>gb|AC107085.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone OJ1764_D01,
             complete sequence
          Length = 164709

 Score = 60.0 bits (30), Expect = 3e-06
 Identities = 57/66 (86%)
 Strand = Plus / Minus

                                                                         
Query: 139   gcatggttcagatgatagttccagcctctcaaaatgaccctgggcttggatccttcgggt 198
             ||||||| ||| ||||||||||||||| ||| ||||||||||||  ||||||| | ||| 
Sbjct: 42054 gcatggtccaggtgatagttccagcctttcagaatgaccctgggggtggatccctggggg 41995

                   
Query: 199   gcctcg 204
             ||||||
Sbjct: 41994 gcctcg 41989

>dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 5, complete
                sequence
          Length = 29737217

 Score = 60.0 bits (30), Expect = 3e-06
 Identities = 57/66 (86%)
 Strand = Plus / Minus

                                                                            
Query: 139      gcatggttcagatgatagttccagcctctcaaaatgaccctgggcttggatccttcgggt 198
                ||||||| ||| ||||||||||||||| ||| ||||||||||||  ||||||| | ||| 
Sbjct: 18874676 gcatggtccaggtgatagttccagcctttcagaatgaccctgggggtggatccctggggg 18874617

                      
Query: 199      gcctcg 204
                ||||||
Sbjct: 18874616 gcctcg 18874611

>dbj|AK119412.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-132-F10, full
            insert sequence
          Length = 3621

 Score = 60.0 bits (30), Expect = 3e-06
 Identities = 57/66 (86%)
 Strand = Plus / Minus

                                                                        
Query: 139  gcatggttcagatgatagttccagcctctcaaaatgaccctgggcttggatccttcgggt 198
            ||||||| ||| ||||||||||||||| ||| ||||||||||||  ||||||| | ||| 
Sbjct: 3072 gcatggtccaggtgatagttccagcctttcagaatgaccctgggggtggatccctggggg 3013

                  
Query: 199  gcctcg 204
            ||||||
Sbjct: 3012 gcctcg 3007

>gb|AC026179.5|AC026179 Homo sapiens chromosome 3 clone RP11-264H3 map 3p, complete sequence
          Length = 166488

 Score = 42.1 bits (21), Expect = 0.65
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 74     atgtacttactttacatggat 94
              |||||||||||||||||||||
Sbjct: 152625 atgtacttactttacatggat 152605

>gb|AC066584.6|AC066584 Homo sapiens chromosome 3 clone RP11-244G3 map 3p, complete sequence
          Length = 155825

 Score = 42.1 bits (21), Expect = 0.65
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 74    atgtacttactttacatggat 94
             |||||||||||||||||||||
Sbjct: 76775 atgtacttactttacatggat 76755

>gb|AC018493.6|AC018493 Homo sapiens chromosome 3 clone RP11-163M22 map 3p, complete sequence
          Length = 180299

 Score = 42.1 bits (21), Expect = 0.65
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 74     atgtacttactttacatggat 94
              |||||||||||||||||||||
Sbjct: 171146 atgtacttactttacatggat 171166

>gb|AC011327.17|AC011327 Homo sapiens 3 BAC RP11-77I5 (Roswell Park Cancer Institute Human BAC
              Library) complete sequence
          Length = 168812

 Score = 42.1 bits (21), Expect = 0.65
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 74     atgtacttactttacatggat 94
              |||||||||||||||||||||
Sbjct: 159653 atgtacttactttacatggat 159673

>emb|AL935264.12| Mouse DNA sequence from clone RP23-118A9 on chromosome 4, complete
             sequence
          Length = 230886

 Score = 42.1 bits (21), Expect = 0.65
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 58    ctgcactttattggggatgta 78
             |||||||||||||||||||||
Sbjct: 26959 ctgcactttattggggatgta 26939

>gb|AC023485.6| Homo sapiens chromosome 3 clone RP11-489D19 map 3p, complete sequence
          Length = 179304

 Score = 42.1 bits (21), Expect = 0.65
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 74     atgtacttactttacatggat 94
              |||||||||||||||||||||
Sbjct: 100248 atgtacttactttacatggat 100228

