ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
menu 
| Clone Name | rbastl24c09 |
|---|---|
| Clone Library Name | barley_pub |
>dbj|BS000654.1| Pan troglodytes chromosome Y clone:PTB-129E12, complete sequences Length = 193714 Score = 52.0 bits (26), Expect = 2e-04 Identities = 26/26 (100%) Strand = Plus / Plus Query: 15 tccattcctttccattccattcaaag 40 |||||||||||||||||||||||||| Sbjct: 102038 tccattcctttccattccattcaaag 102063 Score = 50.1 bits (25), Expect = 8e-04 Identities = 25/25 (100%) Strand = Plus / Plus Query: 15 tccattcctttccattccattcaaa 39 ||||||||||||||||||||||||| Sbjct: 122719 tccattcctttccattccattcaaa 122743 Score = 48.1 bits (24), Expect = 0.003 Identities = 24/24 (100%) Strand = Plus / Plus Query: 15 tccattcctttccattccattcaa 38 |||||||||||||||||||||||| Sbjct: 97656 tccattcctttccattccattcaa 97679 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Plus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 166093 tccattcctttccattccattc 166114 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Plus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 164245 tccattcctttccattccattc 164266 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Plus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 148103 tccattcctttccattccattc 148124 Score = 44.1 bits (22), Expect = 0.050 Identities = 25/26 (96%) Strand = Plus / Plus Query: 15 tccattcctttccattccattcaaag 40 |||||||| ||||||||||||||||| Sbjct: 117100 tccattccattccattccattcaaag 117125 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Plus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 117010 tccattcctttccattccattc 117031 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Plus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 96945 tccattcctttccattccattc 96966 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Plus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 85217 tccattcctttccattccattc 85238 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Plus Query: 17 cattcctttccattccattcaa 38 |||||||||||||||||||||| Sbjct: 72396 cattcctttccattccattcaa 72417 Score = 42.1 bits (21), Expect = 0.20 Identities = 24/25 (96%) Strand = Plus / Plus Query: 15 tccattcctttccattccattcaaa 39 ||||||| ||||||||||||||||| Sbjct: 174791 tccattcgtttccattccattcaaa 174815 Score = 42.1 bits (21), Expect = 0.20 Identities = 21/21 (100%) Strand = Plus / Plus Query: 15 tccattcctttccattccatt 35 ||||||||||||||||||||| Sbjct: 174556 tccattcctttccattccatt 174576 Score = 42.1 bits (21), Expect = 0.20 Identities = 21/21 (100%) Strand = Plus / Plus Query: 17 cattcctttccattccattca 37 ||||||||||||||||||||| Sbjct: 168543 cattcctttccattccattca 168563 Score = 42.1 bits (21), Expect = 0.20 Identities = 21/21 (100%) Strand = Plus / Plus Query: 18 attcctttccattccattcaa 38 ||||||||||||||||||||| Sbjct: 161816 attcctttccattccattcaa 161836 Score = 42.1 bits (21), Expect = 0.20 Identities = 21/21 (100%) Strand = Plus / Plus Query: 15 tccattcctttccattccatt 35 ||||||||||||||||||||| Sbjct: 160823 tccattcctttccattccatt 160843 Score = 42.1 bits (21), Expect = 0.20 Identities = 24/25 (96%) Strand = Plus / Plus Query: 15 tccattcctttccattccattcaaa 39 |||||||| |||||||||||||||| Sbjct: 146129 tccattccattccattccattcaaa 146153 Score = 42.1 bits (21), Expect = 0.20 Identities = 21/21 (100%) Strand = Plus / Plus Query: 15 tccattcctttccattccatt 35 ||||||||||||||||||||| Sbjct: 114651 tccattcctttccattccatt 114671 Score = 42.1 bits (21), Expect = 0.20 Identities = 21/21 (100%) Strand = Plus / Plus Query: 15 tccattcctttccattccatt 35 ||||||||||||||||||||| Sbjct: 114541 tccattcctttccattccatt 114561 Score = 42.1 bits (21), Expect = 0.20 Identities = 21/21 (100%) Strand = Plus / Plus Query: 15 tccattcctttccattccatt 35 ||||||||||||||||||||| Sbjct: 76386 tccattcctttccattccatt 76406 Score = 42.1 bits (21), Expect = 0.20 Identities = 21/21 (100%) Strand = Plus / Plus Query: 15 tccattcctttccattccatt 35 ||||||||||||||||||||| Sbjct: 76341 tccattcctttccattccatt 76361 Score = 40.1 bits (20), Expect = 0.78 Identities = 23/24 (95%) Strand = Plus / Plus Query: 15 tccattcctttccattccattcaa 38 ||||||||| |||||||||||||| Sbjct: 181234 tccattcctgtccattccattcaa 181257 Score = 40.1 bits (20), Expect = 0.78 Identities = 23/24 (95%) Strand = Plus / Plus Query: 15 tccattcctttccattccattcaa 38 ||||||| |||||||||||||||| Sbjct: 179695 tccattcatttccattccattcaa 179718 Score = 40.1 bits (20), Expect = 0.78 Identities = 23/24 (95%) Strand = Plus / Plus Query: 15 tccattcctttccattccattcaa 38 |||||||| ||||||||||||||| Sbjct: 175921 tccattccattccattccattcaa 175944 Score = 40.1 bits (20), Expect = 0.78 Identities = 23/24 (95%) Strand = Plus / Plus Query: 13 gatccattcctttccattccattc 36 |||||||||| ||||||||||||| Sbjct: 172580 gatccattccattccattccattc 172603 Score = 40.1 bits (20), Expect = 0.78 Identities = 23/24 (95%) Strand = Plus / Plus Query: 15 tccattcctttccattccattcaa 38 |||||||| ||||||||||||||| Sbjct: 155662 tccattccattccattccattcaa 155685 Score = 40.1 bits (20), Expect = 0.78 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tccattcctttccattccat 34 |||||||||||||||||||| Sbjct: 153964 tccattcctttccattccat 153983 Score = 40.1 bits (20), Expect = 0.78 Identities = 20/20 (100%) Strand = Plus / Plus Query: 17 cattcctttccattccattc 36 |||||||||||||||||||| Sbjct: 143266 cattcctttccattccattc 143285 Score = 40.1 bits (20), Expect = 0.78 Identities = 23/24 (95%) Strand = Plus / Plus Query: 15 tccattcctttccattccattcaa 38 |||||||| ||||||||||||||| Sbjct: 142745 tccattccattccattccattcaa 142768 Score = 40.1 bits (20), Expect = 0.78 Identities = 23/24 (95%) Strand = Plus / Plus Query: 15 tccattcctttccattccattcaa 38 |||||||| ||||||||||||||| Sbjct: 138520 tccattccattccattccattcaa 138543 Score = 40.1 bits (20), Expect = 0.78 Identities = 23/24 (95%) Strand = Plus / Plus Query: 15 tccattcctttccattccattcaa 38 ||||||| |||||||||||||||| Sbjct: 136676 tccattcatttccattccattcaa 136699 Score = 40.1 bits (20), Expect = 0.78 Identities = 20/20 (100%) Strand = Plus / Plus Query: 17 cattcctttccattccattc 36 |||||||||||||||||||| Sbjct: 136563 cattcctttccattccattc 136582 Score = 40.1 bits (20), Expect = 0.78 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tccattcctttccattccat 34 |||||||||||||||||||| Sbjct: 126864 tccattcctttccattccat 126883 Score = 40.1 bits (20), Expect = 0.78 Identities = 23/24 (95%) Strand = Plus / Plus Query: 15 tccattcctttccattccattcaa 38 ||||||||||| |||||||||||| Sbjct: 115641 tccattccttttcattccattcaa 115664 Score = 40.1 bits (20), Expect = 0.78 Identities = 23/24 (95%) Strand = Plus / Plus Query: 15 tccattcctttccattccattcaa 38 |||||||| ||||||||||||||| Sbjct: 110422 tccattccattccattccattcaa 110445 Score = 40.1 bits (20), Expect = 0.78 Identities = 23/24 (95%) Strand = Plus / Plus Query: 15 tccattcctttccattccattcaa 38 |||||||| ||||||||||||||| Sbjct: 106042 tccattccattccattccattcaa 106065 Score = 40.1 bits (20), Expect = 0.78 Identities = 23/24 (95%) Strand = Plus / Plus Query: 15 tccattcctttccattccattcaa 38 |||||||| ||||||||||||||| Sbjct: 91368 tccattccattccattccattcaa 91391 Score = 40.1 bits (20), Expect = 0.78 Identities = 23/24 (95%) Strand = Plus / Plus Query: 15 tccattcctttccattccattcaa 38 ||||||| |||||||||||||||| Sbjct: 86807 tccattcatttccattccattcaa 86830 Score = 40.1 bits (20), Expect = 0.78 Identities = 23/24 (95%) Strand = Plus / Plus Query: 12 cgatccattcctttccattccatt 35 ||||||||||| |||||||||||| Sbjct: 85399 cgatccattccattccattccatt 85422 Score = 40.1 bits (20), Expect = 0.78 Identities = 23/24 (95%) Strand = Plus / Plus Query: 15 tccattcctttccattccattcaa 38 |||||||||| ||||||||||||| Sbjct: 85232 tccattccttcccattccattcaa 85255 Score = 40.1 bits (20), Expect = 0.78 Identities = 23/24 (95%) Strand = Plus / Plus Query: 15 tccattcctttccattccattcaa 38 |||||||| ||||||||||||||| Sbjct: 82618 tccattccattccattccattcaa 82641 Score = 40.1 bits (20), Expect = 0.78 Identities = 20/20 (100%) Strand = Plus / Plus Query: 19 ttcctttccattccattcaa 38 |||||||||||||||||||| Sbjct: 80391 ttcctttccattccattcaa 80410 Score = 40.1 bits (20), Expect = 0.78 Identities = 23/24 (95%) Strand = Plus / Plus Query: 15 tccattcctttccattccattcaa 38 ||||||||||| |||||||||||| Sbjct: 79613 tccattcctttgcattccattcaa 79636 Score = 40.1 bits (20), Expect = 0.78 Identities = 23/24 (95%) Strand = Plus / Plus Query: 15 tccattcctttccattccattcaa 38 |||||||| ||||||||||||||| Sbjct: 79358 tccattcccttccattccattcaa 79381 Score = 40.1 bits (20), Expect = 0.78 Identities = 23/24 (95%) Strand = Plus / Plus Query: 15 tccattcctttccattccattcaa 38 |||||||| ||||||||||||||| Sbjct: 78599 tccattccattccattccattcaa 78622 Score = 40.1 bits (20), Expect = 0.78 Identities = 23/24 (95%) Strand = Plus / Plus Query: 15 tccattcctttccattccattcaa 38 |||||| ||||||||||||||||| Sbjct: 71091 tccatttctttccattccattcaa 71114 Score = 40.1 bits (20), Expect = 0.78 Identities = 23/24 (95%) Strand = Plus / Plus Query: 15 tccattcctttccattccattcaa 38 |||||||| ||||||||||||||| Sbjct: 70365 tccattccattccattccattcaa 70388 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Plus Query: 18 attcctttccattccattc 36 ||||||||||||||||||| Sbjct: 181132 attcctttccattccattc 181150 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Plus Query: 15 tccattcctttccattccattca 37 |||||||| |||||||||||||| Sbjct: 178680 tccattccattccattccattca 178702 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Plus Query: 17 cattcctttccattccatt 35 ||||||||||||||||||| Sbjct: 176942 cattcctttccattccatt 176960 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Plus Query: 17 cattcctttccattccatt 35 ||||||||||||||||||| Sbjct: 175699 cattcctttccattccatt 175717 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Plus Query: 15 tccattcctttccattccattca 37 |||||||| |||||||||||||| Sbjct: 169541 tccattcccttccattccattca 169563 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Plus Query: 18 attcctttccattccattc 36 ||||||||||||||||||| Sbjct: 169529 attcctttccattccattc 169547 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Plus Query: 18 attcctttccattccattc 36 ||||||||||||||||||| Sbjct: 169309 attcctttccattccattc 169327 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Plus Query: 18 attcctttccattccattc 36 ||||||||||||||||||| Sbjct: 167111 attcctttccattccattc 167129 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Plus Query: 19 ttcctttccattccattca 37 ||||||||||||||||||| Sbjct: 166372 ttcctttccattccattca 166390 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Plus Query: 18 attcctttccattccattc 36 ||||||||||||||||||| Sbjct: 165292 attcctttccattccattc 165310 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Plus Query: 18 attcctttccattccattc 36 ||||||||||||||||||| Sbjct: 164208 attcctttccattccattc 164226 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Plus Query: 18 attcctttccattccattc 36 ||||||||||||||||||| Sbjct: 158412 attcctttccattccattc 158430 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Plus Query: 18 attcctttccattccattc 36 ||||||||||||||||||| Sbjct: 157937 attcctttccattccattc 157955 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Plus Query: 15 tccattcctttccattccattca 37 |||||||| |||||||||||||| Sbjct: 143729 tccattccattccattccattca 143751 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Plus Query: 15 tccattcctttccattccattca 37 |||||||| |||||||||||||| Sbjct: 142236 tccattccattccattccattca 142258 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Plus Query: 18 attcctttccattccattc 36 ||||||||||||||||||| Sbjct: 140897 attcctttccattccattc 140915 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Plus Query: 18 attcctttccattccattc 36 ||||||||||||||||||| Sbjct: 138198 attcctttccattccattc 138216 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Plus Query: 18 attcctttccattccattc 36 ||||||||||||||||||| Sbjct: 135620 attcctttccattccattc 135638 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Plus Query: 18 attcctttccattccattc 36 ||||||||||||||||||| Sbjct: 135245 attcctttccattccattc 135263 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Plus Query: 14 atccattcctttccattccattc 36 ||||||||| ||||||||||||| Sbjct: 126788 atccattccattccattccattc 126810 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Plus Query: 15 tccattcctttccattccattca 37 |||||||| |||||||||||||| Sbjct: 124730 tccattccattccattccattca 124752 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Plus Query: 15 tccattcctttccattccattca 37 |||||||| |||||||||||||| Sbjct: 122329 tccattccattccattccattca 122351 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Plus Query: 14 atccattcctttccattccattc 36 ||||||||| ||||||||||||| Sbjct: 121009 atccattccattccattccattc 121031 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Plus Query: 18 attcctttccattccattc 36 ||||||||||||||||||| Sbjct: 117198 attcctttccattccattc 117216 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Plus Query: 18 attcctttccattccattc 36 ||||||||||||||||||| Sbjct: 114189 attcctttccattccattc 114207 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Plus Query: 14 atccattcctttccattccattc 36 |||||||||||| |||||||||| Sbjct: 114030 atccattcctttacattccattc 114052 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Plus Query: 18 attcctttccattccattc 36 ||||||||||||||||||| Sbjct: 111496 attcctttccattccattc 111514 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Plus Query: 15 tccattcctttccattcca 33 ||||||||||||||||||| Sbjct: 108785 tccattcctttccattcca 108803 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Plus Query: 18 attcctttccattccattc 36 ||||||||||||||||||| Sbjct: 108668 attcctttccattccattc 108686 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Plus Query: 18 attcctttccattccattc 36 ||||||||||||||||||| Sbjct: 105430 attcctttccattccattc 105448 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Plus Query: 18 attcctttccattccattc 36 ||||||||||||||||||| Sbjct: 104596 attcctttccattccattc 104614 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Plus Query: 15 tccattcctttccattccattca 37 |||||||| |||||||||||||| Sbjct: 102968 tccattccattccattccattca 102990 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Plus Query: 14 atccattcctttccattccattc 36 ||||||||| ||||||||||||| Sbjct: 102917 atccattccattccattccattc 102939 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Plus Query: 18 attcctttccattccattc 36 ||||||||||||||||||| Sbjct: 102416 attcctttccattccattc 102434 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Plus Query: 18 attcctttccattccattc 36 ||||||||||||||||||| Sbjct: 97753 attcctttccattccattc 97771 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Plus Query: 18 attcctttccattccattc 36 ||||||||||||||||||| Sbjct: 97529 attcctttccattccattc 97547 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Plus Query: 18 attcctttccattccattc 36 ||||||||||||||||||| Sbjct: 95565 attcctttccattccattc 95583 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Plus Query: 15 tccattcctttccattccattca 37 |||||||| |||||||||||||| Sbjct: 94757 tccattccattccattccattca 94779 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Plus Query: 14 atccattcctttccattccattc 36 ||||||||| ||||||||||||| Sbjct: 93774 atccattccattccattccattc 93796 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Plus Query: 14 atccattcctttccattccattc 36 ||||||||| ||||||||||||| Sbjct: 87783 atccattccattccattccattc 87805 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Plus Query: 15 tccattcctttccattccattca 37 |||||||| |||||||||||||| Sbjct: 86792 tccattccattccattccattca 86814 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Plus Query: 14 atccattcctttccattccattc 36 ||||||||||| ||||||||||| Sbjct: 83501 atccattccttcccattccattc 83523 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Plus Query: 18 attcctttccattccattc 36 ||||||||||||||||||| Sbjct: 82606 attcctttccattccattc 82624 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Plus Query: 14 atccattcctttccattccattc 36 ||||||||| ||||||||||||| Sbjct: 82437 atccattccattccattccattc 82459 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Plus Query: 18 attcctttccattccattc 36 ||||||||||||||||||| Sbjct: 80255 attcctttccattccattc 80273 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Plus Query: 14 atccattcctttccattccattc 36 ||||||||| ||||||||||||| Sbjct: 75116 atccattccattccattccattc 75138 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Plus Query: 18 attcctttccattccattc 36 ||||||||||||||||||| Sbjct: 74585 attcctttccattccattc 74603 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Plus Query: 14 atccattcctttccattccattc 36 ||||||||| ||||||||||||| Sbjct: 73477 atccattccattccattccattc 73499 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Plus Query: 15 tccattcctttccattcca 33 ||||||||||||||||||| Sbjct: 71231 tccattcctttccattcca 71249
>gb|DP000054.1| Pan troglodytes chromosome Y, partial sequence Length = 23952694 Score = 52.0 bits (26), Expect = 2e-04 Identities = 26/26 (100%) Strand = Plus / Plus Query: 15 tccattcctttccattccattcaaag 40 |||||||||||||||||||||||||| Sbjct: 5946802 tccattcctttccattccattcaaag 5946827 Score = 50.1 bits (25), Expect = 8e-04 Identities = 25/25 (100%) Strand = Plus / Plus Query: 15 tccattcctttccattccattcaaa 39 ||||||||||||||||||||||||| Sbjct: 5967478 tccattcctttccattccattcaaa 5967502 Score = 48.1 bits (24), Expect = 0.003 Identities = 24/24 (100%) Strand = Plus / Plus Query: 15 tccattcctttccattccattcaa 38 |||||||||||||||||||||||| Sbjct: 5942440 tccattcctttccattccattcaa 5942463 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Plus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 13877997 tccattcctttccattccattc 13878018 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Plus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 6010842 tccattcctttccattccattc 6010863 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Plus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 6008994 tccattcctttccattccattc 6009015 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Plus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 5992862 tccattcctttccattccattc 5992883 Score = 44.1 bits (22), Expect = 0.050 Identities = 25/26 (96%) Strand = Plus / Plus Query: 15 tccattcctttccattccattcaaag 40 |||||||| ||||||||||||||||| Sbjct: 5961859 tccattccattccattccattcaaag 5961884 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Plus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 5961769 tccattcctttccattccattc 5961790 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Plus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 5941729 tccattcctttccattccattc 5941750 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Plus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 5930011 tccattcctttccattccattc 5930032 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Plus Query: 17 cattcctttccattccattcaa 38 |||||||||||||||||||||| Sbjct: 5917205 cattcctttccattccattcaa 5917226 Score = 42.1 bits (21), Expect = 0.20 Identities = 24/25 (96%) Strand = Plus / Plus Query: 15 tccattcctttccattccattcaaa 39 ||||||| ||||||||||||||||| Sbjct: 6019540 tccattcgtttccattccattcaaa 6019564 Score = 42.1 bits (21), Expect = 0.20 Identities = 21/21 (100%) Strand = Plus / Plus Query: 15 tccattcctttccattccatt 35 ||||||||||||||||||||| Sbjct: 6019305 tccattcctttccattccatt 6019325 Score = 42.1 bits (21), Expect = 0.20 Identities = 21/21 (100%) Strand = Plus / Plus Query: 17 cattcctttccattccattca 37 ||||||||||||||||||||| Sbjct: 6013292 cattcctttccattccattca 6013312 Score = 42.1 bits (21), Expect = 0.20 Identities = 21/21 (100%) Strand = Plus / Plus Query: 18 attcctttccattccattcaa 38 ||||||||||||||||||||| Sbjct: 6006565 attcctttccattccattcaa 6006585 Score = 42.1 bits (21), Expect = 0.20 Identities = 21/21 (100%) Strand = Plus / Plus Query: 15 tccattcctttccattccatt 35 ||||||||||||||||||||| Sbjct: 6005572 tccattcctttccattccatt 6005592 Score = 42.1 bits (21), Expect = 0.20 Identities = 24/25 (96%) Strand = Plus / Plus Query: 15 tccattcctttccattccattcaaa 39 |||||||| |||||||||||||||| Sbjct: 5990888 tccattccattccattccattcaaa 5990912 Score = 42.1 bits (21), Expect = 0.20 Identities = 21/21 (100%) Strand = Plus / Plus Query: 15 tccattcctttccattccatt 35 ||||||||||||||||||||| Sbjct: 5959410 tccattcctttccattccatt 5959430 Score = 42.1 bits (21), Expect = 0.20 Identities = 21/21 (100%) Strand = Plus / Plus Query: 15 tccattcctttccattccatt 35 ||||||||||||||||||||| Sbjct: 5959300 tccattcctttccattccatt 5959320 Score = 42.1 bits (21), Expect = 0.20 Identities = 21/21 (100%) Strand = Plus / Plus Query: 15 tccattcctttccattccatt 35 ||||||||||||||||||||| Sbjct: 5921195 tccattcctttccattccatt 5921215 Score = 42.1 bits (21), Expect = 0.20 Identities = 21/21 (100%) Strand = Plus / Plus Query: 15 tccattcctttccattccatt 35 ||||||||||||||||||||| Sbjct: 5921150 tccattcctttccattccatt 5921170 Score = 42.1 bits (21), Expect = 0.20 Identities = 21/21 (100%) Strand = Plus / Plus Query: 15 tccattcctttccattccatt 35 ||||||||||||||||||||| Sbjct: 4036103 tccattcctttccattccatt 4036123 Score = 40.1 bits (20), Expect = 0.78 Identities = 23/24 (95%) Strand = Plus / Plus Query: 15 tccattcctttccattccattcaa 38 ||||||||| |||||||||||||| Sbjct: 6025978 tccattcctgtccattccattcaa 6026001 Score = 40.1 bits (20), Expect = 0.78 Identities = 23/24 (95%) Strand = Plus / Plus Query: 15 tccattcctttccattccattcaa 38 ||||||| |||||||||||||||| Sbjct: 6024439 tccattcatttccattccattcaa 6024462 Score = 40.1 bits (20), Expect = 0.78 Identities = 23/24 (95%) Strand = Plus / Plus Query: 15 tccattcctttccattccattcaa 38 |||||||| ||||||||||||||| Sbjct: 6020670 tccattccattccattccattcaa 6020693 Score = 40.1 bits (20), Expect = 0.78 Identities = 23/24 (95%) Strand = Plus / Plus Query: 13 gatccattcctttccattccattc 36 |||||||||| ||||||||||||| Sbjct: 6017329 gatccattccattccattccattc 6017352 Score = 40.1 bits (20), Expect = 0.78 Identities = 23/24 (95%) Strand = Plus / Plus Query: 15 tccattcctttccattccattcaa 38 |||||||| ||||||||||||||| Sbjct: 6000406 tccattccattccattccattcaa 6000429 Score = 40.1 bits (20), Expect = 0.78 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tccattcctttccattccat 34 |||||||||||||||||||| Sbjct: 5998718 tccattcctttccattccat 5998737 Score = 40.1 bits (20), Expect = 0.78 Identities = 20/20 (100%) Strand = Plus / Plus Query: 17 cattcctttccattccattc 36 |||||||||||||||||||| Sbjct: 5988025 cattcctttccattccattc 5988044 Score = 40.1 bits (20), Expect = 0.78 Identities = 23/24 (95%) Strand = Plus / Plus Query: 15 tccattcctttccattccattcaa 38 |||||||| ||||||||||||||| Sbjct: 5987504 tccattccattccattccattcaa 5987527 Score = 40.1 bits (20), Expect = 0.78 Identities = 23/24 (95%) Strand = Plus / Plus Query: 15 tccattcctttccattccattcaa 38 |||||||| ||||||||||||||| Sbjct: 5983284 tccattccattccattccattcaa 5983307 Score = 40.1 bits (20), Expect = 0.78 Identities = 23/24 (95%) Strand = Plus / Plus Query: 15 tccattcctttccattccattcaa 38 ||||||| |||||||||||||||| Sbjct: 5981440 tccattcatttccattccattcaa 5981463 Score = 40.1 bits (20), Expect = 0.78 Identities = 20/20 (100%) Strand = Plus / Plus Query: 17 cattcctttccattccattc 36 |||||||||||||||||||| Sbjct: 5981327 cattcctttccattccattc 5981346 Score = 40.1 bits (20), Expect = 0.78 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tccattcctttccattccat 34 |||||||||||||||||||| Sbjct: 5971623 tccattcctttccattccat 5971642 Score = 40.1 bits (20), Expect = 0.78 Identities = 23/24 (95%) Strand = Plus / Plus Query: 15 tccattcctttccattccattcaa 38 ||||||||||| |||||||||||| Sbjct: 5960400 tccattccttttcattccattcaa 5960423 Score = 40.1 bits (20), Expect = 0.78 Identities = 23/24 (95%) Strand = Plus / Plus Query: 15 tccattcctttccattccattcaa 38 |||||||| ||||||||||||||| Sbjct: 5955186 tccattccattccattccattcaa 5955209 Score = 40.1 bits (20), Expect = 0.78 Identities = 23/24 (95%) Strand = Plus / Plus Query: 15 tccattcctttccattccattcaa 38 |||||||| ||||||||||||||| Sbjct: 5950806 tccattccattccattccattcaa 5950829 Score = 40.1 bits (20), Expect = 0.78 Identities = 23/24 (95%) Strand = Plus / Plus Query: 15 tccattcctttccattccattcaa 38 |||||||| ||||||||||||||| Sbjct: 5936152 tccattccattccattccattcaa 5936175 Score = 40.1 bits (20), Expect = 0.78 Identities = 23/24 (95%) Strand = Plus / Plus Query: 15 tccattcctttccattccattcaa 38 ||||||| |||||||||||||||| Sbjct: 5931601 tccattcatttccattccattcaa 5931624 Score = 40.1 bits (20), Expect = 0.78 Identities = 23/24 (95%) Strand = Plus / Plus Query: 12 cgatccattcctttccattccatt 35 ||||||||||| |||||||||||| Sbjct: 5930193 cgatccattccattccattccatt 5930216 Score = 40.1 bits (20), Expect = 0.78 Identities = 23/24 (95%) Strand = Plus / Plus Query: 15 tccattcctttccattccattcaa 38 |||||||||| ||||||||||||| Sbjct: 5930026 tccattccttcccattccattcaa 5930049 Score = 40.1 bits (20), Expect = 0.78 Identities = 23/24 (95%) Strand = Plus / Plus Query: 15 tccattcctttccattccattcaa 38 |||||||| ||||||||||||||| Sbjct: 5927427 tccattccattccattccattcaa 5927450 Score = 40.1 bits (20), Expect = 0.78 Identities = 20/20 (100%) Strand = Plus / Plus Query: 19 ttcctttccattccattcaa 38 |||||||||||||||||||| Sbjct: 5925200 ttcctttccattccattcaa 5925219 Score = 40.1 bits (20), Expect = 0.78 Identities = 23/24 (95%) Strand = Plus / Plus Query: 15 tccattcctttccattccattcaa 38 ||||||||||| |||||||||||| Sbjct: 5924422 tccattcctttgcattccattcaa 5924445 Score = 40.1 bits (20), Expect = 0.78 Identities = 23/24 (95%) Strand = Plus / Plus Query: 15 tccattcctttccattccattcaa 38 |||||||| ||||||||||||||| Sbjct: 5924167 tccattcccttccattccattcaa 5924190 Score = 40.1 bits (20), Expect = 0.78 Identities = 23/24 (95%) Strand = Plus / Plus Query: 15 tccattcctttccattccattcaa 38 |||||||| ||||||||||||||| Sbjct: 5923408 tccattccattccattccattcaa 5923431 Score = 40.1 bits (20), Expect = 0.78 Identities = 23/24 (95%) Strand = Plus / Plus Query: 15 tccattcctttccattccattcaa 38 |||||| ||||||||||||||||| Sbjct: 5915900 tccatttctttccattccattcaa 5915923 Score = 40.1 bits (20), Expect = 0.78 Identities = 23/24 (95%) Strand = Plus / Plus Query: 15 tccattcctttccattccattcaa 38 |||||||| ||||||||||||||| Sbjct: 5915174 tccattccattccattccattcaa 5915197 Score = 40.1 bits (20), Expect = 0.78 Identities = 23/24 (95%) Strand = Plus / Plus Query: 15 tccattcctttccattccattcaa 38 |||||||| ||||||||||||||| Sbjct: 4035226 tccattccattccattccattcaa 4035249 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Plus Query: 18 attcctttccattccattc 36 ||||||||||||||||||| Sbjct: 6025876 attcctttccattccattc 6025894 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Plus Query: 15 tccattcctttccattccattca 37 |||||||| |||||||||||||| Sbjct: 6023424 tccattccattccattccattca 6023446 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Plus Query: 17 cattcctttccattccatt 35 ||||||||||||||||||| Sbjct: 6021686 cattcctttccattccatt 6021704 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Plus Query: 17 cattcctttccattccatt 35 ||||||||||||||||||| Sbjct: 6020448 cattcctttccattccatt 6020466 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Plus Query: 15 tccattcctttccattccattca 37 |||||||| |||||||||||||| Sbjct: 6014290 tccattcccttccattccattca 6014312 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Plus Query: 18 attcctttccattccattc 36 ||||||||||||||||||| Sbjct: 6014278 attcctttccattccattc 6014296 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Plus Query: 18 attcctttccattccattc 36 ||||||||||||||||||| Sbjct: 6014058 attcctttccattccattc 6014076 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Plus Query: 18 attcctttccattccattc 36 ||||||||||||||||||| Sbjct: 6011860 attcctttccattccattc 6011878 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Plus Query: 19 ttcctttccattccattca 37 ||||||||||||||||||| Sbjct: 6011121 ttcctttccattccattca 6011139 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Plus Query: 18 attcctttccattccattc 36 ||||||||||||||||||| Sbjct: 6010041 attcctttccattccattc 6010059 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Plus Query: 18 attcctttccattccattc 36 ||||||||||||||||||| Sbjct: 6008957 attcctttccattccattc 6008975 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Plus Query: 18 attcctttccattccattc 36 ||||||||||||||||||| Sbjct: 6003161 attcctttccattccattc 6003179 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Plus Query: 18 attcctttccattccattc 36 ||||||||||||||||||| Sbjct: 6002686 attcctttccattccattc 6002704 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Plus Query: 15 tccattcctttccattccattca 37 |||||||| |||||||||||||| Sbjct: 5988488 tccattccattccattccattca 5988510 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Plus Query: 15 tccattcctttccattccattca 37 |||||||| |||||||||||||| Sbjct: 5986995 tccattccattccattccattca 5987017 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Plus Query: 18 attcctttccattccattc 36 ||||||||||||||||||| Sbjct: 5985661 attcctttccattccattc 5985679 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Plus Query: 18 attcctttccattccattc 36 ||||||||||||||||||| Sbjct: 5982962 attcctttccattccattc 5982980 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Plus Query: 18 attcctttccattccattc 36 ||||||||||||||||||| Sbjct: 5980384 attcctttccattccattc 5980402 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Plus Query: 18 attcctttccattccattc 36 ||||||||||||||||||| Sbjct: 5980009 attcctttccattccattc 5980027 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Plus Query: 14 atccattcctttccattccattc 36 ||||||||| ||||||||||||| Sbjct: 5971547 atccattccattccattccattc 5971569 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Plus Query: 15 tccattcctttccattccattca 37 |||||||| |||||||||||||| Sbjct: 5969489 tccattccattccattccattca 5969511 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Plus Query: 15 tccattcctttccattccattca 37 |||||||| |||||||||||||| Sbjct: 5967088 tccattccattccattccattca 5967110 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Plus Query: 14 atccattcctttccattccattc 36 ||||||||| ||||||||||||| Sbjct: 5965768 atccattccattccattccattc 5965790 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Plus Query: 18 attcctttccattccattc 36 ||||||||||||||||||| Sbjct: 5961957 attcctttccattccattc 5961975 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Plus Query: 18 attcctttccattccattc 36 ||||||||||||||||||| Sbjct: 5958948 attcctttccattccattc 5958966 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Plus Query: 14 atccattcctttccattccattc 36 |||||||||||| |||||||||| Sbjct: 5958789 atccattcctttacattccattc 5958811 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Plus Query: 18 attcctttccattccattc 36 ||||||||||||||||||| Sbjct: 5956260 attcctttccattccattc 5956278 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Plus Query: 15 tccattcctttccattcca 33 ||||||||||||||||||| Sbjct: 5953549 tccattcctttccattcca 5953567 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Plus Query: 18 attcctttccattccattc 36 ||||||||||||||||||| Sbjct: 5953432 attcctttccattccattc 5953450 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Plus Query: 18 attcctttccattccattc 36 ||||||||||||||||||| Sbjct: 5950194 attcctttccattccattc 5950212 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Plus Query: 18 attcctttccattccattc 36 ||||||||||||||||||| Sbjct: 5949360 attcctttccattccattc 5949378 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Plus Query: 15 tccattcctttccattccattca 37 |||||||| |||||||||||||| Sbjct: 5947732 tccattccattccattccattca 5947754 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Plus Query: 14 atccattcctttccattccattc 36 ||||||||| ||||||||||||| Sbjct: 5947681 atccattccattccattccattc 5947703 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Plus Query: 18 attcctttccattccattc 36 ||||||||||||||||||| Sbjct: 5947180 attcctttccattccattc 5947198 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Plus Query: 18 attcctttccattccattc 36 ||||||||||||||||||| Sbjct: 5942537 attcctttccattccattc 5942555 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Plus Query: 18 attcctttccattccattc 36 ||||||||||||||||||| Sbjct: 5942313 attcctttccattccattc 5942331 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Plus Query: 18 attcctttccattccattc 36 ||||||||||||||||||| Sbjct: 5940349 attcctttccattccattc 5940367 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Plus Query: 15 tccattcctttccattccattca 37 |||||||| |||||||||||||| Sbjct: 5939541 tccattccattccattccattca 5939563 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Plus Query: 14 atccattcctttccattccattc 36 ||||||||| ||||||||||||| Sbjct: 5938558 atccattccattccattccattc 5938580 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Plus Query: 14 atccattcctttccattccattc 36 ||||||||| ||||||||||||| Sbjct: 5932577 atccattccattccattccattc 5932599 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Plus Query: 15 tccattcctttccattccattca 37 |||||||| |||||||||||||| Sbjct: 5931586 tccattccattccattccattca 5931608 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Plus Query: 14 atccattcctttccattccattc 36 ||||||||||| ||||||||||| Sbjct: 5928310 atccattccttcccattccattc 5928332 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Plus Query: 18 attcctttccattccattc 36 ||||||||||||||||||| Sbjct: 5927415 attcctttccattccattc 5927433 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Plus Query: 14 atccattcctttccattccattc 36 ||||||||| ||||||||||||| Sbjct: 5927246 atccattccattccattccattc 5927268 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Plus Query: 18 attcctttccattccattc 36 ||||||||||||||||||| Sbjct: 5925064 attcctttccattccattc 5925082 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Plus Query: 14 atccattcctttccattccattc 36 ||||||||| ||||||||||||| Sbjct: 5919925 atccattccattccattccattc 5919947 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Plus Query: 18 attcctttccattccattc 36 ||||||||||||||||||| Sbjct: 5919394 attcctttccattccattc 5919412 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Plus Query: 14 atccattcctttccattccattc 36 ||||||||| ||||||||||||| Sbjct: 5918286 atccattccattccattccattc 5918308 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Plus Query: 15 tccattcctttccattcca 33 ||||||||||||||||||| Sbjct: 5916040 tccattcctttccattcca 5916058
>gb|AC150909.3| Pan troglodytes BAC clone CH251-1056O7 from chromosome y, complete sequence Length = 178039 Score = 52.0 bits (26), Expect = 2e-04 Identities = 26/26 (100%) Strand = Plus / Plus Query: 15 tccattcctttccattccattcaaag 40 |||||||||||||||||||||||||| Sbjct: 107509 tccattcctttccattccattcaaag 107534 Score = 50.1 bits (25), Expect = 8e-04 Identities = 25/25 (100%) Strand = Plus / Plus Query: 15 tccattcctttccattccattcaaa 39 ||||||||||||||||||||||||| Sbjct: 128185 tccattcctttccattccattcaaa 128209 Score = 48.1 bits (24), Expect = 0.003 Identities = 24/24 (100%) Strand = Plus / Plus Query: 15 tccattcctttccattccattcaa 38 |||||||||||||||||||||||| Sbjct: 103147 tccattcctttccattccattcaa 103170 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Plus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 171549 tccattcctttccattccattc 171570 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Plus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 169701 tccattcctttccattccattc 169722 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Plus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 153559 tccattcctttccattccattc 153580 Score = 44.1 bits (22), Expect = 0.050 Identities = 25/26 (96%) Strand = Plus / Plus Query: 15 tccattcctttccattccattcaaag 40 |||||||| ||||||||||||||||| Sbjct: 122566 tccattccattccattccattcaaag 122591 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Plus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 122476 tccattcctttccattccattc 122497 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Plus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 102436 tccattcctttccattccattc 102457 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Plus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 90723 tccattcctttccattccattc 90744 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Plus Query: 17 cattcctttccattccattcaa 38 |||||||||||||||||||||| Sbjct: 77917 cattcctttccattccattcaa 77938 Score = 42.1 bits (21), Expect = 0.20 Identities = 21/21 (100%) Strand = Plus / Plus Query: 17 cattcctttccattccattca 37 ||||||||||||||||||||| Sbjct: 173999 cattcctttccattccattca 174019 Score = 42.1 bits (21), Expect = 0.20 Identities = 21/21 (100%) Strand = Plus / Plus Query: 18 attcctttccattccattcaa 38 ||||||||||||||||||||| Sbjct: 167272 attcctttccattccattcaa 167292 Score = 42.1 bits (21), Expect = 0.20 Identities = 21/21 (100%) Strand = Plus / Plus Query: 15 tccattcctttccattccatt 35 ||||||||||||||||||||| Sbjct: 166279 tccattcctttccattccatt 166299 Score = 42.1 bits (21), Expect = 0.20 Identities = 24/25 (96%) Strand = Plus / Plus Query: 15 tccattcctttccattccattcaaa 39 |||||||| |||||||||||||||| Sbjct: 151585 tccattccattccattccattcaaa 151609 Score = 42.1 bits (21), Expect = 0.20 Identities = 21/21 (100%) Strand = Plus / Plus Query: 15 tccattcctttccattccatt 35 ||||||||||||||||||||| Sbjct: 120117 tccattcctttccattccatt 120137 Score = 42.1 bits (21), Expect = 0.20 Identities = 21/21 (100%) Strand = Plus / Plus Query: 15 tccattcctttccattccatt 35 ||||||||||||||||||||| Sbjct: 120007 tccattcctttccattccatt 120027 Score = 42.1 bits (21), Expect = 0.20 Identities = 21/21 (100%) Strand = Plus / Plus Query: 15 tccattcctttccattccatt 35 ||||||||||||||||||||| Sbjct: 81907 tccattcctttccattccatt 81927 Score = 42.1 bits (21), Expect = 0.20 Identities = 21/21 (100%) Strand = Plus / Plus Query: 15 tccattcctttccattccatt 35 ||||||||||||||||||||| Sbjct: 81862 tccattcctttccattccatt 81882 Score = 40.1 bits (20), Expect = 0.78 Identities = 23/24 (95%) Strand = Plus / Plus Query: 15 tccattcctttccattccattcaa 38 |||||||| ||||||||||||||| Sbjct: 161113 tccattccattccattccattcaa 161136 Score = 40.1 bits (20), Expect = 0.78 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tccattcctttccattccat 34 |||||||||||||||||||| Sbjct: 159415 tccattcctttccattccat 159434 Score = 40.1 bits (20), Expect = 0.78 Identities = 20/20 (100%) Strand = Plus / Plus Query: 17 cattcctttccattccattc 36 |||||||||||||||||||| Sbjct: 148722 cattcctttccattccattc 148741 Score = 40.1 bits (20), Expect = 0.78 Identities = 23/24 (95%) Strand = Plus / Plus Query: 15 tccattcctttccattccattcaa 38 |||||||| ||||||||||||||| Sbjct: 148201 tccattccattccattccattcaa 148224 Score = 40.1 bits (20), Expect = 0.78 Identities = 23/24 (95%) Strand = Plus / Plus Query: 15 tccattcctttccattccattcaa 38 |||||||| ||||||||||||||| Sbjct: 143981 tccattccattccattccattcaa 144004 Score = 40.1 bits (20), Expect = 0.78 Identities = 23/24 (95%) Strand = Plus / Plus Query: 15 tccattcctttccattccattcaa 38 ||||||| |||||||||||||||| Sbjct: 142137 tccattcatttccattccattcaa 142160 Score = 40.1 bits (20), Expect = 0.78 Identities = 20/20 (100%) Strand = Plus / Plus Query: 17 cattcctttccattccattc 36 |||||||||||||||||||| Sbjct: 142024 cattcctttccattccattc 142043 Score = 40.1 bits (20), Expect = 0.78 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tccattcctttccattccat 34 |||||||||||||||||||| Sbjct: 132320 tccattcctttccattccat 132339 Score = 40.1 bits (20), Expect = 0.78 Identities = 23/24 (95%) Strand = Plus / Plus Query: 15 tccattcctttccattccattcaa 38 ||||||||||| |||||||||||| Sbjct: 121107 tccattccttttcattccattcaa 121130 Score = 40.1 bits (20), Expect = 0.78 Identities = 23/24 (95%) Strand = Plus / Plus Query: 15 tccattcctttccattccattcaa 38 |||||||| ||||||||||||||| Sbjct: 115893 tccattccattccattccattcaa 115916 Score = 40.1 bits (20), Expect = 0.78 Identities = 23/24 (95%) Strand = Plus / Plus Query: 15 tccattcctttccattccattcaa 38 |||||||| ||||||||||||||| Sbjct: 111513 tccattccattccattccattcaa 111536 Score = 40.1 bits (20), Expect = 0.78 Identities = 23/24 (95%) Strand = Plus / Plus Query: 15 tccattcctttccattccattcaa 38 |||||||| ||||||||||||||| Sbjct: 96864 tccattccattccattccattcaa 96887 Score = 40.1 bits (20), Expect = 0.78 Identities = 23/24 (95%) Strand = Plus / Plus Query: 15 tccattcctttccattccattcaa 38 ||||||| |||||||||||||||| Sbjct: 92313 tccattcatttccattccattcaa 92336 Score = 40.1 bits (20), Expect = 0.78 Identities = 23/24 (95%) Strand = Plus / Plus Query: 12 cgatccattcctttccattccatt 35 ||||||||||| |||||||||||| Sbjct: 90905 cgatccattccattccattccatt 90928 Score = 40.1 bits (20), Expect = 0.78 Identities = 23/24 (95%) Strand = Plus / Plus Query: 15 tccattcctttccattccattcaa 38 |||||||||| ||||||||||||| Sbjct: 90738 tccattccttcccattccattcaa 90761 Score = 40.1 bits (20), Expect = 0.78 Identities = 23/24 (95%) Strand = Plus / Plus Query: 15 tccattcctttccattccattcaa 38 |||||||| ||||||||||||||| Sbjct: 88139 tccattccattccattccattcaa 88162 Score = 40.1 bits (20), Expect = 0.78 Identities = 20/20 (100%) Strand = Plus / Plus Query: 19 ttcctttccattccattcaa 38 |||||||||||||||||||| Sbjct: 85912 ttcctttccattccattcaa 85931 Score = 40.1 bits (20), Expect = 0.78 Identities = 23/24 (95%) Strand = Plus / Plus Query: 15 tccattcctttccattccattcaa 38 ||||||||||| |||||||||||| Sbjct: 85134 tccattcctttgcattccattcaa 85157 Score = 40.1 bits (20), Expect = 0.78 Identities = 23/24 (95%) Strand = Plus / Plus Query: 15 tccattcctttccattccattcaa 38 |||||||| ||||||||||||||| Sbjct: 84879 tccattcccttccattccattcaa 84902 Score = 40.1 bits (20), Expect = 0.78 Identities = 23/24 (95%) Strand = Plus / Plus Query: 15 tccattcctttccattccattcaa 38 |||||||| ||||||||||||||| Sbjct: 84120 tccattccattccattccattcaa 84143 Score = 40.1 bits (20), Expect = 0.78 Identities = 23/24 (95%) Strand = Plus / Plus Query: 15 tccattcctttccattccattcaa 38 |||||| ||||||||||||||||| Sbjct: 76612 tccatttctttccattccattcaa 76635 Score = 40.1 bits (20), Expect = 0.78 Identities = 23/24 (95%) Strand = Plus / Plus Query: 15 tccattcctttccattccattcaa 38 |||||||| ||||||||||||||| Sbjct: 75886 tccattccattccattccattcaa 