||||||||||| ||||||||||||||||||
Sbjct: 354 tccttgggcatgatggtgacacgcttggcgtggatggcgcacaggttggtgtcctcgaag 295

                                                                       
Query: 257 agcccgacgaggtacgcctcggcggcctcctggagcgcggagacggcggaggactggaag 316
           || ||||| ||||| ||||||   |||||||| || ||   |||||| |||  |||||||
Sbjct: 294 agaccgaccaggtaagcctcgcttgcctcctgcagtgccatgacggcagagctctggaag 235

                                                                       
Query: 317 cggaggtcggtcttgaagtcctgcgcgatctcccggacgaggcgctgaaaggggagcttg 376
           ||||| ||||||||||||||||| || ||||| || ||||||||||| ||||| ||||||
Sbjct: 234 cggagatcggtcttgaagtcctgagcaatctcacgcacgaggcgctggaagggcagcttg 175

                                        
Query: 377 cggatgagcagctccgtgctcttctggta 405
           ||||| |||||||| || |||||||||||
Sbjct: 174 cggatcagcagctcggtactcttctggta 146



to top

>gb|AY870292.1| Pantala flavescens histone H3 gene, partial cds
          Length = 328

 Score =  198 bits (100), Expect = 1e-47
 Identities = 166/188 (88%)
 Strand = Plus / Minus

                                                                       
Query: 218 cgcttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtacgcctcg 277
           |||||||||||||||||||| |||||||||||||| ||||| |||||||| || ||||||
Sbjct: 327 cgcttggcgtggatggcgcaaaggttggtgtcctcaaagagaccgacgagataagcctcg 268

                                                                       
Query: 278 gcggcctcctggagcgcggagacggcggaggactggaagcggaggtcggtcttgaagtcc 337
             |||||||||||| ||    |||||||||  |||||| ||||| |||||||| ||||||
Sbjct: 267 ctggcctcctggagggccataacggcggagctctggaaacggagatcggtcttaaagtcc 208

                                                                       
Query: 338 tgcgcgatctcccggacgaggcgctgaaaggggagcttgcggatgagcagctccgtgctc 397
           || |||||||| |||||||||||||| |||||||||||||||||||| ||||| ||||||
Sbjct: 207 tgagcgatctcacggacgaggcgctggaaggggagcttgcggatgagaagctcagtgctc 148

                   
Query: 398 ttctggta 405
           ||||||||
Sbjct: 147 ttctggta 140



to top

>gb|AY338638.1| Hetaerina americana histone 3 gene, partial cds
          Length = 345

 Score =  198 bits (100), Expect = 1e-47
 Identities = 178/204 (87%)
 Strand = Plus / Minus

                                                                       
Query: 202 gggcatgattgtgacgcgcttggcgtggatggcgcagaggttggtgtcctcgaagagccc 261
           ||||||||| ||||| ||||| ||||||||||||||||||||||||||||| ||||| ||
Sbjct: 345 gggcatgatggtgacacgcttagcgtggatggcgcagaggttggtgtcctcaaagagacc 286

                                                                       
Query: 262 gacgaggtacgcctcggcggcctcctggagcgcggagacggcggaggactggaagcggag 321
            || ||||| ||||||  |||||||||||| ||   ||||||||||  |||||| || ||
Sbjct: 285 cactaggtaagcctcgctggcctcctggagagccatgacggcggagctctggaaccgaag 226

                                                                       
Query: 322 gtcggtcttgaagtcctgcgcgatctcccggacgaggcgctgaaaggggagcttgcggat 381
            ||||||||||||||||| |||||||| || || |||||||| ||||| |||||||||||
Sbjct: 225 atcggtcttgaagtcctgggcgatctcacgcaccaggcgctggaagggcagcttgcggat 166

                                   
Query: 382 gagcagctccgtgctcttctggta 405
           ||| ||||||||||||||||||||
Sbjct: 165 gaggagctccgtgctcttctggta 142



to top

>gb|DQ284359.1| Rana maosonensis histone H3a gene, partial cds
          Length = 328

 Score =  196 bits (99), Expect = 4e-47
 Identities = 153/171 (89%)
 Strand = Plus / Minus

                                                                       
Query: 220 cttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtacgcctcggc 279
           ||||||||||||||||||||||||||||||||||||||| |||||||| || ||||||| 
Sbjct: 325 cttggcgtggatggcgcagaggttggtgtcctcgaagagtccgacgagataagcctcgga 266

                                                                       
Query: 280 ggcctcctggagcgcggagacggcggaggactggaagcggaggtcggtcttgaagtcctg 339
           ||||||||| || ||   ||| ||||||  ||||||||| ||||||||||||||||||||
Sbjct: 265 ggcctcctgcagagccatgacagcggagctctggaagcgcaggtcggtcttgaagtcctg 206