>gb|AY633104.1| Cicurina pallida haplotype TX365 cytochrome oxidase subunit I (COI)
           gene, partial cds; mitochondrial
          Length = 984

 Score = 40.1 bits (20), Expect = 2.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 81  tactttacatggatcttatt 100
           ||||||||||||||||||||
Sbjct: 678 tactttacatggatcttatt 697

>gb|AY633103.1| Cicurina pallida haplotype TX363 cytochrome oxidase subunit I (COI)
           gene, partial cds; mitochondrial
          Length = 966

 Score = 40.1 bits (20), Expect = 2.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 81  tactttacatggatcttatt 100
           ||||||||||||||||||||
Sbjct: 660 tactttacatggatcttatt 679

>gb|AC135239.3| Mus musculus BAC clone RP23-324D2 from chromosome 3, complete sequence
          Length = 190178

 Score = 40.1 bits (20), Expect = 2.6
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 60    gcactttattggggatgtacttac 83
             |||||| |||||||||||||||||
Sbjct: 91501 gcacttaattggggatgtacttac 91524

>gb|AC152414.7| Mus musculus BAC clone RP23-358O14 from chromosome 10, complete
           sequence
          Length = 230322

 Score = 40.1 bits (20), Expect = 2.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 153 atagttccagcctctcaaaa 172
           ||||||||||||||||||||
Sbjct: 532 atagttccagcctctcaaaa 551

>gb|AC163212.3| Mus musculus chromosome 3, clone RP24-102O2, complete sequence
          Length = 199319

 Score = 40.1 bits (20), Expect = 2.6
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 60    gcactttattggggatgtacttac 83
             |||||| |||||||||||||||||
Sbjct: 61943 gcacttaattggggatgtacttac 61966

>gb|AC152411.5| Mus musculus BAC clone RP24-87M19 from chromosome 10, complete sequence
          Length = 204973

 Score = 40.1 bits (20), Expect = 2.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 153   atagttccagcctctcaaaa 172
             ||||||||||||||||||||
Sbjct: 99907 atagttccagcctctcaaaa 99888

>gb|DQ174430.1| Diaea sp. JEG-696 cytochrome oxidase subunit I (COI) gene, partial
           cds; mitochondrial
          Length = 820

 Score = 40.1 bits (20), Expect = 2.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 81  tactttacatggatcttatt 100
           ||||||||||||||||||||
Sbjct: 774 tactttacatggatcttatt 793

>gb|DQ174429.1| Diaea sp. JEG-697 cytochrome oxidase subunit I (COI) gene, partial
           cds; mitochondrial
          Length = 820

 Score = 40.1 bits (20), Expect = 2.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 81  tactttacatggatcttatt 100
           ||||||||||||||||||||
Sbjct: 774 tactttacatggatcttatt 793

>gb|DQ174399.1| Diaea sp. JEG-692 cytochrome oxidase subunit I (COI) gene, partial
           cds; mitochondrial
          Length = 820

 Score = 40.1 bits (20), Expect = 2.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 81  tactttacatggatcttatt 100
           ||||||||||||||||||||
Sbjct: 774 tactttacatggatcttatt 793

>gb|DQ174374.1| Misumenops melloleitaio isolate 368 cytochrome oxidase subunit I
           (COI) gene, partial cds; mitochondrial
          Length = 820

 Score = 40.1 bits (20), Expect = 2.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 81  tactttacatggatcttatt 100
           ||||||||||||||||||||
Sbjct: 774 tactttacatggatcttatt 793

>gb|DQ174373.1| Misumenops melloleitaio isolate 484 cytochrome oxidase subunit I
           (COI) gene, partial cds; mitochondrial
          Length = 819

 Score = 40.1 bits (20), Expect = 2.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 81  tactttacatggatcttatt 100
           ||||||||||||||||||||
Sbjct: 773 tactttacatggatcttatt 792


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 1,597,955
Number of Sequences: 3902068
Number of extensions: 1597955
Number of successful extensions: 109329
Number of sequences better than 10.0: 20
Number of HSP's better than 10.0 without gapping: 20
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 109273
Number of HSP's gapped (non-prelim): 56
length of query: 204
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 182
effective length of database: 17,147,199,772
effective search space: 3120790358504
effective search space used: 3120790358504
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)