75909 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Plus Query: 15 tccattcctttccattccattca 37 |||||||| |||||||||||||| Sbjct: 174997 tccattcccttccattccattca 175019 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Plus Query: 18 attcctttccattccattc 36 ||||||||||||||||||| Sbjct: 174985 attcctttccattccattc 175003 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Plus Query: 18 attcctttccattccattc 36 ||||||||||||||||||| Sbjct: 174765 attcctttccattccattc 174783 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Plus Query: 18 attcctttccattccattc 36 ||||||||||||||||||| Sbjct: 172567 attcctttccattccattc 172585 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Plus Query: 19 ttcctttccattccattca 37 ||||||||||||||||||| Sbjct: 171828 ttcctttccattccattca 171846 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Plus Query: 18 attcctttccattccattc 36 ||||||||||||||||||| Sbjct: 170748 attcctttccattccattc 170766 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Plus Query: 18 attcctttccattccattc 36 ||||||||||||||||||| Sbjct: 169664 attcctttccattccattc 169682 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Plus Query: 18 attcctttccattccattc 36 ||||||||||||||||||| Sbjct: 163868 attcctttccattccattc 163886 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Plus Query: 18 attcctttccattccattc 36 ||||||||||||||||||| Sbjct: 163393 attcctttccattccattc 163411 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Plus Query: 15 tccattcctttccattccattca 37 |||||||| |||||||||||||| Sbjct: 149185 tccattccattccattccattca 149207 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Plus Query: 15 tccattcctttccattccattca 37 |||||||| |||||||||||||| Sbjct: 147692 tccattccattccattccattca 147714 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Plus Query: 18 attcctttccattccattc 36 ||||||||||||||||||| Sbjct: 146358 attcctttccattccattc 146376 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Plus Query: 18 attcctttccattccattc 36 ||||||||||||||||||| Sbjct: 143659 attcctttccattccattc 143677 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Plus Query: 18 attcctttccattccattc 36 ||||||||||||||||||| Sbjct: 141081 attcctttccattccattc 141099 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Plus Query: 18 attcctttccattccattc 36 ||||||||||||||||||| Sbjct: 140706 attcctttccattccattc 140724 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Plus Query: 14 atccattcctttccattccattc 36 ||||||||| ||||||||||||| Sbjct: 132254 atccattccattccattccattc 132276 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Plus Query: 15 tccattcctttccattccattca 37 |||||||| |||||||||||||| Sbjct: 130196 tccattccattccattccattca 130218 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Plus Query: 15 tccattcctttccattccattca 37 |||||||| |||||||||||||| Sbjct: 127795 tccattccattccattccattca 127817 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Plus Query: 14 atccattcctttccattccattc 36 ||||||||| ||||||||||||| Sbjct: 126475 atccattccattccattccattc 126497 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Plus Query: 18 attcctttccattccattc 36 ||||||||||||||||||| Sbjct: 122664 attcctttccattccattc 122682 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Plus Query: 18 attcctttccattccattc 36 ||||||||||||||||||| Sbjct: 119655 attcctttccattccattc 119673 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Plus Query: 14 atccattcctttccattccattc 36 |||||||||||| |||||||||| Sbjct: 119496 atccattcctttacattccattc 119518 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Plus Query: 18 attcctttccattccattc 36 ||||||||||||||||||| Sbjct: 116967 attcctttccattccattc 116985 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Plus Query: 15 tccattcctttccattcca 33 ||||||||||||||||||| Sbjct: 114256 tccattcctttccattcca 114274 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Plus Query: 18 attcctttccattccattc 36 ||||||||||||||||||| Sbjct: 114139 attcctttccattccattc 114157 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Plus Query: 18 attcctttccattccattc 36 ||||||||||||||||||| Sbjct: 110901 attcctttccattccattc 110919 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Plus Query: 18 attcctttccattccattc 36 ||||||||||||||||||| Sbjct: 110067 attcctttccattccattc 110085 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Plus Query: 15 tccattcctttccattccattca 37 |||||||| |||||||||||||| Sbjct: 108439 tccattccattccattccattca 108461 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Plus Query: 14 atccattcctttccattccattc 36 ||||||||| ||||||||||||| Sbjct: 108388 atccattccattccattccattc 108410 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Plus Query: 18 attcctttccattccattc 36 ||||||||||||||||||| Sbjct: 107887 attcctttccattccattc 107905 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Plus Query: 18 attcctttccattccattc 36 ||||||||||||||||||| Sbjct: 103244 attcctttccattccattc 103262 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Plus Query: 18 attcctttccattccattc 36 ||||||||||||||||||| Sbjct: 103020 attcctttccattccattc 103038 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Plus Query: 18 attcctttccattccattc 36 ||||||||||||||||||| Sbjct: 101056 attcctttccattccattc 101074 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Plus Query: 15 tccattcctttccattccattca 37 |||||||| |||||||||||||| Sbjct: 100248 tccattccattccattccattca 100270 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Plus Query: 14 atccattcctttccattccattc 36 ||||||||| ||||||||||||| Sbjct: 99270 atccattccattccattccattc 99292 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Plus Query: 14 atccattcctttccattccattc 36 ||||||||| ||||||||||||| Sbjct: 93289 atccattccattccattccattc 93311 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Plus Query: 15 tccattcctttccattccattca 37 |||||||| |||||||||||||| Sbjct: 92298 tccattccattccattccattca 92320 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Plus Query: 14 atccattcctttccattccattc 36 ||||||||||| ||||||||||| Sbjct: 89022 atccattccttcccattccattc 89044 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Plus Query: 18 attcctttccattccattc 36 ||||||||||||||||||| Sbjct: 88127 attcctttccattccattc 88145 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Plus Query: 14 atccattcctttccattccattc 36 ||||||||| ||||||||||||| Sbjct: 87958 atccattccattccattccattc 87980 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Plus Query: 18 attcctttccattccattc 36 ||||||||||||||||||| Sbjct: 85776 attcctttccattccattc 85794 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Plus Query: 14 atccattcctttccattccattc 36 ||||||||| ||||||||||||| Sbjct: 80637 atccattccattccattccattc 80659 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Plus Query: 18 attcctttccattccattc 36 ||||||||||||||||||| Sbjct: 80106 attcctttccattccattc 80124 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Plus Query: 14 atccattcctttccattccattc 36 ||||||||| ||||||||||||| Sbjct: 78998 atccattccattccattccattc 79020 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Plus Query: 15 tccattcctttccattcca 33 ||||||||||||||||||| Sbjct: 76752 tccattcctttccattcca 76770
>gb|AC156805.2| Pan troglodytes BAC clone CH251-830G14 from chromosome y, complete sequence Length = 230623 Score = 52.0 bits (26), Expect = 2e-04 Identities = 26/26 (100%) Strand = Plus / Minus Query: 15 tccattcctttccattccattcaaag 40 |||||||||||||||||||||||||| Sbjct: 162144 tccattcctttccattccattcaaag 162119 Score = 50.1 bits (25), Expect = 8e-04 Identities = 25/25 (100%) Strand = Plus / Minus Query: 15 tccattcctttccattccattcaaa 39 ||||||||||||||||||||||||| Sbjct: 141468 tccattcctttccattccattcaaa 141444 Score = 48.1 bits (24), Expect = 0.003 Identities = 24/24 (100%) Strand = Plus / Minus Query: 15 tccattcctttccattccattcaa 38 |||||||||||||||||||||||| Sbjct: 166506 tccattcctttccattccattcaa 166483 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Minus Query: 17 cattcctttccattccattcaa 38 |||||||||||||||||||||| Sbjct: 191741 cattcctttccattccattcaa 191720 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Minus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 178935 tccattcctttccattccattc 178914 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Minus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 167217 tccattcctttccattccattc 167196 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Minus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 147177 tccattcctttccattccattc 147156 Score = 44.1 bits (22), Expect = 0.050 Identities = 25/26 (96%) Strand = Plus / Minus Query: 15 tccattcctttccattccattcaaag 40 |||||||| ||||||||||||||||| Sbjct: 147087 tccattccattccattccattcaaag 147062 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Minus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 116084 tccattcctttccattccattc 116063 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Minus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 99952 tccattcctttccattccattc 99931 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Minus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 98104 tccattcctttccattccattc 98083 Score = 42.1 bits (21), Expect = 0.20 Identities = 21/21 (100%) Strand = Plus / Minus Query: 15 tccattcctttccattccatt 35 ||||||||||||||||||||| Sbjct: 187796 tccattcctttccattccatt 187776 Score = 42.1 bits (21), Expect = 0.20 Identities = 21/21 (100%) Strand = Plus / Minus Query: 15 tccattcctttccattccatt 35 ||||||||||||||||||||| Sbjct: 187751 tccattcctttccattccatt 187731 Score = 42.1 bits (21), Expect = 0.20 Identities = 21/21 (100%) Strand = Plus / Minus Query: 15 tccattcctttccattccatt 35 ||||||||||||||||||||| Sbjct: 149646 tccattcctttccattccatt 149626 Score = 42.1 bits (21), Expect = 0.20 Identities = 21/21 (100%) Strand = Plus / Minus Query: 15 tccattcctttccattccatt 35 ||||||||||||||||||||| Sbjct: 149536 tccattcctttccattccatt 149516 Score = 42.1 bits (21), Expect = 0.20 Identities = 24/25 (96%) Strand = Plus / Minus Query: 15 tccattcctttccattccattcaaa 39 |||||||| |||||||||||||||| Sbjct: 118058 tccattccattccattccattcaaa 118034 Score = 42.1 bits (21), Expect = 0.20 Identities = 21/21 (100%) Strand = Plus / Minus Query: 15 tccattcctttccattccatt 35 ||||||||||||||||||||| Sbjct: 103374 tccattcctttccattccatt 103354 Score = 42.1 bits (21), Expect = 0.20 Identities = 21/21 (100%) Strand = Plus / Minus Query: 18 attcctttccattccattcaa 38 ||||||||||||||||||||| Sbjct: 102381 attcctttccattccattcaa 102361 Score = 42.1 bits (21), Expect = 0.20 Identities = 21/21 (100%) Strand = Plus / Minus Query: 17 cattcctttccattccattca 37 ||||||||||||||||||||| Sbjct: 95654 cattcctttccattccattca 95634 Score = 42.1 bits (21), Expect = 0.20 Identities = 21/21 (100%) Strand = Plus / Minus Query: 15 tccattcctttccattccatt 35 ||||||||||||||||||||| Sbjct: 89641 tccattcctttccattccatt 89621 Score = 42.1 bits (21), Expect = 0.20 Identities = 24/25 (96%) Strand = Plus / Minus Query: 15 tccattcctttccattccattcaaa 39 ||||||| ||||||||||||||||| Sbjct: 89406 tccattcgtttccattccattcaaa 89382 Score = 40.1 bits (20), Expect = 0.78 Identities = 23/24 (95%) Strand = Plus / Minus Query: 15 tccattcctttccattccattcaa 38 |||||||| ||||||||||||||| Sbjct: 193772 tccattccattccattccattcaa 193749 Score = 40.1 bits (20), Expect = 0.78 Identities = 23/24 (95%) Strand = Plus / Minus Query: 15 tccattcctttccattccattcaa 38 |||||| ||||||||||||||||| Sbjct: 193046 tccatttctttccattccattcaa 193023 Score = 40.1 bits (20), Expect = 0.78 Identities = 23/24 (95%) Strand = Plus / Minus Query: 15 tccattcctttccattccattcaa 38 |||||||| ||||||||||||||| Sbjct: 185538 tccattccattccattccattcaa 185515 Score = 40.1 bits (20), Expect = 0.78 Identities = 23/24 (95%) Strand = Plus / Minus Query: 15 tccattcctttccattccattcaa 38 |||||||| ||||||||||||||| Sbjct: 184779 tccattcccttccattccattcaa 184756 Score = 40.1 bits (20), Expect = 0.78 Identities = 23/24 (95%) Strand = Plus / Minus Query: 15 tccattcctttccattccattcaa 38 ||||||||||| |||||||||||| Sbjct: 184524 tccattcctttgcattccattcaa 184501 Score = 40.1 bits (20), Expect = 0.78 Identities = 20/20 (100%) Strand = Plus / Minus Query: 19 ttcctttccattccattcaa 38 |||||||||||||||||||| Sbjct: 183746 ttcctttccattccattcaa 183727 Score = 40.1 bits (20), Expect = 0.78 Identities = 23/24 (95%) Strand = Plus / Minus Query: 15 tccattcctttccattccattcaa 38 |||||||| ||||||||||||||| Sbjct: 181519 tccattccattccattccattcaa 181496 Score = 40.1 bits (20), Expect = 0.78 Identities = 23/24 (95%) Strand = Plus / Minus Query: 15 tccattcctttccattccattcaa 38 |||||||||| ||||||||||||| Sbjct: 178920 tccattccttcccattccattcaa 178897 Score = 40.1 bits (20), Expect = 0.78 Identities = 23/24 (95%) Strand = Plus / Minus Query: 12 cgatccattcctttccattccatt 35 ||||||||||| |||||||||||| Sbjct: 178753 cgatccattccattccattccatt 178730 Score = 40.1 bits (20), Expect = 0.78 Identities = 23/24 (95%) Strand = Plus / Minus Query: 15 tccattcctttccattccattcaa 38 ||||||| |||||||||||||||| Sbjct: 177345 tccattcatttccattccattcaa 177322 Score = 40.1 bits (20), Expect = 0.78 Identities = 23/24 (95%) Strand = Plus / Minus Query: 15 tccattcctttccattccattcaa 38 |||||||| ||||||||||||||| Sbjct: 172794 tccattccattccattccattcaa 172771 Score = 40.1 bits (20), Expect = 0.78 Identities = 23/24 (95%) Strand = Plus / Minus Query: 15 tccattcctttccattccattcaa 38 |||||||| ||||||||||||||| Sbjct: 158140 tccattccattccattccattcaa 158117 Score = 40.1 bits (20), Expect = 0.78 Identities = 23/24 (95%) Strand = Plus / Minus Query: 15 tccattcctttccattccattcaa 38 |||||||| ||||||||||||||| Sbjct: 153760 tccattccattccattccattcaa 153737 Score = 40.1 bits (20), Expect = 0.78 Identities = 23/24 (95%) Strand = Plus / Minus Query: 15 tccattcctttccattccattcaa 38 ||||||||||| |||||||||||| Sbjct: 148546 tccattccttttcattccattcaa 148523 Score = 40.1 bits (20), Expect = 0.78 Identities = 20/20 (100%) Strand = Plus / Minus Query: 15 tccattcctttccattccat 34 |||||||||||||||||||| Sbjct: 137323 tccattcctttccattccat 137304 Score = 40.1 bits (20), Expect = 0.78 Identities = 20/20 (100%) Strand = Plus / Minus Query: 17 cattcctttccattccattc 36 |||||||||||||||||||| Sbjct: 127619 cattcctttccattccattc 127600 Score = 40.1 bits (20), Expect = 0.78 Identities = 23/24 (95%) Strand = Plus / Minus Query: 15 tccattcctttccattccattcaa 38 ||||||| |||||||||||||||| Sbjct: 127506 tccattcatttccattccattcaa 127483 Score = 40.1 bits (20), Expect = 0.78 Identities = 23/24 (95%) Strand = Plus / Minus Query: 15 tccattcctttccattccattcaa 38 |||||||| ||||||||||||||| Sbjct: 125662 tccattccattccattccattcaa 125639 Score = 40.1 bits (20), Expect = 0.78 Identities = 23/24 (95%) Strand = Plus / Minus Query: 15 tccattcctttccattccattcaa 38 |||||||| ||||||||||||||| Sbjct: 121442 tccattccattccattccattcaa 121419 Score = 40.1 bits (20), Expect = 0.78 Identities = 20/20 (100%) Strand = Plus / Minus Query: 17 cattcctttccattccattc 36 |||||||||||||||||||| Sbjct: 120921 cattcctttccattccattc 120902 Score = 40.1 bits (20), Expect = 0.78 Identities = 20/20 (100%) Strand = Plus / Minus Query: 15 tccattcctttccattccat 34 |||||||||||||||||||| Sbjct: 110228 tccattcctttccattccat 110209 Score = 40.1 bits (20), Expect = 0.78 Identities = 23/24 (95%) Strand = Plus / Minus Query: 15 tccattcctttccattccattcaa 38 |||||||| ||||||||||||||| Sbjct: 108540 tccattccattccattccattcaa 108517 Score = 40.1 bits (20), Expect = 0.78 Identities = 23/24 (95%) Strand = Plus / Minus Query: 13 gatccattcctttccattccattc 36 |||||||||| ||||||||||||| Sbjct: 91617 gatccattccattccattccattc 91594 Score = 40.1 bits (20), Expect = 0.78 Identities = 23/24 (95%) Strand = Plus / Minus Query: 15 tccattcctttccattccattcaa 38 |||||||| ||||||||||||||| Sbjct: 88276 tccattccattccattccattcaa 88253 Score = 40.1 bits (20), Expect = 0.78 Identities = 23/24 (95%) Strand = Plus / Minus Query: 15 tccattcctttccattccattcaa 38 ||||||| |||||||||||||||| Sbjct: 84507 tccattcatttccattccattcaa 84484 Score = 40.1 bits (20), Expect = 0.78 Identities = 23/24 (95%) Strand = Plus / Minus Query: 15 tccattcctttccattccattcaa 38 ||||||||| |||||||||||||| Sbjct: 82968 tccattcctgtccattccattcaa 82945 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Minus Query: 15 tccattcctttccattcca 33 ||||||||||||||||||| Sbjct: 192906 tccattcctttccattcca 192888 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Minus Query: 14 atccattcctttccattccattc 36 ||||||||| ||||||||||||| Sbjct: 190660 atccattccattccattccattc 190638 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Minus Query: 18 attcctttccattccattc 36 ||||||||||||||||||| Sbjct: 189552 attcctttccattccattc 189534 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Minus Query: 14 atccattcctttccattccattc 36 ||||||||| ||||||||||||| Sbjct: 189021 atccattccattccattccattc 188999 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Minus Query: 18 attcctttccattccattc 36 ||||||||||||||||||| Sbjct: 183882 attcctttccattccattc 183864 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Minus Query: 14 atccattcctttccattccattc 36 ||||||||| ||||||||||||| Sbjct: 181700 atccattccattccattccattc 181678 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Minus Query: 18 attcctttccattccattc 36 ||||||||||||||||||| Sbjct: 181531 attcctttccattccattc 181513 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Minus Query: 14 atccattcctttccattccattc 36 ||||||||||| ||||||||||| Sbjct: 180636 atccattccttcccattccattc 180614 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Minus Query: 15 tccattcctttccattccattca 37 |||||||| |||||||||||||| Sbjct: 177360 tccattccattccattccattca 177338 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Minus Query: 14 atccattcctttccattccattc 36 ||||||||| ||||||||||||| Sbjct: 176369 atccattccattccattccattc 176347 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Minus Query: 14 atccattcctttccattccattc 36 ||||||||| ||||||||||||| Sbjct: 170388 atccattccattccattccattc 170366 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Minus Query: 15 tccattcctttccattccattca 37 |||||||| |||||||||||||| Sbjct: 169405 tccattccattccattccattca 169383 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Minus Query: 18 attcctttccattccattc 36 ||||||||||||||||||| Sbjct: 168597 attcctttccattccattc 168579 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Minus Query: 18 attcctttccattccattc 36 ||||||||||||||||||| Sbjct: 166633 attcctttccattccattc 166615 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Minus Query: 18 attcctttccattccattc 36 ||||||||||||||||||| Sbjct: 166409 attcctttccattccattc 166391 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Minus Query: 18 attcctttccattccattc 36 ||||||||||||||||||| Sbjct: 161766 attcctttccattccattc 161748 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Minus Query: 14 atccattcctttccattccattc 36 ||||||||| ||||||||||||| Sbjct: 161265 atccattccattccattccattc 161243 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Minus Query: 15 tccattcctttccattccattca 37 |||||||| |||||||||||||| Sbjct: 161214 tccattccattccattccattca 161192 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Minus Query: 18 attcctttccattccattc 36 ||||||||||||||||||| Sbjct: 159586 attcctttccattccattc 159568 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Minus Query: 18 attcctttccattccattc 36 ||||||||||||||||||| Sbjct: 158752 attcctttccattccattc 158734 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Minus Query: 18 attcctttccattccattc 36 ||||||||||||||||||| Sbjct: 155514 attcctttccattccattc 155496 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Minus Query: 15 tccattcctttccattcca 33 ||||||||||||||||||| Sbjct: 155397 tccattcctttccattcca 155379 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Minus Query: 18 attcctttccattccattc 36 ||||||||||||||||||| Sbjct: 152686 attcctttccattccattc 152668 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Minus Query: 14 atccattcctttccattccattc 36 |||||||||||| |||||||||| Sbjct: 150157 atccattcctttacattccattc 150135 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Minus Query: 18 attcctttccattccattc 36 ||||||||||||||||||| Sbjct: 149998 attcctttccattccattc 149980 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Minus Query: 18 attcctttccattccattc 36 ||||||||||||||||||| Sbjct: 146989 attcctttccattccattc 146971 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Minus Query: 14 atccattcctttccattccattc 36 ||||||||| ||||||||||||| Sbjct: 143178 atccattccattccattccattc 143156 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Minus Query: 15 tccattcctttccattccattca 37 |||||||| |||||||||||||| Sbjct: 141858 tccattccattccattccattca 141836 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Minus Query: 15 tccattcctttccattccattca 37 |||||||| |||||||||||||| Sbjct: 139457 tccattccattccattccattca 139435 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Minus Query: 14 atccattcctttccattccattc 36 ||||||||| ||||||||||||| Sbjct: 137399 atccattccattccattccattc 137377 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Minus Query: 18 attcctttccattccattc 36 ||||||||||||||||||| Sbjct: 128937 attcctttccattccattc 128919 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Minus Query: 18 attcctttccattccattc 36 ||||||||||||||||||| Sbjct: 128562 attcctttccattccattc 128544 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Minus Query: 18 attcctttccattccattc 36 ||||||||||||||||||| Sbjct: 125984 attcctttccattccattc 125966 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Minus Query: 18 attcctttccattccattc 36 ||||||||||||||||||| Sbjct: 123285 attcctttccattccattc 123267 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Minus Query: 15 tccattcctttccattccattca 37 |||||||| |||||||||||||| Sbjct: 121951 tccattccattccattccattca 121929 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Minus Query: 15 tccattcctttccattccattca 37 |||||||| |||||||||||||| Sbjct: 120458 tccattccattccattccattca 120436 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Minus Query: 18 attcctttccattccattc 36 ||||||||||||||||||| Sbjct: 106260 attcctttccattccattc 106242 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Minus Query: 18 attcctttccattccattc 36 ||||||||||||||||||| Sbjct: 105785 attcctttccattccattc 105767 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Minus Query: 18 attcctttccattccattc 36 ||||||||||||||||||| Sbjct: 99989 attcctttccattccattc 99971 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Minus Query: 18 attcctttccattccattc 36 ||||||||||||||||||| Sbjct: 98905 attcctttccattccattc 98887 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Minus Query: 19 ttcctttccattccattca 37 ||||||||||||||||||| Sbjct: 97825 ttcctttccattccattca 97807 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Minus Query: 18 attcctttccattccattc 36 ||||||||||||||||||| Sbjct: 97086 attcctttccattccattc 97068 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Minus Query: 18 attcctttccattccattc 36 ||||||||||||||||||| Sbjct: 94888 attcctttccattccattc 94870 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Minus Query: 18 attcctttccattccattc 36 ||||||||||||||||||| Sbjct: 94668 attcctttccattccattc 94650 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Minus Query: 15 tccattcctttccattccattca 37 |||||||| |||||||||||||| Sbjct: 94656 tccattcccttccattccattca 94634 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Minus Query: 17 cattcctttccattccatt 35 ||||||||||||||||||| Sbjct: 88498 cattcctttccattccatt 88480 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Minus Query: 17 cattcctttccattccatt 35 ||||||||||||||||||| Sbjct: 87260 cattcctttccattccatt 87242 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Minus Query: 15 tccattcctttccattccattca 37 |||||||| |||||||||||||| Sbjct: 85522 tccattccattccattccattca 85500 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Minus Query: 18 attcctttccattccattc 36 ||||||||||||||||||| Sbjct: 83070 attcctttccattccattc 83052