                                                              
Query: 340 cgcgatctcccggacgaggcgctgaaaggggagcttgcggatgagcagctc 390
            |||||||| |||||||||||||| ||||| ||||||||||| ||||||||
Sbjct: 205 ggcgatctcgcggacgaggcgctggaagggcagcttgcggataagcagctc 155



to top

>gb|DQ284354.1| Amnirana albilabris histone H3a gene, partial cds
          Length = 328

 Score =  196 bits (99), Expect = 4e-47
 Identities = 153/171 (89%)
 Strand = Plus / Minus

                                                                       
Query: 220 cttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtacgcctcggc 279
           ||||||||||||||||||||||||||||||||||||||| || ||||| || ||||| | 
Sbjct: 325 cttggcgtggatggcgcagaggttggtgtcctcgaagagtcctacgagataagcctcaga 266

                                                                       
Query: 280 ggcctcctggagcgcggagacggcggaggactggaagcggaggtcggtcttgaagtcctg 339
           ||||||||| || ||   ||||||||||  ||||||||| ||||||||||||||||||||
Sbjct: 265 ggcctcctgcagagccatgacggcggagctctggaagcgcaggtcggtcttgaagtcctg 206

                                                              
Query: 340 cgcgatctcccggacgaggcgctgaaaggggagcttgcggatgagcagctc 390
            |||||||| |||||||||||||| ||||| ||||||||||||||||||||
Sbjct: 205 ggcgatctctcggacgaggcgctggaagggcagcttgcggatgagcagctc 155



to top

>gb|DQ284187.1| Meristogenys orphnocnemis histone H3a gene, partial cds
          Length = 328

 Score =  196 bits (99), Expect = 4e-47
 Identities = 153/171 (89%)
 Strand = Plus / Minus

                                                                       
Query: 220 cttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtacgcctcggc 279
           ||||||||||||||||||||||||||||||||||||||| || ||||| || ||||| | 
Sbjct: 325 cttggcgtggatggcgcagaggttggtgtcctcgaagagtcctacgagataagcctctga 266

                                                                       
Query: 280 ggcctcctggagcgcggagacggcggaggactggaagcggaggtcggtcttgaagtcctg 339
           ||||||||| || ||   ||||||||||  ||||||||| ||||||||||||||||||||
Sbjct: 265 ggcctcctgcagagccatgacggcggagctctggaagcgcaggtcggtcttgaagtcctg 206

                                                              
Query: 340 cgcgatctcccggacgaggcgctgaaaggggagcttgcggatgagcagctc 390
            |||||||| |||||||||||||| ||||| ||||||||||||||||||||
Sbjct: 205 ggcgatctctcggacgaggcgctggaagggcagcttgcggatgagcagctc 155



to top

>gb|DQ284178.1| Rana nigromaculata histone H3a gene, partial cds
          Length = 328

 Score =  196 bits (99), Expect = 4e-47
 Identities = 153/171 (89%)
 Strand = Plus / Minus

                                                                       
Query: 220 cttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtacgcctcggc 279
           ||||||||| ||||||||||||||||||||||||||||| |||||||| || ||||| | 
Sbjct: 325 cttggcgtgtatggcgcagaggttggtgtcctcgaagagtccgacgagataagcctctga 266

                                                                       
Query: 280 ggcctcctggagcgcggagacggcggaggactggaagcggaggtcggtcttgaagtcctg 339
           ||||||||| || ||   ||||||||||  ||||||||| ||||||||||||||||||||
Sbjct: 265 ggcctcctgcagagccatgacggcggagctctggaagcgcaggtcggtcttgaagtcctg 206

                                                              
Query: 340 cgcgatctcccggacgaggcgctgaaaggggagcttgcggatgagcagctc 390
            |||||||| |||||||||||||| ||||| ||||||||||||||||||||
Sbjct: 205 ggcgatctctcggacgaggcgctggaagggcagcttgcggatgagcagctc 155



to top

>gb|DQ284163.1| Rana adenopleura histone H3a gene, partial cds
          Length = 328

 Score =  196 bits (99), Expect = 4e-47
 Identities = 153/171 (89%)
 Strand = Plus / Minus

                                                                       
Query: 220 cttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtacgcctcggc 279
           ||||||||||||||||||||||||||||||||||||||| || ||||| || ||||||| 
Sbjct: 325 cttggcgtggatggcgcagaggttggtgtcctcgaagagtcctacgagataagcctcgga 266

                                                                       
Query: 280 ggcctcctggagcgcggagacggcggaggactggaagcggaggtcggtcttgaagtcctg 339
           ||||||||| || ||   ||||||||||  ||||||||| ||||||||||||||||||||
Sbjct: 265 ggcctcctgcagagccatgacggcggagctctggaagcgcaggtcggtcttgaagtcctg 206

                                                              
Query: 340 cgcgatctcccggacgaggcgctgaaaggggagcttgcggatgagcagctc 390
            |||||||| ||||| |||||||| ||||| ||||||||||||||||||||
Sbjct: 205 ggcgatctctcggacaaggcgctggaagggcagcttgcggatgagcagctc 155



to top

>gb|DQ275319.1| Graphoderus zonatus voucher BYU KBMGrzo66 histone 3 (H3) gene,
           partial cds
          Length = 376

 Score =  196 bits (99), Expect = 4e-47
 Identities = 181/209 (86%)
 Strand = Plus / Minus

                                                                       
Query: 197 tccttgggcatgattgtgacgcgcttggcgtggatggcgcagaggttggtgtcctcgaag 256
           |||||||||||||| |||||||||||||||||||| ||||| | ||||||||||||||| 
Sbjct: 372 tccttgggcatgatggtgacgcgcttggcgtggatsgcgcacaagttggtgtcctcgaaa 313

                                                                       
Query: 257 agcccgacgaggtacgcctcggcggcctcctggagcgcggagacggcggaggactggaag 316
           || ||||||||||| || |||  ||||||||| || ||   ||||||||||  |||||||
Sbjct: 312 agaccgacgaggtatgcttcgctggcctcctgcagagccatgacggcggagctctggaag 253

                                                                       
Query: 317 cggaggtcggtcttgaagtcctgcgcgatctcccggacgaggcgctgaaaggggagcttg 376
           || |||||||||||||| ||||| |||||||| || || |||||||| || || ||||||
Sbjct: 252 cgcaggtcggtcttgaaatcctgrgcgatctcgcgaaccaggcgctggaaaggcagcttg 193

                                        
Query: 377 cggatgagcagctccgtgctcttctggta 405
           ||||| || ||||||||||||||||||||
Sbjct: 192 cggatcagaagctccgtgctcttctggta 164



to top

>gb|AY662897.1| Paretroplus cf. kieneri 'Ravelobe' histone H3a gene, partial cds
          Length = 333

 Score =  196 bits (99), Expect = 4e-47
 Identities = 152/171 (88%)
 Strand = Plus / Minus

                                                                       
Query: 220 cttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtacgcctcggc 279
           |||||||||||||||||| ||||||||||||||||| |||||||| ||||| ||||||  
Sbjct: 329 cttggcgtggatggcgcasaggttggtgtcctcgaasagcccgaccaggtaagcctcgct 270

                                                                       
Query: 280 ggcctcctggagcgcggagacggcggaggactggaagcggaggtcggtcttgaagtcctg 339
           ||||||||| || ||   ||||||||||  ||||||||| ||||||||||||||||||||
Sbjct: 269 ggcctcctgcagagccatgacggcggagctctggaagcgcaggtcggtcttgaagtcctg 210

                                                              
Query: 340 cgcgatctcccggacgaggcgctgaaaggggagcttgcggatgagcagctc 390
            |||||||| ||||| |||||||| ||||| ||||||||||||||||||||
Sbjct: 209 agcgatctcgcggaccaggcgctggaagggcagcttgcggatgagcagctc 159



to top

>gb|AY662895.1| Paretroplus kieneri 'Kinkony' histone H3a gene, partial cds
          Length = 333

 Score =  196 bits (99), Expect = 4e-47
 Identities = 152/171 (88%)
 Strand = Plus / Minus

                                                                       
Query: 220 cttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtacgcctcggc 279
           |||||||||||||||||| ||||||||||||||||| |||||||| ||||| ||||||  
Sbjct: 329 cttggcgtggatggcgcasaggttggtgtcctcgaasagcccgaccaggtaagcctcgct 270

                                                                       
Query: 280 ggcctcctggagcgcggagacggcggaggactggaagcggaggtcggtcttgaagtcctg 339
           ||||||||| || ||   ||||||||||  ||||||||| ||||||||||||||||||||
Sbjct: 269 ggcctcctgcagagccatgacggcggagctctggaagcgcaggtcggtcttgaagtcctg 210

                                                              
Query: 340 cgcgatctcccggacgaggcgctgaaaggggagcttgcggatgagcagctc 390
            |||||||| ||||| |||||||| ||||| ||||||||||||||||||||
Sbjct: 209 agcgatctcgcggaccaggcgctggaagggcagcttgcggatgagcagctc 159



to top

>gb|AY662890.1| Etroplus canarensis histone H3a gene, partial cds
          Length = 333

 Score =  196 bits (99), Expect = 4e-47
 Identities = 153/171 (89%)
 Strand = Plus / Minus