>gb|AC011293.5|AC011293 Homo sapiens BAC clone RP11-75F5 from Y, complete sequence Length = 159722 Score = 52.0 bits (26), Expect = 2e-04 Identities = 26/26 (100%) Strand = Plus / Minus Query: 15 tccattcctttccattccattcaaag 40 |||||||||||||||||||||||||| Sbjct: 52970 tccattcctttccattccattcaaag 52945 Score = 48.1 bits (24), Expect = 0.003 Identities = 24/24 (100%) Strand = Plus / Minus Query: 15 tccattcctttccattccattcaa 38 |||||||||||||||||||||||| Sbjct: 67008 tccattcctttccattccattcaa 66985 Score = 48.1 bits (24), Expect = 0.003 Identities = 24/24 (100%) Strand = Plus / Minus Query: 15 tccattcctttccattccattcaa 38 |||||||||||||||||||||||| Sbjct: 29655 tccattcctttccattccattcaa 29632 Score = 48.1 bits (24), Expect = 0.003 Identities = 24/24 (100%) Strand = Plus / Minus Query: 15 tccattcctttccattccattcaa 38 |||||||||||||||||||||||| Sbjct: 21051 tccattcctttccattccattcaa 21028 Score = 46.1 bits (23), Expect = 0.013 Identities = 23/23 (100%) Strand = Plus / Minus Query: 14 atccattcctttccattccattc 36 ||||||||||||||||||||||| Sbjct: 12453 atccattcctttccattccattc 12431 Score = 46.1 bits (23), Expect = 0.013 Identities = 23/23 (100%) Strand = Plus / Minus Query: 14 atccattcctttccattccattc 36 ||||||||||||||||||||||| Sbjct: 3214 atccattcctttccattccattc 3192 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Minus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 66684 tccattcctttccattccattc 66663 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Minus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 65624 tccattcctttccattccattc 65603 Score = 44.1 bits (22), Expect = 0.050 Identities = 25/26 (96%) Strand = Plus / Minus Query: 14 atccattcctttccattccattcaaa 39 |||||||| ||||||||||||||||| Sbjct: 54892 atccattcttttccattccattcaaa 54867 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Minus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 51880 tccattcctttccattccattc 51859 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Minus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 51830 tccattcctttccattccattc 51809 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Minus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 46323 tccattcctttccattccattc 46302 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Minus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 45448 tccattcctttccattccattc 45427 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Minus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 45143 tccattcctttccattccattc 45122 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Minus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 39915 tccattcctttccattccattc 39894 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Minus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 32128 tccattcctttccattccattc 32107 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Minus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 27575 tccattcctttccattccattc 27554 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Minus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 26676 tccattcctttccattccattc 26655 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Minus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 19341 tccattcctttccattccattc 19320 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Minus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 17972 tccattcctttccattccattc 17951 Score = 42.1 bits (21), Expect = 0.20 Identities = 21/21 (100%) Strand = Plus / Minus Query: 18 attcctttccattccattcaa 38 ||||||||||||||||||||| Sbjct: 34952 attcctttccattccattcaa 34932 Score = 42.1 bits (21), Expect = 0.20 Identities = 21/21 (100%) Strand = Plus / Minus Query: 15 tccattcctttccattccatt 35 ||||||||||||||||||||| Sbjct: 26312 tccattcctttccattccatt 26292 Score = 42.1 bits (21), Expect = 0.20 Identities = 21/21 (100%) Strand = Plus / Minus Query: 15 tccattcctttccattccatt 35 ||||||||||||||||||||| Sbjct: 24146 tccattcctttccattccatt 24126 Score = 42.1 bits (21), Expect = 0.20 Identities = 21/21 (100%) Strand = Plus / Minus Query: 16 ccattcctttccattccattc 36 ||||||||||||||||||||| Sbjct: 8154 ccattcctttccattccattc 8134 Score = 40.1 bits (20), Expect = 0.78 Identities = 23/24 (95%) Strand = Plus / Minus Query: 15 tccattcctttccattccattcaa 38 |||||||| ||||||||||||||| Sbjct: 65994 tccattccgttccattccattcaa 65971 Score = 40.1 bits (20), Expect = 0.78 Identities = 26/28 (92%) Strand = Plus / Minus Query: 12 cgatccattcctttccattccattcaaa 39 ||||||||||| ||| |||||||||||| Sbjct: 64306 cgatccattccattctattccattcaaa 64279 Score = 40.1 bits (20), Expect = 0.78 Identities = 20/20 (100%) Strand = Plus / Minus Query: 15 tccattcctttccattccat 34 |||||||||||||||||||| Sbjct: 61148 tccattcctttccattccat 61129 Score = 40.1 bits (20), Expect = 0.78 Identities = 20/20 (100%) Strand = Plus / Minus Query: 15 tccattcctttccattccat 34 |||||||||||||||||||| Sbjct: 58660 tccattcctttccattccat 58641 Score = 40.1 bits (20), Expect = 0.78 Identities = 23/24 (95%) Strand = Plus / Minus Query: 13 gatccattcctttccattccattc 36 |||||||||| ||||||||||||| Sbjct: 50662 gatccattccattccattccattc 50639 Score = 40.1 bits (20), Expect = 0.78 Identities = 23/24 (95%) Strand = Plus / Minus Query: 15 tccattcctttccattccattcaa 38 |||||||| ||||||||||||||| Sbjct: 46752 tccattccattccattccattcaa 46729 Score = 40.1 bits (20), Expect = 0.78 Identities = 23/24 (95%) Strand = Plus / Minus Query: 15 tccattcctttccattccattcaa 38 |||||||| ||||||||||||||| Sbjct: 40949 tccattccattccattccattcaa 40926 Score = 40.1 bits (20), Expect = 0.78 Identities = 23/24 (95%) Strand = Plus / Minus Query: 15 tccattcctttccattccattcaa 38 |||||||| ||||||||||||||| Sbjct: 34450 tccattccattccattccattcaa 34427 Score = 40.1 bits (20), Expect = 0.78 Identities = 23/24 (95%) Strand = Plus / Minus Query: 15 tccattcctttccattccattcaa 38 ||||||||| |||||||||||||| Sbjct: 27958 tccattcctgtccattccattcaa 27935 Score = 40.1 bits (20), Expect = 0.78 Identities = 20/20 (100%) Strand = Plus / Minus Query: 15 tccattcctttccattccat 34 |||||||||||||||||||| Sbjct: 26252 tccattcctttccattccat 26233 Score = 40.1 bits (20), Expect = 0.78 Identities = 23/24 (95%) Strand = Plus / Minus Query: 15 tccattcctttccattccattcaa 38 |||||||| ||||||||||||||| Sbjct: 25615 tccattccattccattccattcaa 25592 Score = 40.1 bits (20), Expect = 0.78 Identities = 20/20 (100%) Strand = Plus / Minus Query: 17 cattcctttccattccattc 36 |||||||||||||||||||| Sbjct: 23684 cattcctttccattccattc 23665 Score = 40.1 bits (20), Expect = 0.78 Identities = 20/20 (100%) Strand = Plus / Minus Query: 15 tccattcctttccattccat 34 |||||||||||||||||||| Sbjct: 22547 tccattcctttccattccat 22528 Score = 40.1 bits (20), Expect = 0.78 Identities = 23/24 (95%) Strand = Plus / Minus Query: 15 tccattcctttccattccattcaa 38 |||||||| ||||||||||||||| Sbjct: 21403 tccattccattccattccattcaa 21380 Score = 40.1 bits (20), Expect = 0.78 Identities = 23/24 (95%) Strand = Plus / Minus Query: 15 tccattcctttccattccattcaa 38 |||||||||||| ||||||||||| Sbjct: 19801 tccattcctttcaattccattcaa 19778 Score = 40.1 bits (20), Expect = 0.78 Identities = 23/24 (95%) Strand = Plus / Minus Query: 15 tccattcctttccattccattcaa 38 |||||||| ||||||||||||||| Sbjct: 19636 tccattccattccattccattcaa 19613 Score = 40.1 bits (20), Expect = 0.78 Identities = 23/24 (95%) Strand = Plus / Minus Query: 15 tccattcctttccattccattcaa 38 |||||||| ||||||||||||||| Sbjct: 11272 tccattccattccattccattcaa 11249 Score = 40.1 bits (20), Expect = 0.78 Identities = 23/24 (95%) Strand = Plus / Minus Query: 15 tccattcctttccattccattcaa 38 |||||||| ||||||||||||||| Sbjct: 10383 tccattccattccattccattcaa 10360 Score = 40.1 bits (20), Expect = 0.78 Identities = 23/24 (95%) Strand = Plus / Minus Query: 15 tccattcctttccattccattcaa 38 ||||||| |||||||||||||||| Sbjct: 3797 tccattcatttccattccattcaa 3774 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Minus Query: 15 tccattcctttccattccattca 37 |||||||| |||||||||||||| Sbjct: 65614 tccattccattccattccattca 65592 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Minus Query: 18 attcctttccattccattc 36 ||||||||||||||||||| Sbjct: 62655 attcctttccattccattc 62637 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Minus Query: 17 cattcctttccattccatt 35 ||||||||||||||||||| Sbjct: 61101 cattcctttccattccatt 61083 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Minus Query: 20 tcctttccattccattcaa 38 ||||||||||||||||||| Sbjct: 54211 tcctttccattccattcaa 54193 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Minus Query: 19 ttcctttccattccattca 37 ||||||||||||||||||| Sbjct: 51456 ttcctttccattccattca 51438 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Minus Query: 15 tccattcctttccattccattca 37 |||||||| |||||||||||||| Sbjct: 47668 tccattccattccattccattca 47646 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Minus Query: 15 tccattcctttccattccattca 37 |||||||| |||||||||||||| Sbjct: 44933 tccattccattccattccattca 44911 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Minus Query: 18 attcctttccattccattc 36 ||||||||||||||||||| Sbjct: 43488 attcctttccattccattc 43470 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Minus Query: 18 attcctttccattccattc 36 ||||||||||||||||||| Sbjct: 40191 attcctttccattccattc 40173 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Minus Query: 14 atccattcctttccattccattc 36 ||||||||| ||||||||||||| Sbjct: 39891 atccattccattccattccattc 39869 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Minus Query: 18 attcctttccattccattc 36 ||||||||||||||||||| Sbjct: 39387 attcctttccattccattc 39369 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Minus Query: 18 attcctttccattccattc 36 ||||||||||||||||||| Sbjct: 38043 attcctttccattccattc 38025 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Minus Query: 18 attcctttccattccattc 36 ||||||||||||||||||| Sbjct: 36705 attcctttccattccattc 36687 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Minus Query: 18 attcctttccattccattc 36 ||||||||||||||||||| Sbjct: 35102 attcctttccattccattc 35084 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Minus Query: 18 attcctttccattccattcaaag 40 ||||| ||||||||||||||||| Sbjct: 31885 attccattccattccattcaaag 31863 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Minus Query: 14 atccattcctttccattccattc 36 ||||||||| ||||||||||||| Sbjct: 31499 atccattccattccattccattc 31477 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Minus Query: 14 atccattcctttccattccattc 36 ||||||||| ||||||||||||| Sbjct: 30110 atccattccattccattccattc 30088 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Minus Query: 18 attcctttccattccattc 36 ||||||||||||||||||| Sbjct: 29962 attcctttccattccattc 29944 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Minus Query: 18 attcctttccattccattc 36 ||||||||||||||||||| Sbjct: 29752 attcctttccattccattc 29734 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Minus Query: 17 cattcctttccattccatt 35 ||||||||||||||||||| Sbjct: 25878 cattcctttccattccatt 25860 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Minus Query: 14 atccattcctttccattccattc 36 ||||||||||||||| ||||||| Sbjct: 24062 atccattcctttccagtccattc 24040 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Minus Query: 18 attcctttccattccattc 36 ||||||||||||||||||| Sbjct: 23479 attcctttccattccattc 23461 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Minus Query: 14 atccattcctttccattccattc 36 ||||||||| ||||||||||||| Sbjct: 22253 atccattccattccattccattc 22231 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Minus Query: 14 atccattcctttccattccattc 36 ||||||||| ||||||||||||| Sbjct: 20482 atccattccattccattccattc 20460 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Minus Query: 18 attcctttccattccattc 36 ||||||||||||||||||| Sbjct: 14287 attcctttccattccattc 14269 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Minus Query: 14 atccattcctttccattccattc 36 ||||||||| ||||||||||||| Sbjct: 10389 atccattccattccattccattc 10367 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Minus Query: 15 tccattcctttccattccattca 37 |||||||| |||||||||||||| Sbjct: 6840 tccattccattccattccattca 6818
>gb|AC172374.4| Pan troglodytes BAC clone CH251-119H6 from chromosome y, complete sequence Length = 176115 Score = 50.1 bits (25), Expect = 8e-04 Identities = 25/25 (100%) Strand = Plus / Plus Query: 15 tccattcctttccattccattcaaa 39 ||||||||||||||||||||||||| Sbjct: 1134 tccattcctttccattccattcaaa 1158 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Plus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 44508 tccattcctttccattccattc 44529 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Plus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 42660 tccattcctttccattccattc 42681 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Plus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 26518 tccattcctttccattccattc 26539 Score = 42.1 bits (21), Expect = 0.20 Identities = 24/25 (96%) Strand = Plus / Plus Query: 15 tccattcctttccattccattcaaa 39 ||||||| ||||||||||||||||| Sbjct: 53206 tccattcgtttccattccattcaaa 53230 Score = 42.1 bits (21), Expect = 0.20 Identities = 21/21 (100%) Strand = Plus / Plus Query: 15 tccattcctttccattccatt 35 ||||||||||||||||||||| Sbjct: 52971 tccattcctttccattccatt 52991 Score = 42.1 bits (21), Expect = 0.20 Identities = 21/21 (100%) Strand = Plus / Plus Query: 17 cattcctttccattccattca 37 ||||||||||||||||||||| Sbjct: 46958 cattcctttccattccattca 46978 Score = 42.1 bits (21), Expect = 0.20 Identities = 21/21 (100%) Strand = Plus / Plus Query: 18 attcctttccattccattcaa 38 ||||||||||||||||||||| Sbjct: 40231 attcctttccattccattcaa 40251 Score = 42.1 bits (21), Expect = 0.20 Identities = 21/21 (100%) Strand = Plus / Plus Query: 15 tccattcctttccattccatt 35 ||||||||||||||||||||| Sbjct: 39238 tccattcctttccattccatt 39258 Score = 42.1 bits (21), Expect = 0.20 Identities = 24/25 (96%) Strand = Plus / Plus Query: 15 tccattcctttccattccattcaaa 39 |||||||| |||||||||||||||| Sbjct: 24544 tccattccattccattccattcaaa 24568 Score = 40.1 bits (20), Expect = 0.78 Identities = 23/24 (95%) Strand = Plus / Plus Query: 15 tccattcctttccattccattcaa 38 ||||||||| |||||||||||||| Sbjct: 59644 tccattcctgtccattccattcaa 59667 Score = 40.1 bits (20), Expect = 0.78 Identities = 23/24 (95%) Strand = Plus / Plus Query: 15 tccattcctttccattccattcaa 38 ||||||| |||||||||||||||| Sbjct: 58105 tccattcatttccattccattcaa 58128 Score = 40.1 bits (20), Expect = 0.78 Identities = 23/24 (95%) Strand = Plus / Plus Query: 15 tccattcctttccattccattcaa 38 |||||||| ||||||||||||||| Sbjct: 54336 tccattccattccattccattcaa 54359 Score = 40.1 bits (20), Expect = 0.78 Identities = 23/24 (95%) Strand = Plus / Plus Query: 13 gatccattcctttccattccattc 36 |||||||||| ||||||||||||| Sbjct: 50995 gatccattccattccattccattc 51018 Score = 40.1 bits (20), Expect = 0.78 Identities = 23/24 (95%) Strand = Plus / Plus Query: 15 tccattcctttccattccattcaa 38 |||||||| ||||||||||||||| Sbjct: 34072 tccattccattccattccattcaa 34095 Score = 40.1 bits (20), Expect = 0.78 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tccattcctttccattccat 34 |||||||||||||||||||| Sbjct: 32374 tccattcctttccattccat 32393 Score = 40.1 bits (20), Expect = 0.78 Identities = 20/20 (100%) Strand = Plus / Plus Query: 17 cattcctttccattccattc 36 |||||||||||||||||||| Sbjct: 21681 cattcctttccattccattc 21700 Score = 40.1 bits (20), Expect = 0.78 Identities = 23/24 (95%) Strand = Plus / Plus Query: 15 tccattcctttccattccattcaa 38 |||||||| ||||||||||||||| Sbjct: 21160 tccattccattccattccattcaa 21183 Score = 40.1 bits (20), Expect = 0.78 Identities = 23/24 (95%) Strand = Plus / Plus Query: 15 tccattcctttccattccattcaa 38 |||||||| ||||||||||||||| Sbjct: 16940 tccattccattccattccattcaa 16963 Score = 40.1 bits (20), Expect = 0.78 Identities = 23/24 (95%) Strand = Plus / Plus Query: 15 tccattcctttccattccattcaa 38 ||||||| |||||||||||||||| Sbjct: 15096 tccattcatttccattccattcaa 15119 Score = 40.1 bits (20), Expect = 0.78 Identities = 20/20 (100%) Strand = Plus / Plus Query: 17 cattcctttccattccattc 36 |||||||||||||||||||| Sbjct: 14983 cattcctttccattccattc 15002 Score = 40.1 bits (20), Expect = 0.78 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tccattcctttccattccat 34 |||||||||||||||||||| Sbjct: 5279 tccattcctttccattccat 5298 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Plus Query: 18 attcctttccattccattc 36 ||||||||||||||||||| Sbjct: 59542 attcctttccattccattc 59560 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Plus Query: 15 tccattcctttccattccattca 37 |||||||| |||||||||||||| Sbjct: 57090 tccattccattccattccattca 57112 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Plus Query: 17 cattcctttccattccatt 35 ||||||||||||||||||| Sbjct: 55352 cattcctttccattccatt 55370 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Plus Query: 17 cattcctttccattccatt 35 ||||||||||||||||||| Sbjct: 54114 cattcctttccattccatt 54132 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Plus Query: 15 tccattcctttccattccattca 37 |||||||| |||||||||||||| Sbjct: 47956 tccattcccttccattccattca 47978 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Plus Query: 18 attcctttccattccattc 36 ||||||||||||||||||| Sbjct: 47944 attcctttccattccattc 47962 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Plus Query: 18 attcctttccattccattc 36 ||||||||||||||||||| Sbjct: 47724 attcctttccattccattc 47742 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Plus Query: 18 attcctttccattccattc 36 ||||||||||||||||||| Sbjct: 45526 attcctttccattccattc 45544 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Plus Query: 19 ttcctttccattccattca 37 ||||||||||||||||||| Sbjct: 44787 ttcctttccattccattca 44805 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Plus Query: 18 attcctttccattccattc 36 ||||||||||||||||||| Sbjct: 43707 attcctttccattccattc 43725 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Plus Query: 18 attcctttccattccattc 36 ||||||||||||||||||| Sbjct: 42623 attcctttccattccattc 42641 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Plus Query: 18 attcctttccattccattc 36 ||||||||||||||||||| Sbjct: 36827 attcctttccattccattc 36845 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Plus Query: 18 attcctttccattccattc 36 ||||||||||||||||||| Sbjct: 36352 attcctttccattccattc 36370 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Plus Query: 15 tccattcctttccattccattca 37 |||||||| |||||||||||||| Sbjct: 22144 tccattccattccattccattca 22166 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Plus Query: 15 tccattcctttccattccattca 37 |||||||| |||||||||||||| Sbjct: 20651 tccattccattccattccattca 20673 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Plus Query: 18 attcctttccattccattc 36 ||||||||||||||||||| Sbjct: 19317 attcctttccattccattc 19335 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Plus Query: 18 attcctttccattccattc 36 ||||||||||||||||||| Sbjct: 16618 attcctttccattccattc 16636 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Plus Query: 18 attcctttccattccattc 36 ||||||||||||||||||| Sbjct: 14040 attcctttccattccattc 14058 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Plus Query: 18 attcctttccattccattc 36 ||||||||||||||||||| Sbjct: 13665 attcctttccattccattc 13683 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Plus Query: 14 atccattcctttccattccattc 36 ||||||||| ||||||||||||| Sbjct: 5203 atccattccattccattccattc 5225 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Plus Query: 15 tccattcctttccattccattca 37 |||||||| |||||||||||||| Sbjct: 3145 tccattccattccattccattca 3167 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Plus Query: 15 tccattcctttccattccattca 37 |||||||| |||||||||||||| Sbjct: 744 tccattccattccattccattca 766
>gb|AC134882.2| Homo sapiens BAC clone RP11-886I11 from Y, complete sequence Length = 152654 Score = 48.1 bits (24), Expect = 0.003 Identities = 24/24 (100%) Strand = Plus / Minus Query: 15 tccattcctttccattccattcaa 38 |||||||||||||||||||||||| Sbjct: 96709 tccattcctttccattccattcaa 96686 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Minus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 100717 tccattcctttccattccattc 100696 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Minus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 99214 tccattcctttccattccattc 99193 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Minus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 95970 tccattcctttccattccattc 95949 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Minus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 95385 tccattcctttccattccattc 95364 Score = 42.1 bits (21), Expect = 0.20 Identities = 24/25 (96%) Strand = Plus / Minus Query: 15 tccattcctttccattccattcaaa 39 |||||||| |||||||||||||||| Sbjct: 101394 tccattccattccattccattcaaa 101370 Score = 40.1 bits (20), Expect = 0.78 Identities = 23/24 (95%) Strand = Plus / Minus Query: 15 tccattcctttccattccattcaa 38 |||||||| ||||||||||||||| Sbjct: 104037 tccattccattccattccattcaa 104014 Score = 40.1 bits (20), Expect = 0.78 Identities = 20/20 (100%) Strand = Plus / Minus Query: 17 cattcctttccattccattc 36 |||||||||||||||||||| Sbjct: 99723 cattcctttccattccattc 99704 Score = 40.1 bits (20), Expect = 0.78 Identities = 23/24 (95%) Strand = Plus / Minus Query: 15 tccattcctttccattccattcaa 38 ||||||||||||| |||||||||| Sbjct: 99279 tccattcctttcccttccattcaa 99256 Score = 40.1 bits (20), Expect = 0.78 Identities = 20/20 (100%) Strand = Plus / Minus Query: 17 cattcctttccattccattc 36 |||||||||||||||||||| Sbjct: 98544 cattcctttccattccattc 98525 Score = 40.1 bits (20), Expect = 0.78 Identities = 23/24 (95%) Strand = Plus / Minus Query: 15 tccattcctttccattccattcaa 38 |||||||| ||||||||||||||| Sbjct: 95850 tccattccattccattccattcaa 95827 Score = 40.1 bits (20), Expect = 0.78 Identities = 23/24 (95%) Strand = Plus / Minus Query: 15 tccattcctttccattccattcaa 38 |||||||| ||||||||||||||| Sbjct: 95605 tccattccattccattccattcaa 95582 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Minus Query: 14 atccattcctttccattccattc 36 ||||||||| ||||||||||||| Sbjct: 100543 atccattccattccattccattc 100521 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Minus Query: 15 tccattcctttccattccattca 37 |||||||| |||||||||||||| Sbjct: 100512 tccattccattccattccattca 100490
>emb|BX322639.2| Human DNA sequence from clone RP11-313J2 on chromosome 10 Contains a zinc finger protein pseudogene and a CpG island, complete sequence Length = 87299 Score = 48.1 bits (24), Expect = 0.003 Identities = 24/24 (100%) Strand = Plus / Plus Query: 15 tccattcctttccattccattcaa 38 |||||||||||||||||||||||| Sbjct: 20852 tccattcctttccattccattcaa 20875 Score = 48.1 bits (24), Expect = 0.003 Identities = 24/24 (100%) Strand = Plus / Plus Query: 15 tccattcctttccattccattcaa 38 |||||||||||||||||||||||| Sbjct: 4830 tccattcctttccattccattcaa 4853 Score = 46.1 bits (23), Expect = 0.013 Identities = 23/23 (100%) Strand = Plus / Plus Query: 15 tccattcctttccattccattca 37 ||||||||||||||||||||||| Sbjct: 6497 tccattcctttccattccattca 6519 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Plus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 24043 tccattcctttccattccattc 24064 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Plus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 22854 tccattcctttccattccattc 22875 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Plus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 18636 tccattcctttccattccattc 18657 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Plus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 17492 tccattcctttccattccattc 17513 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Plus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 16659 tccattcctttccattccattc 16680 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Plus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 15142 tccattcctttccattccattc 15163 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Plus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 12552 tccattcctttccattccattc 12573 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Plus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 11897 tccattcctttccattccattc 11918 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Plus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 11777 tccattcctttccattccattc 11798 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Plus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 11602 tccattcctttccattccattc 11623 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Plus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 11322 tccattcctttccattccattc 11343 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Plus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 11262 tccattcctttccattccattc 11283 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Plus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 8925 tccattcctttccattccattc 8946 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Plus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 7150 tccattcctttccattccattc 7171 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Plus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 7066 tccattcctttccattccattc 7087 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Plus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 6816 tccattcctttccattccattc 6837 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Plus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 6107 tccattcctttccattccattc 6128 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Plus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 3586 tccattcctttccattccattc 3607 Score = 42.1 bits (21), Expect = 0.20 Identities = 21/21 (100%) Strand = Plus / Plus Query: 15 tccattcctttccattccatt 35 ||||||||||||||||||||| Sbjct: 22829 tccattcctttccattccatt 22849 Score = 42.1 bits (21), Expect = 0.20 Identities = 24/25 (96%) Strand = Plus / Plus Query: 15 tccattcctttccattccattcaaa 39 |||||||| |||||||||||||||| Sbjct: 22759 tccattccattccattccattcaaa 22783 Score = 42.1 bits (21), Expect = 0.20 Identities = 21/21 (100%) Strand = Plus / Plus Query: 15 tccattcctttccattccatt 35 ||||||||||||||||||||| Sbjct: 18506 tccattcctttccattccatt 18526 Score = 42.1 bits (21), Expect = 0.20 Identities = 21/21 (100%) Strand = Plus / Plus Query: 15 tccattcctttccattccatt 35 ||||||||||||||||||||| Sbjct: 16240 tccattcctttccattccatt 16260 Score = 42.1 bits (21), Expect = 0.20 Identities = 21/21 (100%) Strand = Plus / Plus Query: 15 tccattcctttccattccatt 35 ||||||||||||||||||||| Sbjct: 15446 tccattcctttccattccatt 15466 Score = 42.1 bits (21), Expect = 0.20 Identities = 21/21 (100%) Strand = Plus / Plus Query: 14 atccattcctttccattccat 34 ||||||||||||||||||||| Sbjct: 13415 atccattcctttccattccat 13435 Score = 42.1 bits (21), Expect = 0.20 Identities = 21/21 (100%) Strand = Plus / Plus Query: 16 ccattcctttccattccattc 36 ||||||||||||||||||||| Sbjct: 10458 ccattcctttccattccattc 10478 Score = 42.1 bits (21), Expect = 0.20 Identities = 21/21 (100%) Strand = Plus / Plus Query: 18 attcctttccattccattcaa 38 ||||||||||||||||||||| Sbjct: 8888 attcctttccattccattcaa 8908 Score = 42.1 bits (21), Expect = 0.20 Identities = 21/21 (100%) Strand = Plus / Plus Query: 15 tccattcctttccattccatt 35 ||||||||||||||||||||| Sbjct: 4265 tccattcctttccattccatt 4285 Score = 40.1 bits (20), Expect = 0.78 Identities = 23/24 (95%) Strand = Plus / Plus Query: 15 tccattcctttccattccattcaa 38 |||||||| ||||||||||||||| Sbjct: 21796 tccattccattccattccattcaa 21819 Score = 40.1 bits (20), Expect = 0.78 Identities = 20/20 (100%) Strand = Plus / Plus Query: 17 cattcctttccattccattc 36 |||||||||||||||||||| Sbjct: 17000 cattcctttccattccattc 17019 Score = 40.1 bits (20), Expect = 0.78 Identities = 23/24 (95%) Strand = Plus / Plus Query: 14 atccattcctttccattccattca 37 ||||||||||||||||| |||||| Sbjct: 14319 atccattcctttccattgcattca 14342 Score = 40.1 bits (20), Expect = 0.78 Identities = 20/20 (100%) Strand = Plus / Plus Query: 17 cattcctttccattccattc 36 |||||||||||||||||||| Sbjct: 8647 cattcctttccattccattc 8666 Score = 40.1 bits (20), Expect = 0.78 Identities = 23/24 (95%) Strand = Plus / Plus Query: 15 tccattcctttccattccattcaa 38 ||||||||||| |||||||||||| Sbjct: 4945 tccattcctttacattccattcaa 4968 Score = 40.1 bits (20), Expect = 0.78 Identities = 20/20 (100%) Strand = Plus / Plus Query: 17 cattcctttccattccattc 36 |||||||||||||||||||| Sbjct: 2903 cattcctttccattccattc 2922 Score = 40.1 bits (20), Expect = 0.78 Identities = 23/24 (95%) Strand = Plus / Plus Query: 15 tccattcctttccattccattcaa 38 |||||||| ||||||||||||||| Sbjct: 325 tccattccattccattccattcaa 348 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Plus Query: 14 atccattcctttccattccattc 36 ||||||||| ||||||||||||| Sbjct: 24486 atccattccattccattccattc 24508 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Plus Query: 14 atccattcctttccattccattc 36 |||||||||||||||||| |||| Sbjct: 23992 atccattcctttccattcaattc 24014 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Plus Query: 14 atccattcctttccattccattc 36 ||||||||| ||||||||||||| Sbjct: 23697 atccattccattccattccattc 23719 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Plus Query: 15 tccattcctttccattccattca 37 |||||||| |||||||||||||| Sbjct: 21552 tccattccattccattccattca 21574 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Plus Query: 17 cattcctttccattccatt 35 ||||||||||||||||||| Sbjct: 17554 cattcctttccattccatt 17572 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Plus Query: 14 atccattcctttccattccattc 36 ||||||||| ||||||||||||| Sbjct: 16643 atccattccattccattccattc 16665 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Plus Query: 15 tccattcctttccattccattca 37 |||||||| |||||||||||||| Sbjct: 14455 tccattccattccattccattca 14477 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Plus Query: 18 attcctttccattccattc 36 ||||||||||||||||||| Sbjct: 12710 attcctttccattccattc 12728 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Plus Query: 14 atccattcctttccattccattc 36 |||||||| |||||||||||||| Sbjct: 11986 atccattcttttccattccattc 12008 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Plus Query: 14 atccattcctttccattccattc 36 ||||||||| ||||||||||||| Sbjct: 8554 atccattccattccattccattc 8576 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Plus Query: 14 atccattcctttccattccattc 36 |||||||||||||| |||||||| Sbjct: 8289 atccattcctttccgttccattc 8311 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Plus Query: 18 attcctttccattccattc 36 ||||||||||||||||||| Sbjct: 7358 attcctttccattccattc 7376 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Plus Query: 15 tccattcctttccattccattca 37 |||||||| |||||||||||||| Sbjct: 7320 tccattccattccattccattca 7342 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Plus Query: 15 tccattcctttccattccattca 37 |||||||| |||||||||||||| Sbjct: 7121 tccattccattccattccattca 7143 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Plus Query: 14 atccattcctttccattccattc 36 ||||||||||||||||| ||||| Sbjct: 6860 atccattcctttccattacattc 6882 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Plus Query: 14 atccattcctttccattccattc 36 ||||||||| ||||||||||||| Sbjct: 4145 atccattccattccattccattc 4167 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Plus Query: 14 atccattcctttccattccattc 36 ||||||||| ||||||||||||| Sbjct: 3010 atccattccattccattccattc 3032 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Plus Query: 15 tccattcctttccattccattca 37 |||||||| |||||||||||||| Sbjct: 1514 tccattccattccattccattca 1536
>gb|AF254982.4| Homo sapiens chromosome 21 clone CTD-2503J9 map p11-q21.1, complete sequence Length = 211345 Score = 48.1 bits (24), Expect = 0.003 Identities = 24/24 (100%) Strand = Plus / Minus Query: 13 gatccattcctttccattccattc 36 |||||||||||||||||||||||| Sbjct: 132733 gatccattcctttccattccattc 132710 Score = 48.1 bits (24), Expect = 0.003 Identities = 24/24 (100%) Strand = Plus / Minus Query: 15 tccattcctttccattccattcaa 38 |||||||||||||||||||||||| Sbjct: 121941 tccattcctttccattccattcaa 121918 Score = 48.1 bits (24), Expect = 0.003 Identities = 24/24 (100%) Strand = Plus / Minus Query: 15 tccattcctttccattccattcaa 38 |||||||||||||||||||||||| Sbjct: 118182 tccattcctttccattccattcaa 118159 Score = 46.1 bits (23), Expect = 0.013 Identities = 23/23 (100%) Strand = Plus / Minus Query: 14 atccattcctttccattccattc 36 ||||||||||||||||||||||| Sbjct: 84131 atccattcctttccattccattc 84109 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Minus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 160295 tccattcctttccattccattc 160274 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Minus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 159275 tccattcctttccattccattc 159254 Score = 44.1 bits (22), Expect = 0.050 Identities = 25/26 (96%) Strand = Plus / Minus Query: 14 atccattcctttccattccattcaaa 39 ||||||||| |||||||||||||||| Sbjct: 156134 atccattccattccattccattcaaa 156109 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Minus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 155078 tccattcctttccattccattc 155057 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Minus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 145368 tccattcctttccattccattc 145347 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Minus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 143551 tccattcctttccattccattc 143530 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Minus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 138910 tccattcctttccattccattc 138889 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Minus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 138496 tccattcctttccattccattc 138475 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Minus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 128817 tccattcctttccattccattc 128796 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Minus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 124760 tccattcctttccattccattc 124739 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Minus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 123066 tccattcctttccattccattc 123045 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Minus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 119518 tccattcctttccattccattc 119497 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Minus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 118542 tccattcctttccattccattc 118521 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Minus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 118282 tccattcctttccattccattc 118261 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Minus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 111235 tccattcctttccattccattc 111214 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Minus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 108382 tccattcctttccattccattc 108361 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Minus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 107782 tccattcctttccattccattc 107761 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Minus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 104403 tccattcctttccattccattc 104382 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Minus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 101237 tccattcctttccattccattc 101216 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Minus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 97532 tccattcctttccattccattc 97511 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Minus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 89417 tccattcctttccattccattc 89396 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Minus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 86554 tccattcctttccattccattc 86533 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Minus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 86484 tccattcctttccattccattc 86463 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Minus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 81826 tccattcctttccattccattc 81805 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Minus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 78580 tccattcctttccattccattc 78559 Score = 42.1 bits (21), Expect = 0.20 Identities = 21/21 (100%) Strand = Plus / Minus Query: 15 tccattcctttccattccatt 35 ||||||||||||||||||||| Sbjct: 155563 tccattcctttccattccatt 155543 Score = 42.1 bits (21), Expect = 0.20 Identities = 21/21 (100%) Strand = Plus / Minus Query: 18 attcctttccattccattcaa 38 ||||||||||||||||||||| Sbjct: 151723 attcctttccattccattcaa 151703 Score = 42.1 bits (21), Expect = 0.20 Identities = 21/21 (100%) Strand = Plus / Minus Query: 15 tccattcctttccattccatt 35 ||||||||||||||||||||| Sbjct: 133676 tccattcctttccattccatt 133656 Score = 42.1 bits (21), Expect = 0.20 Identities = 21/21 (100%) Strand = Plus / Minus Query: 16 ccattcctttccattccattc 36 ||||||||||||||||||||| Sbjct: 131327 ccattcctttccattccattc 131307 Score = 42.1 bits (21), Expect = 0.20 Identities = 21/21 (100%) Strand = Plus / Minus Query: 15 tccattcctttccattccatt 35 ||||||||||||||||||||| Sbjct: 127207 tccattcctttccattccatt 127187 Score = 42.1 bits (21), Expect = 0.20 Identities = 21/21 (100%) Strand = Plus / Minus Query: 15 tccattcctttccattccatt 35 ||||||||||||||||||||| Sbjct: 126079 tccattcctttccattccatt 126059 Score = 42.1 bits (21), Expect = 0.20 Identities = 24/25 (96%) Strand = Plus / Minus Query: 14 atccattcctttccattccattcaa 38 ||||||||| ||||||||||||||| Sbjct: 125600 atccattccattccattccattcaa 125576 Score = 42.1 bits (21), Expect = 0.20 Identities = 21/21 (100%) Strand = Plus / Minus Query: 15 tccattcctttccattccatt 35 ||||||||||||||||||||| Sbjct: 124675 tccattcctttccattccatt 124655 Score = 42.1 bits (21), Expect = 0.20 Identities = 24/25 (96%) Strand = Plus / Minus Query: 14 atccattcctttccattccattcaa 38 ||||||||| ||||||||||||||| Sbjct: 122627 atccattccattccattccattcaa 122603 Score = 42.1 bits (21), Expect = 0.20 Identities = 21/21 (100%) Strand = Plus / Minus Query: 15 tccattcctttccattccatt 35 ||||||||||||||||||||| Sbjct: 101332 tccattcctttccattccatt 101312 Score = 40.1 bits (20), Expect = 0.78 Identities = 23/24 (95%) Strand = Plus / Minus Query: 15 tccattcctttccattccattcaa 38 |||||||| ||||||||||||||| Sbjct: 161969 tccattccattccattccattcaa 161946 Score = 40.1 bits (20), Expect = 0.78 Identities = 23/24 (95%) Strand = Plus / Minus Query: 15 tccattcctttccattccattcaa 38 |||||||| ||||||||||||||| Sbjct: 160405 tccattccattccattccattcaa 160382 Score = 40.1 bits (20), Expect = 0.78 Identities = 23/24 (95%) Strand = Plus / Minus Query: 15 tccattcctttccattccattcaa 38 |||||||| ||||||||||||||| Sbjct: 158492 tccattccattccattccattcaa 158469 Score = 40.1 bits (20), Expect = 0.78 Identities = 23/24 (95%) Strand = Plus / Minus Query: 15 