                                                                       
Query: 220 cttggcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtacgcctcggc 279
           |||||||||||||||||| |||||||||||||||||||||||||| ||||| ||||||  
Sbjct: 329 cttggcgtggatggcgcacaggttggtgtcctcgaagagcccgaccaggtaagcctcgct 270

                                                                       
Query: 280 ggcctcctggagcgcggagacggcggaggactggaagcggaggtcggtcttgaagtcctg 339
           ||||||||| || ||   ||||||||||  ||||||||| ||||||||||||||||||||
Sbjct: 269 ggcctcctgcagagccatgacggcggagctctggaagcgcaggtcggtcttgaagtcctg 210

                                                              
Query: 340 cgcgatctcccggacgaggcgctgaaaggggagcttgcggatgagcagctc 390
            |||||||| |||||||||||||| ||||| ||||||||||| ||||||||
Sbjct: 209 agcgatctcacggacgaggcgctggaagggcagcttgcggatcagcagctc 159



to top

>emb|X01685.1|MMHISH32 Mouse gene (H3.2) for histone H3
          Length = 702

 Score =  196 bits (99), Expect = 4e-47
 Identities = 195/227 (85%)
 Strand = Plus / Minus

                                                                       
Query: 164 cgctccccgcggatgcggcgggcgagctggatgtccttgggcatgattgtgacgcgcttg 223
           ||||| |||||||| |||||||| ||||||||||||||||||||||| ||||| ||||||
Sbjct: 555 cgctcgccgcggatacggcgggccagctggatgtccttgggcatgatggtgacacgcttg 496

                                                                       
Query: 224 gcgtggatggcgcagaggttggtgtcctcgaagagcccgacgaggtacgcctcggcggcc 283
           |||||||||||||| |||||||||||||| || || || || ||||| ||||||   |||
Sbjct: 495 gcgtggatggcgcacaggttggtgtcctcaaacagacccacaaggtaggcctcgctcgcc 436

                                                                       
Query: 284 tcctggagcgcggagacggcggaggactggaagcggaggtcggtcttgaagtcctgcgcg 343
           ||||| || ||   |||||| |||  ||||||||| ||||||||||||||||||||||||
Sbjct: 435 tcctgcagagccatgacggccgagctctggaagcgcaggtcggtcttgaagtcctgcgcg 376

                                                          
Query: 344 atctcccggacgaggcgctgaaaggggagcttgcggatgagcagctc 390
           ||||| || || | |||||| || || ||||||||||| ||||||||
Sbjct: 375 atctcgcgcaccaagcgctggaacggcagcttgcggatcagcagctc 329



to top

>emb|X80326.1|MPMPH312 M.pahari mpH312 gene
          Length = 580

 Score =  194 bits (98), Expect = 2e-46
 Identities = 188/218 (86%)
 Strand = Plus / Minus

                                                                       
Query: 173 cggatgcggcgggcgagctggatgtccttgggcatgattgtgacgcgcttggcgtggatg 232
           |||||||||||||| ||||||||||||||||||||||| ||||| |||||||||||||||
Sbjct: 440 cggatgcggcgggccagctggatgtccttgggcatgatggtgacacgcttggcgtggatg 381

                                                                       
Query: 233 gcgcagaggttggtgtcctcgaagagcccgacgaggtacgcctcggcggcctcctggagc 292
           ||||| |||||||||||||| || || || || ||||| ||||||   |||||||| || 
Sbjct: 380 gcgcacaggttggtgtcctcaaacagacccacaaggtaggcctcgctcgcctcctgcaga 321

                                                                       
Query: 293 gcggagacggcggaggactggaagcggaggtcggtcttgaagtcctgcgcgatctcccgg 352
           ||   |||||| |||  ||||||||| ||||||||||||||||||||||||||||| || 
Sbjct: 320 gccatgacggccgagctctggaagcgcaggtcggtcttgaagtcctgcgcgatctcgcgc 261

                                                 
Query: 353 acgaggcgctgaaaggggagcttgcggatgagcagctc 390
           || || ||||| || || ||||||||||| ||||||||
Sbjct: 260 accagccgctggaacggcagcttgcggatcagcagctc 223


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 2,556,483
Number of Sequences: 3902068
Number of extensions: 2556483
Number of successful extensions: 62567
Number of sequences better than 10.0: 3646
Number of HSP's better than 10.0 without gapping: 3644
Number of HSP's successfully gapped in prelim test: 6
Number of HSP's that attempted gapping in prelim test: 54802
Number of HSP's gapped (non-prelim): 6739
length of query: 418
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 396
effective length of database: 17,147,199,772
effective search space: 6790291109712
effective search space used: 6790291109712
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top