tccattcctttccattccattcaa 38 |||| ||||||||||||||||||| Sbjct: 158063 tccactcctttccattccattcaa 158040 Score = 40.1 bits (20), Expect = 0.78 Identities = 23/24 (95%) Strand = Plus / Minus Query: 15 tccattcctttccattccattcaa 38 |||||||| ||||||||||||||| Sbjct: 157858 tccattccattccattccattcaa 157835 Score = 40.1 bits (20), Expect = 0.78 Identities = 23/24 (95%) Strand = Plus / Minus Query: 15 tccattcctttccattccattcaa 38 |||||||| ||||||||||||||| Sbjct: 152164 tccattccattccattccattcaa 152141 Score = 40.1 bits (20), Expect = 0.78 Identities = 23/24 (95%) Strand = Plus / Minus Query: 15 tccattcctttccattccattcaa 38 |||||||| ||||||||||||||| Sbjct: 145573 tccattccattccattccattcaa 145550 Score = 40.1 bits (20), Expect = 0.78 Identities = 20/20 (100%) Strand = Plus / Minus Query: 19 ttcctttccattccattcaa 38 |||||||||||||||||||| Sbjct: 141982 ttcctttccattccattcaa 141963 Score = 40.1 bits (20), Expect = 0.78 Identities = 23/24 (95%) Strand = Plus / Minus Query: 15 tccattcctttccattccattcaa 38 |||| ||||||||||||||||||| Sbjct: 141786 tccaatcctttccattccattcaa 141763 Score = 40.1 bits (20), Expect = 0.78 Identities = 23/24 (95%) Strand = Plus / Minus Query: 15 tccattcctttccattccattcaa 38 |||||||| ||||||||||||||| Sbjct: 141556 tccattccattccattccattcaa 141533 Score = 40.1 bits (20), Expect = 0.78 Identities = 23/24 (95%) Strand = Plus / Minus Query: 15 tccattcctttccattccattcaa 38 |||||||||||| ||||||||||| Sbjct: 140952 tccattcctttcaattccattcaa 140929 Score = 40.1 bits (20), Expect = 0.78 Identities = 23/24 (95%) Strand = Plus / Minus Query: 15 tccattcctttccattccattcaa 38 |||||||| ||||||||||||||| Sbjct: 138017 tccattccattccattccattcaa 137994 Score = 40.1 bits (20), Expect = 0.78 Identities = 23/24 (95%) Strand = Plus / Minus Query: 15 tccattcctttccattccattcaa 38 |||||||| ||||||||||||||| Sbjct: 133131 tccattccattccattccattcaa 133108 Score = 40.1 bits (20), Expect = 0.78 Identities = 23/24 (95%) Strand = Plus / Minus Query: 15 tccattcctttccattccattcaa 38 |||||||| ||||||||||||||| Sbjct: 133101 tccattccgttccattccattcaa 133078 Score = 40.1 bits (20), Expect = 0.78 Identities = 23/24 (95%) Strand = Plus / Minus Query: 15 tccattcctttccattccattcaa 38 |||||||| ||||||||||||||| Sbjct: 126588 tccattccattccattccattcaa 126565 Score = 40.1 bits (20), Expect = 0.78 Identities = 23/24 (95%) Strand = Plus / Minus Query: 15 tccattcctttccattccattcaa 38 |||||||| ||||||||||||||| Sbjct: 126044 tccattccattccattccattcaa 126021 Score = 40.1 bits (20), Expect = 0.78 Identities = 20/20 (100%) Strand = Plus / Minus Query: 14 atccattcctttccattcca 33 |||||||||||||||||||| Sbjct: 125141 atccattcctttccattcca 125122 Score = 40.1 bits (20), Expect = 0.78 Identities = 20/20 (100%) Strand = Plus / Minus Query: 17 cattcctttccattccattc 36 |||||||||||||||||||| Sbjct: 124963 cattcctttccattccattc 124944 Score = 40.1 bits (20), Expect = 0.78 Identities = 23/24 (95%) Strand = Plus / Minus Query: 15 tccattcctttccattccattcaa 38 |||||||| ||||||||||||||| Sbjct: 124895 tccattccattccattccattcaa 124872 Score = 40.1 bits (20), Expect = 0.78 Identities = 23/24 (95%) Strand = Plus / Minus Query: 15 tccattcctttccattccattcaa 38 |||||||| ||||||||||||||| Sbjct: 124730 tccattccattccattccattcaa 124707 Score = 40.1 bits (20), Expect = 0.78 Identities = 20/20 (100%) Strand = Plus / Minus Query: 15 tccattcctttccattccat 34 |||||||||||||||||||| Sbjct: 117700 tccattcctttccattccat 117681 Score = 40.1 bits (20), Expect = 0.78 Identities = 23/24 (95%) Strand = Plus / Minus Query: 15 tccattcctttccattccattcaa 38 |||||||||| ||||||||||||| Sbjct: 113738 tccattccttcccattccattcaa 113715 Score = 40.1 bits (20), Expect = 0.78 Identities = 20/20 (100%) Strand = Plus / Minus Query: 15 tccattcctttccattccat 34 |||||||||||||||||||| Sbjct: 89202 tccattcctttccattccat 89183 Score = 40.1 bits (20), Expect = 0.78 Identities = 23/24 (95%) Strand = Plus / Minus Query: 15 tccattcctttccattccattcaa 38 |||||||| ||||||||||||||| Sbjct: 87493 tccattccattccattccattcaa 87470 Score = 40.1 bits (20), Expect = 0.78 Identities = 23/24 (95%) Strand = Plus / Minus Query: 15 tccattcctttccattccattcaa 38 |||||||| ||||||||||||||| Sbjct: 84435 tccattccattccattccattcaa 84412 Score = 40.1 bits (20), Expect = 0.78 Identities = 23/24 (95%) Strand = Plus / Minus Query: 15 tccattcctttccattccattcaa 38 |||||| ||||||||||||||||| Sbjct: 78880 tccatttctttccattccattcaa 78857 Score = 40.1 bits (20), Expect = 0.78 Identities = 23/24 (95%) Strand = Plus / Minus Query: 15 tccattcctttccattccattcaa 38 ||||||| |||||||||||||||| Sbjct: 78745 tccattcgtttccattccattcaa 78722 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Minus Query: 16 ccattcctttccattccattcaa 38 ||||||| ||||||||||||||| Sbjct: 162238 ccattcccttccattccattcaa 162216 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Minus Query: 18 attcctttccattccattc 36 ||||||||||||||||||| Sbjct: 154405 attcctttccattccattc 154387 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Minus Query: 18 attcctttccattccattc 36 ||||||||||||||||||| Sbjct: 153650 attcctttccattccattc 153632 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Minus Query: 18 attcctttccattccattc 36 ||||||||||||||||||| Sbjct: 151184 attcctttccattccattc 151166 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Minus Query: 18 attcctttccattccattc 36 ||||||||||||||||||| Sbjct: 148187 attcctttccattccattc 148169 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Minus Query: 14 atccattcctttccattccattc 36 ||||||||| ||||||||||||| Sbjct: 147371 atccattccattccattccattc 147349 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Minus Query: 15 tccattcctttccattccattca 37 |||||||| |||||||||||||| Sbjct: 147180 tccattccattccattccattca 147158 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Minus Query: 14 atccattcctttccattccattc 36 ||||||||| ||||||||||||| Sbjct: 146627 atccattccattccattccattc 146605 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Minus Query: 15 tccattcctttccattccattca 37 |||||||| |||||||||||||| Sbjct: 146326 tccattccattccattccattca 146304 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Minus Query: 18 attcctttccattccattc 36 ||||||||||||||||||| Sbjct: 145550 attcctttccattccattc 145532 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Minus Query: 14 atccattcctttccattccattc 36 ||||||||| ||||||||||||| Sbjct: 142077 atccattccattccattccattc 142055 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Minus Query: 14 atccattcctttccattccattc 36 ||||||||| ||||||||||||| Sbjct: 141003 atccattccattccattccattc 140981 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Minus Query: 14 atccattcctttccattccattc 36 ||||||||| ||||||||||||| Sbjct: 140069 atccattccattccattccattc 140047 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Minus Query: 14 atccattcctttccattccattc 36 ||||||||| ||||||||||||| Sbjct: 137197 atccattccattccattccattc 137175 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Minus Query: 14 atccattcctttccattccattc 36 ||||||||| ||||||||||||| Sbjct: 135574 atccattccattccattccattc 135552 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Minus Query: 15 tccattcctttccattccattca 37 |||||||||||||||||| |||| Sbjct: 134683 tccattcctttccattcctttca 134661 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Minus Query: 14 atccattcctttccattccattc 36 ||||||||| ||||||||||||| Sbjct: 129903 atccattccattccattccattc 129881 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Minus Query: 14 atccattcctttccattcc 32 ||||||||||||||||||| Sbjct: 128039 atccattcctttccattcc 128021 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Minus Query: 14 atccattcctttccattccattc 36 ||||||||| ||||||||||||| Sbjct: 125920 atccattccattccattccattc 125898 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Minus Query: 14 atccattcctttccattccattc 36 ||||||||| ||||||||||||| Sbjct: 124511 atccattccattccattccattc 124489 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Minus Query: 14 atccattcctttccattccattc 36 ||||||||| ||||||||||||| Sbjct: 122682 atccattccattccattccattc 122660 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Minus Query: 15 tccattcctttccattccattca 37 |||||||| |||||||||||||| Sbjct: 119712 tccattccattccattccattca 119690 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Minus Query: 18 attcctttccattccattc 36 ||||||||||||||||||| Sbjct: 119619 attcctttccattccattc 119601 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Minus Query: 15 tccattcctttccattccattca 37 |||||||| |||||||||||||| Sbjct: 117451 tccattccattccattccattca 117429 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Minus Query: 14 atccattcctttccattccattc 36 ||||||||| ||||||||||||| Sbjct: 117362 atccattccattccattccattc 117340 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Minus Query: 18 attcctttccattccattc 36 ||||||||||||||||||| Sbjct: 115938 attcctttccattccattc 115920 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Minus Query: 14 atccattcctttccattccattc 36 ||||||||| ||||||||||||| Sbjct: 115378 atccattccgttccattccattc 115356 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Minus Query: 14 atccattcctttccattccattc 36 |||||||||| |||||||||||| Sbjct: 105824 atccattcctgtccattccattc 105802 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Minus Query: 15 tccattcctttccattcca 33 ||||||||||||||||||| Sbjct: 100337 tccattcctttccattcca 100319 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Minus Query: 14 atccattcctttccattccattc 36 ||||||||| ||||||||||||| Sbjct: 91434 atccattccattccattccattc 91412 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Minus Query: 18 attcctttccattccattc 36 ||||||||||||||||||| Sbjct: 77009 attcctttccattccattc 76991
>emb|AL590623.16| Human DNA sequence from clone RP11-96F8 on chromosome 10 Contains a N-acetylated alpha-linked acidic dipeptidase 2 (NAALAD2) pseudogene, complete sequence Length = 81908 Score = 48.1 bits (24), Expect = 0.003 Identities = 24/24 (100%) Strand = Plus / Plus Query: 13 gatccattcctttccattccattc 36 |||||||||||||||||||||||| Sbjct: 21785 gatccattcctttccattccattc 21808 Score = 46.1 bits (23), Expect = 0.013 Identities = 23/23 (100%) Strand = Plus / Minus Query: 15 tccattcctttccattccattca 37 ||||||||||||||||||||||| Sbjct: 43553 tccattcctttccattccattca 43531 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Minus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 74705 tccattcctttccattccattc 74684 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Minus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 62977 tccattcctttccattccattc 62956 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Minus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 60138 tccattcctttccattccattc 60117 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Minus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 57556 tccattcctttccattccattc 57535 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Minus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 57153 tccattcctttccattccattc 57132 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Minus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 54578 tccattcctttccattccattc 54557 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Minus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 53654 tccattcctttccattccattc 53633 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Plus Query: 17 cattcctttccattccattcaa 38 |||||||||||||||||||||| Sbjct: 32082 cattcctttccattccattcaa 32103 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Plus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 30981 tccattcctttccattccattc 31002 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Plus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 30361 tccattcctttccattccattc 30382 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Plus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 29462 tccattcctttccattccattc 29483 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Plus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 26335 tccattcctttccattccattc 26356 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Plus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 23533 tccattcctttccattccattc 23554 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Plus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 21188 tccattcctttccattccattc 21209 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Plus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 15445 tccattcctttccattccattc 15466 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Plus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 15425 tccattcctttccattccattc 15446 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Plus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 9515 tccattcctttccattccattc 9536 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Plus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 6482 tccattcctttccattccattc 6503 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Plus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 515 tccattcctttccattccattc 536 Score = 42.1 bits (21), Expect = 0.20 Identities = 21/21 (100%) Strand = Plus / Minus Query: 19 ttcctttccattccattcaaa 39 ||||||||||||||||||||| Sbjct: 77230 ttcctttccattccattcaaa 77210 Score = 42.1 bits (21), Expect = 0.20 Identities = 24/25 (96%) Strand = Plus / Minus Query: 14 atccattcctttccattccattcaa 38 ||||||||| ||||||||||||||| Sbjct: 67589 atccattccattccattccattcaa 67565 Score = 42.1 bits (21), Expect = 0.20 Identities = 21/21 (100%) Strand = Plus / Minus Query: 15 tccattcctttccattccatt 35 ||||||||||||||||||||| Sbjct: 64949 tccattcctttccattccatt 64929 Score = 42.1 bits (21), Expect = 0.20 Identities = 21/21 (100%) Strand = Plus / Minus Query: 15 tccattcctttccattccatt 35 ||||||||||||||||||||| Sbjct: 55908 tccattcctttccattccatt 55888 Score = 42.1 bits (21), Expect = 0.20 Identities = 21/21 (100%) Strand = Plus / Minus Query: 15 tccattcctttccattccatt 35 ||||||||||||||||||||| Sbjct: 49944 tccattcctttccattccatt 49924 Score = 42.1 bits (21), Expect = 0.20 Identities = 21/21 (100%) Strand = Plus / Plus Query: 15 tccattcctttccattccatt 35 ||||||||||||||||||||| Sbjct: 32989 tccattcctttccattccatt 33009 Score = 40.1 bits (20), Expect = 0.78 Identities = 23/24 (95%) Strand = Plus / Minus Query: 15 tccattcctttccattccattcaa 38 |||||||||||| ||||||||||| Sbjct: 62663 tccattcctttcgattccattcaa 62640 Score = 40.1 bits (20), Expect = 0.78 Identities = 20/20 (100%) Strand = Plus / Minus Query: 15 tccattcctttccattccat 34 |||||||||||||||||||| Sbjct: 56588 tccattcctttccattccat 56569 Score = 40.1 bits (20), Expect = 0.78 Identities = 23/24 (95%) Strand = Plus / Minus Query: 15 tccattcctttccattccattcaa 38 ||||||| |||||||||||||||| Sbjct: 45928 tccattcgtttccattccattcaa 45905 Score = 40.1 bits (20), Expect = 0.78 Identities = 23/24 (95%) Strand = Plus / Plus Query: 15 tccattcctttccattccattcaa 38 |||||||| ||||||||||||||| Sbjct: 39700 tccattccattccattccattcaa 39723 Score = 40.1 bits (20), Expect = 0.78 Identities = 20/20 (100%) Strand = Plus / Plus Query: 18 attcctttccattccattca 37 |||||||||||||||||||| Sbjct: 38689 attcctttccattccattca 38708 Score = 40.1 bits (20), Expect = 0.78 Identities = 23/24 (95%) Strand = Plus / Plus Query: 15 tccattcctttccattccattcaa 38 |||||||| ||||||||||||||| Sbjct: 33642 tccattccattccattccattcaa 33665 Score = 40.1 bits (20), Expect = 0.78 Identities = 23/24 (95%) Strand = Plus / Plus Query: 15 tccattcctttccattccattcaa 38 |||||||| ||||||||||||||| Sbjct: 28997 tccattccattccattccattcaa 29020 Score = 40.1 bits (20), Expect = 0.78 Identities = 23/24 (95%) Strand = Plus / Plus Query: 15 tccattcctttccattccattcaa 38 |||| ||||||||||||||||||| Sbjct: 28657 tccagtcctttccattccattcaa 28680 Score = 40.1 bits (20), Expect = 0.78 Identities = 20/20 (100%) Strand = Plus / Plus Query: 18 attcctttccattccattca 37 |||||||||||||||||||| Sbjct: 24581 attcctttccattccattca 24600 Score = 40.1 bits (20), Expect = 0.78 Identities = 20/20 (100%) Strand = Plus / Plus Query: 17 cattcctttccattccattc 36 |||||||||||||||||||| Sbjct: 21585 cattcctttccattccattc 21604 Score = 40.1 bits (20), Expect = 0.78 Identities = 23/24 (95%) Strand = Plus / Plus Query: 15 tccattcctttccattccattcaa 38 |||||||| ||||||||||||||| Sbjct: 8010 tccattccattccattccattcaa 8033 Score = 40.1 bits (20), Expect = 0.78 Identities = 23/24 (95%) Strand = Plus / Plus Query: 15 tccattcctttccattccattcaa 38 |||||||| ||||||||||||||| Sbjct: 4092 tccattccgttccattccattcaa 4115 Score = 40.1 bits (20), Expect = 0.78 Identities = 23/24 (95%) Strand = Plus / Plus Query: 15 tccattcctttccattccattcaa 38 |||||||| ||||||||||||||| Sbjct: 2328 tccattccattccattccattcaa 2351 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Minus Query: 18 attcctttccattccattc 36 ||||||||||||||||||| Sbjct: 76511 attcctttccattccattc 76493 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Minus Query: 17 cattcctttccattccattcaaa 39 ||||| ||||||||||||||||| Sbjct: 74878 cattcgtttccattccattcaaa 74856 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Minus Query: 18 attcctttccattccattc 36 ||||||||||||||||||| Sbjct: 73279 attcctttccattccattc 73261 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Minus Query: 18 attcctttccattccattc 36 ||||||||||||||||||| Sbjct: 73099 attcctttccattccattc 73081 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Minus Query: 18 attcctttccattccattc 36 ||||||||||||||||||| Sbjct: 72140 attcctttccattccattc 72122 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Minus Query: 15 tccattcctttccattccattca 37 |||||||| |||||||||||||| Sbjct: 70483 tccattccattccattccattca 70461 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Minus Query: 14 atccattcctttccattccattc 36 ||||||||| ||||||||||||| Sbjct: 70066 atccattccattccattccattc 70044 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Minus Query: 18 attcctttccattccattc 36 ||||||||||||||||||| Sbjct: 62485 attcctttccattccattc 62467 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Minus Query: 15 tccattcctttccattccattca 37 ||||||| ||||||||||||||| Sbjct: 61838 tccattcatttccattccattca 61816 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Minus Query: 18 attcctttccattccattc 36 ||||||||||||||||||| Sbjct: 58737 attcctttccattccattc 58719 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Minus Query: 18 attcctttccattccattc 36 ||||||||||||||||||| Sbjct: 55920 attcctttccattccattc 55902 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Minus Query: 18 attcctttccattccattc 36 ||||||||||||||||||| Sbjct: 55454 attcctttccattccattc 55436 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Minus Query: 18 attcctttccattccattc 36 ||||||||||||||||||| Sbjct: 52738 attcctttccattccattc 52720 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Minus Query: 17 cattcctttccattccatt 35 ||||||||||||||||||| Sbjct: 50855 cattcctttccattccatt 50837 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Minus Query: 15 tccattcctttccattccattca 37 |||||||||||||||| |||||| Sbjct: 48433 tccattcctttccatttcattca 48411 Score = 38.2 bits (19), Expect = 3.1 Identities = 25/27 (92%) Strand = Plus / Minus Query: 12 cgatccattcctttccattccattcaa 38 ||||||||||||||| ||||| ||||| Sbjct: 42496 cgatccattcctttcgattccgttcaa 42470 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Plus Query: 18 attcctttccattccattc 36 ||||||||||||||||||| Sbjct: 39863 attcctttccattccattc 39881 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Plus Query: 15 tccattcctttccattccattca 37 |||||||||||||| |||||||| Sbjct: 38726 tccattcctttccactccattca 38748 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Plus Query: 14 atccattcctttccattccattc 36 ||||||||| ||||||||||||| Sbjct: 38635 atccattccattccattccattc 38657 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Plus Query: 18 attcctttccattccattc 36 ||||||||||||||||||| Sbjct: 36367 attcctttccattccattc 36385 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Plus Query: 18 attcctttccattccattc 36 ||||||||||||||||||| Sbjct: 34583 attcctttccattccattc 34601 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Plus Query: 18 attcctttccattccattc 36 ||||||||||||||||||| Sbjct: 31698 attcctttccattccattc 31716 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Plus Query: 18 attcctttccattccattc 36 ||||||||||||||||||| Sbjct: 30114 attcctttccattccattc 30132 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Plus Query: 18 attcctttccattccattc 36 ||||||||||||||||||| Sbjct: 21676 attcctttccattccattc 21694 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Plus Query: 18 attcctttccattccattc 36 ||||||||||||||||||| Sbjct: 20841 attcctttccattccattc 20859 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Plus Query: 15 tccattcctttccattccattca 37 ||||||| ||||||||||||||| Sbjct: 19658 tccattcgtttccattccattca 19680 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Plus Query: 15 tccattcctttccattccattca 37 |||||||| |||||||||||||| Sbjct: 17700 tccattccattccattccattca 17722 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Plus Query: 15 tccattcctttccattccattca 37 |||||||| |||||||||||||| Sbjct: 17655 tccattccattccattccattca 17677 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Plus Query: 17 cattcctttccattccatt 35 ||||||||||||||||||| Sbjct: 13724 cattcctttccattccatt 13742 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Plus Query: 18 attcctttccattccattc 36 ||||||||||||||||||| Sbjct: 11057 attcctttccattccattc 11075 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Plus Query: 18 attcctttccattccattc 36 ||||||||||||||||||| Sbjct: 10298 attcctttccattccattc 10316 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Plus Query: 18 attcctttccattccattc 36 ||||||||||||||||||| Sbjct: 9993 attcctttccattccattc 10011 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Plus Query: 14 atccattcctttccattccattc 36 ||||||||||||| ||||||||| Sbjct: 7405 atccattcctttcgattccattc 7427 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Plus Query: 14 atccattcctttccattcc 32 ||||||||||||||||||| Sbjct: 6826 atccattcctttccattcc 6844 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Plus Query: 18 attcctttccattccattc 36 ||||||||||||||||||| Sbjct: 6695 attcctttccattccattc 6713 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Plus Query: 18 attcctttccattccattc 36 ||||||||||||||||||| Sbjct: 4897 attcctttccattccattc 4915 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Plus Query: 18 attcctttccattccattc 36 ||||||||||||||||||| Sbjct: 4369 attcctttccattccattc 4387 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Plus Query: 18 attcctttccattccattc 36 ||||||||||||||||||| Sbjct: 2426 attcctttccattccattc 2444 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Plus Query: 18 attcctttccattccattc 36 ||||||||||||||||||| Sbjct: 1551 attcctttccattccattc 1569 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Plus Query: 17 cattcctttccattccatt 35 ||||||||||||||||||| Sbjct: 1096 cattcctttccattccatt 1114
>emb|AL133216.10| Human DNA sequence from clone RP11-291L22 on chromosome 10 Contains the 3' end of a gene for a novel protein similar to 17-beta-hydroxysteroid dehydrogenase type 7 (HSD17B7), the gene for a novel protein similar to CDC10 cell division cycle 10, homolog (S. cerevisiae) (CDC10), a novel gene, a novel gene containing FLJ14186, a capicua homolog (Drosophila) (CIC) pseudogene and a CpG island, complete sequence Length = 166835 Score = 48.1 bits (24), Expect = 0.003 Identities = 24/24 (100%) Strand = Plus / Minus Query: 15 tccattcctttccattccattcaa 38 |||||||||||||||||||||||| Sbjct: 134600 tccattcctttccattccattcaa 134577 Score = 46.1 bits (23), Expect = 0.013 Identities = 23/23 (100%) Strand = Plus / Minus Query: 14 atccattcctttccattccattc 36 ||||||||||||||||||||||| Sbjct: 165963 atccattcctttccattccattc 165941 Score = 46.1 bits (23), Expect = 0.013 Identities = 23/23 (100%) Strand = Plus / Minus Query: 14 atccattcctttccattccattc 36 ||||||||||||||||||||||| Sbjct: 155717 atccattcctttccattccattc 155695 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Minus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 163054 tccattcctttccattccattc 163033 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Minus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 162697 tccattcctttccattccattc 162676 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Minus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 159439 tccattcctttccattccattc 159418 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Minus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 146613 tccattcctttccattccattc 146592 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Minus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 146463 tccattcctttccattccattc 146442 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Minus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 140146 tccattcctttccattccattc 140125 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Minus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 137567 tccattcctttccattccattc 137546 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Minus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 134650 tccattcctttccattccattc 134629 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Minus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 133790 tccattcctttccattccattc 133769 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Minus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 130110 tccattcctttccattccattc 130089 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Minus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 130000 tccattcctttccattccattc 129979 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Minus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 128692 tccattcctttccattccattc 128671 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Minus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 124785 tccattcctttccattccattc 124764 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Minus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 122240 tccattcctttccattccattc 122219 Score = 42.1 bits (21), Expect = 0.20 Identities = 21/21 (100%) Strand = Plus / Minus Query: 16 ccattcctttccattccattc 36 ||||||||||||||||||||| Sbjct: 151277 ccattcctttccattccattc 151257 Score = 42.1 bits (21), Expect = 0.20 Identities = 21/21 (100%) Strand = Plus / Minus Query: 15 tccattcctttccattccatt 35 ||||||||||||||||||||| Sbjct: 144827 tccattcctttccattccatt 144807 Score = 42.1 bits (21), Expect = 0.20 Identities = 21/21 (100%) Strand = Plus / Minus Query: 16 ccattcctttccattccattc 36 ||||||||||||||||||||| Sbjct: 144398 ccattcctttccattccattc 144378 Score = 42.1 bits (21), Expect = 0.20 Identities = 21/21 (100%) Strand = Plus / Minus Query: 16 ccattcctttccattccattc 36 ||||||||||||||||||||| Sbjct: 139445 ccattcctttccattccattc 139425 Score = 42.1 bits (21), Expect = 0.20 Identities = 21/21 (100%) Strand = Plus / Minus Query: 16 ccattcctttccattccattc 36 ||||||||||||||||||||| Sbjct: 139325 ccattcctttccattccattc 139305 Score = 42.1 bits (21), Expect = 0.20 Identities = 21/21 (100%) Strand = Plus / Minus Query: 16 ccattcctttccattccattc 36 ||||||||||||||||||||| Sbjct: 132553 ccattcctttccattccattc 132533 Score = 42.1 bits (21), Expect = 0.20 Identities = 21/21 (100%) Strand = Plus / Minus Query: 15 tccattcctttccattccatt 35 ||||||||||||||||||||| Sbjct: 125843 tccattcctttccattccatt 125823 Score = 42.1 bits (21), Expect = 0.20 Identities = 21/21 (100%) Strand = Plus / Minus Query: 15 tccattcctttccattccatt 35 ||||||||||||||||||||| Sbjct: 124002 tccattcctttccattccatt 123982 Score = 42.1 bits (21), Expect = 0.20 Identities = 24/25 (96%) Strand = Plus / Minus Query: 15 tccattcctttccattccattcaaa 39 |||||||| |||||||||||||||| Sbjct: 122130 tccattccattccattccattcaaa 122106 Score = 42.1 bits (21), Expect = 0.20 Identities = 21/21 (100%) Strand = Plus / Minus Query: 15 tccattcctttccattccatt 35 ||||||||||||||||||||| Sbjct: 121915 tccattcctttccattccatt 121895 Score = 42.1 bits (21), Expect = 0.20 Identities = 21/21 (100%) Strand = Plus / Minus Query: 15 tccattcctttccattccatt 35 ||||||||||||||||||||| Sbjct: 120870 tccattcctttccattccatt 120850 Score = 42.1 bits (21), Expect = 0.20 Identities = 21/21 (100%) Strand = Plus / Minus Query: 19 ttcctttccattccattcaaa 39 ||||||||||||||||||||| Sbjct: 120776 ttcctttccattccattcaaa 120756 Score = 40.1 bits (20), Expect = 0.78 Identities = 20/20 (100%) Strand = Plus / Minus Query: 15 tccattcctttccattccat 34 |||||||||||||||||||| Sbjct: 164179 tccattcctttccattccat 164160 Score = 40.1 bits (20), Expect = 0.78 Identities = 23/24 (95%) Strand = Plus / Minus Query: 15 tccattcctttccattccattcaa 38 ||||| |||||||||||||||||| Sbjct: 161317 tccatacctttccattccattcaa 161294 Score = 40.1 bits (20), Expect = 0.78 Identities = 23/24 (95%) Strand = Plus / Minus Query: 13 gatccattcctttccattccattc 36 |||||||||| ||||||||||||| Sbjct: 152493 gatccattccattccattccattc 152470 Score = 40.1 bits (20), Expect = 0.78 Identities = 23/24 (95%) Strand = Plus / Minus Query: 15 tccattcctttccattccattcaa 38 |||||||| ||||||||||||||| Sbjct: 151686 tccattccattccattccattcaa 151663 Score = 40.1 bits (20), Expect = 0.78 Identities = 23/24 (95%) Strand = Plus / Minus Query: 15 tccattcctttccattccattcaa 38 ||||||||||||||||| |||||| Sbjct: 149460 tccattcctttccattctattcaa 149437 Score = 40.1 bits (20), Expect = 0.78 Identities = 23/24 (95%) Strand = Plus / Minus Query: 16 ccattcctttccattccattcaaa 39 ||||||| |||||||||||||||| Sbjct: 146582 ccattccattccattccattcaaa 146559 Score = 40.1 bits (20), Expect = 0.78 Identities = 23/24 (95%) Strand = Plus / Minus Query: 15 tccattcctttccattccattcaa 38 |||||||| ||||||||||||||| Sbjct: 139436 tccattccattccattccattcaa 139413 Score = 40.1 bits (20), Expect = 0.78 Identities = 20/20 (100%) Strand = Plus / Minus Query: 17 cattcctttccattccattc 36 |||||||||||||||||||| Sbjct: 133445 cattcctttccattccattc 133426 Score = 40.1 bits (20), Expect = 0.78 Identities = 20/20 (100%) Strand = Plus / Minus Query: 17 cattcctttccattccattc 36 |||||||||||||||||||| Sbjct: 129574 cattcctttccattccattc 129555 Score = 40.1 bits (20), Expect = 0.78 Identities = 23/24 (95%) Strand = Plus / Minus Query: 15 tccattcctttccattccattcaa 38 |||||||| ||||||||||||||| Sbjct: 126462 tccattccattccattccattcaa 126439 Score = 40.1 bits (20), Expect = 0.78 Identities = 23/24 (95%) Strand = Plus / Minus Query: 15 tccattcctttccattccattcaa 38 |||||||| ||||||||||||||| Sbjct: 123717 tccattccattccattccattcaa 123694 Score = 40.1 bits (20), Expect = 0.78 Identities = 20/20 (100%) Strand = Plus / Minus Query: 19 ttcctttccattccattcaa 38 |||||||||||||||||||| Sbjct: 120736 ttcctttccattccattcaa 120717 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Minus Query: 18 attcctttccattccattc 36 ||||||||||||||||||| Sbjct: 164351 attcctttccattccattc 164333 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Minus Query: 17 cattcctttccattccattcaaa 39 |||||| |||||||||||||||| Sbjct: 162475 cattccattccattccattcaaa 162453 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Minus Query: 15 tccattcctttccattcca 33 ||||||||||||||||||| Sbjct: 161212 tccattcctttccattcca 161194 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Minus Query: 15 tccattcctttccattccattca 37 |||||||| |||||||||||||| Sbjct: 158659 tccattccattccattccattca 158637 Score = 38.2 bits (19), Expect = 3.1 Identities = 25/27 (92%) Strand = Plus / Minus Query: 12 cgatccattcctttccattccattcaa 38 ||||||||||||||| |||||||||| Sbjct: 158317 cgatccattcctttctcttccattcaa 158291 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Minus Query: 14 atccattcctttccattccattc 36 ||||||||| ||||||||||||| Sbjct: 156863 atccattccattccattccattc 156841 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Minus Query: 14 atccattcctttccattccattc 36 ||||||||| ||||||||||||| Sbjct: 156613 atccattccattccattccattc 156591 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Minus Query: 15 tccattcctttccattcca 33 ||||||||||||||||||| Sbjct: 156192 tccattcctttccattcca 156174 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Minus Query: 15 tccattcctttccattcca 33 ||||||||||||||||||| Sbjct: 151253 tccattcctttccattcca 151235 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Minus Query: 18 attcctttccattccattc 36 ||||||||||||||||||| Sbjct: 145433 attcctttccattccattc 145415 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Minus Query: 15 tccattcctttccattccattca 37 |||||||| |||||||||||||| Sbjct: 137092 tccattccattccattccattca 137070 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Minus Query: 15 tccattcctttccattccattca 37 |||||||| |||||||||||||| Sbjct: 135049 tccattccattccattccattca 135027 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Minus Query: 18 attcctttccattccattc 36 ||||||||||||||||||| Sbjct: 134552 attcctttccattccattc 134534 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Minus Query: 14 atccattcctttccattccattc 36 ||||||||| ||||||||||||| Sbjct: 133950 atccattcccttccattccattc 133928 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Minus Query: 18 attcctttccattccattc 36 ||||||||||||||||||| Sbjct: 132466 attcctttccattccattc 132448 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Minus Query: 14 atccattcctttccattccattc 36 ||||||||| ||||||||||||| Sbjct: 130231 atccattccattccattccattc 130209 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Minus Query: 18 attcctttccattccattc 36 ||||||||||||||||||| Sbjct: 130077 attcctttccattccattc 130059 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Minus Query: 17 cattcctttccattccatt 35 ||||||||||||||||||| Sbjct: 129724 cattcctttccattccatt 129706 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Minus Query: 15 tccattcctttccattccattca 37 |||||||| |||||||||||||| Sbjct: 126717 tccattccattccattccattca 126695 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Minus Query: 14 atccattcctttccattccattc 36 |||||||||||||| |||||||| Sbjct: 126258 atccattcctttcctttccattc 126236 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Minus Query: 18 attcctttccattccattc 36 ||||||||||||||||||| Sbjct: 126224 attcctttccattccattc 126206 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Minus Query: 18 attcctttccattccattc 36 ||||||||||||||||||| Sbjct: 125984 attcctttccattccattc 125966 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Minus Query: 14 atccattcctttccattccattc 36 ||||||||| ||||||||||||| Sbjct: 125928 atccattccattccattccattc 125906 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Minus Query: 14 atccattcctttccattccattc 36 ||||||||| ||||||||||||| Sbjct: 121516 atccattccattccattccattc 121494 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Minus Query: 14 atccattcctttccattcc 32 ||||||||||||||||||| Sbjct: 120641 atccattcctttccattcc 120623
>emb|AL031601.4|HSY237C10 Human DNA sequence from clone XX-Y237C10 on chromosome 10 Contains a poly(A) binding protein, cytoplasmic 1 (PABPC1) pseudogene, an Ig kappa chain precursor V region pseudogene, a pseudogene similar to part of kinase suppressor of ras (KSR) and four CpG islands, complete sequence Length = 197700 Score = 48.1 bits (24), Expect = 0.003 Identities = 24/24 (100%) Strand = Plus / Plus Query: 15 tccattcctttccattccattcaa 38 |||||||||||||||||||||||| Sbjct: 194941 tccattcctttccattccattcaa 194964 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Plus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 195586 tccattcctttccattccattc 195607 Score = 42.1 bits (21), Expect = 0.20 Identities = 24/25 (96%) Strand = Plus / Plus Query: 15 tccattcctttccattccattcaaa 39 |||||||| |||||||||||||||| Sbjct: 195026 tccattccattccattccattcaaa 195050 Score = 40.1 bits (20), Expect = 0.78 Identities = 23/24 (95%) Strand = Plus / Plus Query: 15 tccattcctttccattccattcaa 38 |||||||| ||||||||||||||| Sbjct: 196025 tccattccattccattccattcaa 196048 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Plus Query: 15 tccattcctttccattccattca 37 |||||||| |||||||||||||| Sbjct: 197214 tccattccattccattccattca 197236 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Plus Query: 14 atccattcctttccattccattc 36 ||||||||| ||||||||||||| Sbjct: 194445 atccattccattccattccattc 194467 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Plus Query: 14 atccattcctttccattccattc 36 ||||||||| ||||||||||||| Sbjct: 194065 atccattccattccattccattc 194087 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Plus Query: 15 tccattcctttccattccattca 37 |||||||| |||||||||||||| Sbjct: 193887 tccattccattccattccattca 193909 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Minus Query: 18 attcctttccattccattcaaag 40 ||||||||| ||||||||||||| Sbjct: 69525 attcctttcgattccattcaaag 69503
>emb|X65995.1|HSSAT5 H.sapiens satellite DNA (5bp) Length = 191 Score = 48.1 bits (24), Expect = 0.003 Identities = 24/24 (100%) Strand = Plus / Minus Query: 15 tccattcctttccattccattcaa 38 |||||||||||||||||||||||| Sbjct: 172 tccattcctttccattccattcaa 149
>dbj|BS000684.1| Pan troglodytes chromosome Y clone:PTFY-044G21, complete sequences Length = 17311 Score = 48.1 bits (24), Expect = 0.003 Identities = 24/24 (100%) Strand = Plus / Minus Query: 15 tccattcctttccattccattcaa 38 |||||||||||||||||||||||| Sbjct: 1901 tccattcctttccattccattcaa 1878 Score = 46.1 bits (23), Expect = 0.013 Identities = 23/23 (100%) Strand = Plus / Minus Query: 14 atccattcctttccattccattc 36 ||||||||||||||||||||||| Sbjct: 12176 atccattcctttccattccattc 12154 Score = 46.1 bits (23), Expect = 0.013 Identities = 23/23 (100%) Strand = Plus / Minus Query: 16 ccattcctttccattccattcaa 38 ||||||||||||||||||||||| Sbjct: 7909 ccattcctttccattccattcaa 7887 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Minus Query: 15 tccattcctttccattcca 33 ||||||||||||||||||| Sbjct: 11353 tccattcctttccattcca 11335 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Minus Query: 15 tccattcctttccattcca 33 ||||||||||||||||||| Sbjct: 3004 tccattcctttccattcca 2986 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Minus Query: 15 tccattcctttccattcca 33 ||||||||||||||||||| Sbjct: 1029 tccattcctttccattcca 1011
>gb|AC022370.28| Homo sapiens chromosome UL clone RP11-22O10, complete sequence Length = 179013 Score = 48.1 bits (24), Expect = 0.003 Identities = 24/24 (100%) Strand = Plus / Plus Query: 15 tccattcctttccattccattcaa 38 |||||||||||||||||||||||| Sbjct: 33061 tccattcctttccattccattcaa 33084 Score = 48.1 bits (24), Expect = 0.003 Identities = 24/24 (100%) Strand = Plus / Plus Query: 15 tccattcctttccattccattcaa 38 |||||||||||||||||||||||| Sbjct: 32596 tccattcctttccattccattcaa 32619 Score = 48.1 bits (24), Expect = 0.003 Identities = 24/24 (100%) Strand = Plus / Plus Query: 15 tccattcctttccattccattcaa 38 |||||||||||||||||||||||| Sbjct: 19922 tccattcctttccattccattcaa 19945 Score = 48.1 bits (24), Expect = 0.003 Identities = 24/24 (100%) Strand = Plus / Plus Query: 15 tccattcctttccattccattcaa 38 |||||||||||||||||||||||| Sbjct: 19042 tccattcctttccattccattcaa 19065 Score = 46.1 bits (23), Expect = 0.013 Identities = 23/23 (100%) Strand = Plus / Plus Query: 15 tccattcctttccattccattca 37 ||||||||||||||||||||||| Sbjct: 21835 tccattcctttccattccattca 21857 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Plus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 34240 tccattcctttccattccattc 34261 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Plus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 33526 tccattcctttccattccattc 33547 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Plus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 20467 tccattcctttccattccattc 20488 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Plus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 19642 tccattcctttccattccattc 19663 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Plus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 11551 tccattcctttccattccattc 11572 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Plus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 2320 tccattcctttccattccattc 2341 Score = 42.1 bits (21), Expect = 0.20 Identities = 24/25 (96%) Strand = Plus / Plus Query: 14 atccattcctttccattccattcaa 38 ||||||||| ||||||||||||||| Sbjct: 27105 atccattccattccattccattcaa 27129 Score = 42.1 bits (21), Expect = 0.20 Identities = 21/21 (100%) Strand = Plus / Plus Query: 15 tccattcctttccattccatt 35 ||||||||||||||||||||| Sbjct: 23874 tccattcctttccattccatt 23894 Score = 42.1 bits (21), Expect = 0.20 Identities = 21/21 (100%) Strand = Plus / Plus Query: 15 tccattcctttccattccatt 35 ||||||||||||||||||||| Sbjct: 22301 tccattcctttccattccatt 22321 Score = 42.1 bits (21), Expect = 0.20 Identities = 21/21 (100%) Strand = Plus / Plus Query: 15 tccattcctttccattccatt 35 ||||||||||||||||||||| Sbjct: 16165 tccattcctttccattccatt 16185 Score = 42.1 bits (21), Expect = 0.20 Identities = 21/21 (100%) Strand = Plus / Plus Query: 15 tccattcctttccattccatt 35 ||||||||||||||||||||| Sbjct: 8929 tccattcctttccattccatt 8949 Score = 42.1 bits (21), Expect = 0.20 Identities = 24/25 (96%) Strand = Plus / Plus Query: 15 tccattcctttccattccattcaaa 39 |||||||| |||||||||||||||| Sbjct: 8619 tccattccattccattccattcaaa 8643 Score = 42.1 bits (21), Expect = 0.20 Identities = 21/21 (100%) Strand = Plus / Plus Query: 15 tccattcctttccattccatt 35 ||||||||||||||||||||| Sbjct: 7970 tccattcctttccattccatt 7990 Score = 40.1 bits (20), Expect = 0.78 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tccattcctttccattccat 34 |||||||||||||||||||| Sbjct: 38801 tccattcctttccattccat 38820 Score = 40.1 bits (20), Expect = 0.78 Identities = 23/24 (95%) Strand = Plus / Plus Query: 15 tccattcctttccattccattcaa 38 |||||||| ||||||||||||||| Sbjct: 38606 tccattccattccattccattcaa 38629 Score = 40.1 bits (20), Expect = 0.78 Identities = 20/20 (100%) Strand = Plus / Plus Query: 17 cattcctttccattccattc 36 |||||||||||||||||||| Sbjct: 31397 cattcctttccattccattc 31416 Score = 40.1 bits (20), Expect = 0.78 Identities = 23/24 (95%) Strand = Plus / Plus Query: 15 tccattcctttccattccattcaa 38 |||||||||||||| ||||||||| Sbjct: 30695 tccattcctttccactccattcaa 30718 Score = 40.1 bits (20), Expect = 0.78 Identities = 23/24 (95%) Strand = Plus / Plus Query: 15 tccattcctttccattccattcaa 38 |||||||| ||||||||||||||| Sbjct: 27166 tccattccattccattccattcaa 27189 Score = 40.1 bits (20), Expect = 0.78 Identities = 23/24 (95%) Strand = Plus / Plus Query: 15 tccattcctttccattccattcaa 38 |||||||||||| ||||||||||| Sbjct: 25939 tccattcctttcaattccattcaa 25962 Score = 40.1 bits (20), Expect = 0.78 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tccattcctttccattccat 34 |||||||||||||||||||| Sbjct: 25234 tccattcctttccattccat 25253 Score = 40.1 bits (20), Expect = 0.78 Identities = 23/24 (95%) Strand = Plus / Plus Query: 15 tccattcctttccattccattcaa 38 |||||||| ||||||||||||||| Sbjct: 24144 tccattccattccattccattcaa 24167 Score = 40.1 bits (20), Expect = 0.78 Identities = 20/20 (100%) Strand = Plus / Plus Query: 17 cattcctttccattccattc 36 |||||||||||||||||||| Sbjct: 21817 cattcctttccattccattc 21836 Score = 40.1 bits (20), Expect = 0.78 Identities = 23/24 (95%) Strand = Plus / Plus Query: 15 tccattcctttccattccattcaa 38 |||||||| ||||||||||||||| Sbjct: 21765 tccattccattccattccattcaa 21788 Score = 40.1 bits (20), Expect = 0.78 Identities = 23/24 (95%) Strand = Plus / Plus Query: 15 tccattcctttccattccattcaa 38 |||||||| ||||||||||||||| Sbjct: 16977 tccattccattccattccattcaa 17000 Score = 40.1 bits (20), Expect = 0.78 Identities = 23/24 (95%) Strand = Plus / Plus Query: 15 tccattcctttccattccattcaa 38 |||||||| ||||||||||||||| Sbjct: 9188 tccattccattccattccattcaa 9211 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Plus Query: 14 atccattcctttccattccattc 36 ||||||||| ||||||||||||| Sbjct: 38695 atccattccattccattccattc 38717 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Plus Query: 14 atccattcctttccattccattc 36 ||||||||| ||||||||||||| Sbjct: 37970 atccattccattccattccattc 37992 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Plus Query: 14 atccattcctttccattccattc 36 ||||||||| ||||||||||||| Sbjct: 36235 atccattccattccattccattc 36257 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Plus Query: 14 atccattcctttccattccattc 36 ||||||||| ||||||||||||| Sbjct: 30874 atccattccattccattccattc 30896 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Plus Query: 14 atccattcctttccattccattc 36 ||||| ||||||||||||||||| Sbjct: 20526 atccaatcctttccattccattc 20548 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Plus Query: 18 attcctttccattccattc 36 ||||||||||||||||||| Sbjct: 18457 attcctttccattccattc 18475 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Plus Query: 18 attcctttccattccattc 36 ||||||||||||||||||| Sbjct: 17264 attcctttccattccattc 17282 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Plus Query: 15 tccattcctttccattcca 33 ||||||||||||||||||| Sbjct: 14703 tccattcctttccattcca 14721 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Plus Query: 14 atccattcctttccattccattc 36 ||||||||| ||||||||||||| Sbjct: 13691 atccattccattccattccattc 13713 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Plus Query: 15 tccattcctttccattccattca 37 |||||||| |||||||||||||| Sbjct: 12978 tccattccattccattccattca 13000 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Plus Query: 15 tccattcctttccattccattca 37 |||||||| |||||||||||||| Sbjct: 12314 tccattccattccattccattca 12336 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Plus Query: 14 atccattcctttccattccattc 36 ||||||||| ||||||||||||| Sbjct: 11435 atccattccattccattccattc 11457 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Plus Query: 18 attcctttccattccattc 36 ||||||||||||||||||| Sbjct: 9371 attcctttccattccattc 9389 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Plus Query: 15 tccattcctttccattcca 33 ||||||||||||||||||| Sbjct: 7660 tccattcctttccattcca 7678 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Plus Query: 14 atccattcctttccattccattc 36 ||||||||| ||||||||||||| Sbjct: 7294 atccattccattccattccattc 7316 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Plus Query: 14 atccattcctttccattccattc 36 ||||||||| ||||||||||||| Sbjct: 488 atccattccattccattccattc 510
>emb|BX649480.3| Human DNA sequence from clone RP11-22O10 on chromosome 10, complete sequence Length = 181432 Score = 48.1 bits (24), Expect = 0.003 Identities = 24/24 (100%) Strand = Plus / Plus Query: 15 tccattcctttccattccattcaa 38 |||||||||||||||||||||||| Sbjct: 33061 tccattcctttccattccattcaa 33084 Score = 48.1 bits (24), Expect = 0.003 Identities = 24/24 (100%) Strand = Plus / Plus Query: 15 tccattcctttccattccattcaa 38 |||||||||||||||||||||||| Sbjct: 32596 tccattcctttccattccattcaa 32619 Score = 48.1 bits (24), Expect = 0.003 Identities = 24/24 (100%) Strand = Plus / Plus Query: 15 tccattcctttccattccattcaa 38 |||||||||||||||||||||||| Sbjct: 19922 tccattcctttccattccattcaa 19945 Score = 48.1 bits (24), Expect = 0.003 Identities = 24/24 (100%) Strand = Plus / Plus Query: 15 tccattcctttccattccattcaa 38 |||||||||||||||||||||||| Sbjct: 19042 tccattcctttccattccattcaa 19065 Score = 46.1 bits (23), Expect = 0.013 Identities = 23/23 (100%) Strand = Plus / Plus Query: 15 tccattcctttccattccattca 37 ||||||||||||||||||||||| Sbjct: 21835 tccattcctttccattccattca 21857 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Plus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 34240 tccattcctttccattccattc 34261 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Plus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 33526 tccattcctttccattccattc 33547 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Plus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 20467 tccattcctttccattccattc 20488 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Plus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 19642 tccattcctttccattccattc 19663 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Plus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 11551 tccattcctttccattccattc 11572 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Plus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 2320 tccattcctttccattccattc 2341 Score = 42.1 bits (21), Expect = 0.20 Identities = 24/25 (96%) Strand = Plus / Plus Query: 14 atccattcctttccattccattcaa 38 ||||||||| ||||||||||||||| Sbjct: 27105 atccattccattccattccattcaa 27129 Score = 42.1 bits (21), Expect = 0.20 Identities = 21/21 (100%) Strand = Plus / Plus Query: 15 tccattcctttccattccatt 35 ||||||||||||||||||||| Sbjct: 23874 tccattcctttccattccatt 23894 Score = 42.1 bits (21), Expect = 0.20 Identities = 21/21 (100%) Strand = Plus / Plus Query: 15 tccattcctttccattccatt 35 ||||||||||||||||||||| Sbjct: 22301 tccattcctttccattccatt 22321 Score = 42.1 bits (21), Expect = 0.20 Identities = 21/21 (100%) Strand = Plus / Plus Query: 15 tccattcctttccattccatt 35 ||||||||||||||||||||| Sbjct: 16165 tccattcctttccattccatt 16185 Score = 42.1 bits (21), Expect = 0.20 Identities = 21/21 (100%) Strand = Plus / Plus Query: 15 tccattcctttccattccatt 35 ||||||||||||||||||||| Sbjct: 8929 tccattcctttccattccatt 8949 Score = 42.1 bits (21), Expect = 0.20 Identities = 24/25 (96%) Strand = Plus / Plus Query: 15 tccattcctttccattccattcaaa 39 |||||||| |||||||||||||||| Sbjct: 8619 tccattccattccattccattcaaa 8643 Score = 42.1 bits (21), Expect = 0.20 Identities = 21/21 (100%) Strand = Plus / Plus Query: 15 tccattcctttccattccatt 35 ||||||||||||||||||||| Sbjct: 7970 tccattcctttccattccatt 7990 Score = 40.1 bits (20), Expect = 0.78 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tccattcctttccattccat 34 |||||||||||||||||||| Sbjct: 38801 tccattcctttccattccat 38820 Score = 40.1 bits (20), Expect = 0.78 Identities = 23/24 (95%) Strand = Plus / Plus Query: 15 tccattcctttccattccattcaa 38 |||||||| ||||||||||||||| Sbjct: 38606 tccattccattccattccattcaa 38629 Score = 40.1 bits (20), Expect = 0.78 Identities = 20/20 (100%) Strand = Plus / Plus Query: 17 cattcctttccattccattc 36 |||||||||||||||||||| Sbjct: 31397 cattcctttccattccattc 31416 Score = 40.1 bits (20), Expect = 0.78 Identities = 23/24 (95%) Strand = Plus / Plus Query: 15 tccattcctttccattccattcaa 38 |||||||||||||| ||||||||| Sbjct: 30695 tccattcctttccactccattcaa 30718 Score = 40.1 bits (20), Expect = 0.78 Identities = 23/24 (95%) Strand = Plus / Plus Query: 15 tccattcctttccattccattcaa 38 |||||||| ||||||||||||||| Sbjct: 27166 tccattccattccattccattcaa 27189 Score = 40.1 bits (20), Expect = 0.78 Identities = 23/24 (95%) Strand = Plus / Plus Query: 15 tccattcctttccattccattcaa 38 |||||||||||| ||||||||||| Sbjct: 25939 tccattcctttcaattccattcaa 25962 Score = 40.1 bits (20), Expect = 0.78 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tccattcctttccattccat 34 |||||||||||||||||||| Sbjct: 25234 tccattcctttccattccat 25253 Score = 40.1 bits (20), Expect = 0.78 Identities = 23/24 (95%) Strand = Plus / Plus Query: 15 tccattcctttccattccattcaa 38 |||||||| ||||||||||||||| Sbjct: 24144 tccattccattccattccattcaa 24167 Score = 40.1 bits (20), Expect = 0.78 Identities = 20/20 (100%) Strand = Plus / Plus Query: 17 cattcctttccattccattc 36 |||||||||||||||||||| Sbjct: 21817 cattcctttccattccattc 21836 Score = 40.1 bits (20), Expect = 0.78 Identities = 23/24 (95%) Strand = Plus / Plus Query: 15 tccattcctttccattccattcaa 38 |||||||| ||||||||||||||| Sbjct: 21765 tccattccattccattccattcaa 21788 Score = 40.1 bits (20), Expect = 0.78 Identities = 23/24 (95%) Strand = Plus / Plus Query: 15 tccattcctttccattccattcaa 38 |||||||| ||||||||||||||| Sbjct: 16977 tccattccattccattccattcaa 17000 Score = 40.1 bits (20), Expect = 0.78 Identities = 23/24 (95%) Strand = Plus / Plus Query: 15 tccattcctttccattccattcaa 38 |||||||| ||||||||||||||| Sbjct: 9188 tccattccattccattccattcaa 9211 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Plus Query: 14 atccattcctttccattccattc 36 ||||||||| ||||||||||||| Sbjct: 38695 atccattccattccattccattc 38717 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Plus Query: 14 atccattcctttccattccattc 36 ||||||||| ||||||||||||| Sbjct: 37970 atccattccattccattccattc 37992 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Plus Query: 14 atccattcctttccattccattc 36 ||||||||| ||||||||||||| Sbjct: 36235 atccattccattccattccattc 36257 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Plus Query: 14 atccattcctttccattccattc 36 ||||||||| ||||||||||||| Sbjct: 30874 atccattccattccattccattc 30896 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Plus Query: 14 atccattcctttccattccattc 36 ||||| ||||||||||||||||| Sbjct: 20526 atccaatcctttccattccattc 20548 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Plus Query: 18 attcctttccattccattc 36 ||||||||||||||||||| Sbjct: 18457 attcctttccattccattc 18475 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Plus Query: 18 attcctttccattccattc 36 ||||||||||||||||||| Sbjct: 17264 attcctttccattccattc 17282 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Plus Query: 15 tccattcctttccattcca 33 ||||||||||||||||||| Sbjct: 14703 tccattcctttccattcca 14721 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Plus Query: 14 atccattcctttccattccattc 36 ||||||||| ||||||||||||| Sbjct: 13691 atccattccattccattccattc 13713 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Plus Query: 15 tccattcctttccattccattca 37 |||||||| |||||||||||||| Sbjct: 12978 tccattccattccattccattca 13000 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Plus Query: 15 tccattcctttccattccattca 37 |||||||| |||||||||||||| Sbjct: 12314 tccattccattccattccattca 12336 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Plus Query: 14 atccattcctttccattccattc 36 ||||||||| ||||||||||||| Sbjct: 11435 atccattccattccattccattc 11457 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Plus Query: 18 attcctttccattccattc 36 ||||||||||||||||||| Sbjct: 9371 attcctttccattccattc 9389 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Plus Query: 15 tccattcctttccattcca 33 ||||||||||||||||||| Sbjct: 7660 tccattcctttccattcca 7678 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Plus Query: 14 atccattcctttccattccattc 36 ||||||||| ||||||||||||| Sbjct: 7294 atccattccattccattccattc 7316 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Plus Query: 14 atccattcctttccattccattc 36 ||||||||| ||||||||||||| Sbjct: 488 atccattccattccattccattc 510
>emb|BX546479.5| Human DNA sequence from clone RP11-438N17 on chromosome 22, complete sequence Length = 172294 Score = 48.1 bits (24), Expect = 0.003 Identities = 24/24 (100%) Strand = Plus / Plus Query: 15 tccattcctttccattccattcaa 38 |||||||||||||||||||||||| Sbjct: 77164 tccattcctttccattccattcaa 77187 Score = 48.1 bits (24), Expect = 0.003 Identities = 24/24 (100%) Strand = Plus / Plus Query: 15 tccattcctttccattccattcaa 38 |||||||||||||||||||||||| Sbjct: 51103 tccattcctttccattccattcaa 51126 Score = 46.1 bits (23), Expect = 0.013 Identities = 23/23 (100%) Strand = Plus / Plus Query: 14 atccattcctttccattccattc 36 ||||||||||||||||||||||| Sbjct: 70545 atccattcctttccattccattc 70567 Score = 46.1 bits (23), Expect = 0.013 Identities = 23/23 (100%) Strand = Plus / Plus Query: 14 atccattcctttccattccattc 36 ||||||||||||||||||||||| Sbjct: 38049 atccattcctttccattccattc 38071 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Plus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 82144 tccattcctttccattccattc 82165 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Plus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 81789 tccattcctttccattccattc 81810 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Plus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 80724 tccattcctttccattccattc 80745 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Plus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 80674 tccattcctttccattccattc 80695 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Plus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 77884 tccattcctttccattccattc 77905 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Plus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 62930 tccattcctttccattccattc 62951 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Plus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 55176 tccattcctttccattccattc 55197 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Plus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 54410 tccattcctttccattccattc 54431 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Plus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 53730 tccattcctttccattccattc 53751 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Plus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 48840 tccattcctttccattccattc 48861 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Plus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 45907 tccattcctttccattccattc 45928 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Plus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 45867 tccattcctttccattccattc 45888 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Plus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 44979 tccattcctttccattccattc 45000 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Plus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 39140 tccattcctttccattccattc 39161 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Plus Query: 17 cattcctttccattccattcaa 38 |||||||||||||||||||||| Sbjct: 35159 cattcctttccattccattcaa 35180 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Plus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 32844 tccattcctttccattccattc 32865 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Plus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 32099 tccattcctttccattccattc 32120 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Plus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 27309 tccattcctttccattccattc 27330 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Plus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 24597 tccattcctttccattccattc 24618 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Plus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 24147 tccattcctttccattccattc 24168 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Plus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 23712 tccattcctttccattccattc 23733 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Plus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 22583 tccattcctttccattccattc 22604 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Plus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 22325 tccattcctttccattccattc 22346 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Plus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 22110 tccattcctttccattccattc 22131 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Plus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 19675 tccattcctttccattccattc 19696 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Plus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 14824 tccattcctttccattccattc 14845 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Plus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 14374 tccattcctttccattccattc 14395 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Plus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 13939 tccattcctttccattccattc 13960 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Plus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 12930 tccattcctttccattccattc 12951 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Plus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 8711 tccattcctttccattccattc 8732 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Plus Query: 17 cattcctttccattccattcaa 38 |||||||||||||||||||||| Sbjct: 7626 cattcctttccattccattcaa 7647 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Plus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 6632 tccattcctttccattccattc 6653 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Plus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 5057 tccattcctttccattccattc 5078 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Plus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 4812 tccattcctttccattccattc 4833 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Plus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 3902 tccattcctttccattccattc 3923 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Plus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 45 tccattcctttccattccattc 66 Score = 42.1 bits (21), Expect = 0.20 Identities = 21/21 (100%) Strand = Plus / Plus Query: 15 tccattcctttccattccatt 35 ||||||||||||||||||||| Sbjct: 79254 tccattcctttccattccatt 79274 Score = 42.1 bits (21), Expect = 0.20 Identities = 21/21 (100%) Strand = Plus / Plus Query: 18 attcctttccattccattcaa 38 ||||||||||||||||||||| Sbjct: 78758 attcctttccattccattcaa 78778 Score = 42.1 bits (21), Expect = 0.20 Identities = 21/21 (100%) Strand = Plus / Plus Query: 15 tccattcctttccattccatt 35 ||||||||||||||||||||| Sbjct: 75614 tccattcctttccattccatt 75634 Score = 42.1 bits (21), Expect = 0.20 Identities = 21/21 (100%) Strand = Plus / Plus Query: 16 ccattcctttccattccattc 36 ||||||||||||||||||||| Sbjct: 71619 ccattcctttccattccattc 71639 Score = 42.1 bits (21), Expect = 0.20 Identities = 21/21 (100%) Strand = Plus / Plus Query: 16 ccattcctttccattccattc 36 ||||||||||||||||||||| Sbjct: 64416 ccattcctttccattccattc 64436 Score = 42.1 bits (21), Expect = 0.20 Identities = 21/21 (100%) Strand = Plus / Plus Query: 15 tccattcctttccattccatt 35 ||||||||||||||||||||| Sbjct: 47231 tccattcctttccattccatt 47251 Score = 42.1 bits (21), Expect = 0.20 Identities = 21/21 (100%) Strand = Plus / Plus Query: 15 tccattcctttccattccatt 35 ||||||||||||||||||||| Sbjct: 31139 tccattcctttccattccatt 31159 Score = 42.1 bits (21), Expect = 0.20 Identities = 21/21 (100%) Strand = Plus / Plus Query: 15 tccattcctttccattccatt 35 ||||||||||||||||||||| Sbjct: 21846 tccattcctttccattccatt 21866 Score = 42.1 bits (21), Expect = 0.20 Identities = 21/21 (100%) Strand = Plus / Plus Query: 15 tccattcctttccattccatt 35 ||||||||||||||||||||| Sbjct: 19430 tccattcctttccattccatt 19450 Score = 42.1 bits (21), Expect = 0.20 Identities = 21/21 (100%) Strand = Plus / Plus Query: 15 tccattcctttccattccatt 35 ||||||||||||||||||||| Sbjct: 18150 tccattcctttccattccatt 18170 Score = 42.1 bits (21), Expect = 0.20 Identities = 24/25 (96%) Strand = Plus / Plus Query: 15 tccattcctttccattccattcaaa 39 |||||||| |||||||||||||||| Sbjct: 10100 tccattccattccattccattcaaa 10124 Score = 42.1 bits (21), Expect = 0.20 Identities = 21/21 (100%) Strand = Plus / Plus Query: 16 ccattcctttccattccattc 36 ||||||||||||||||||||| Sbjct: 8907 ccattcctttccattccattc 8927 Score = 40.1 bits (20), Expect = 0.78 Identities = 23/24 (95%) Strand = Plus / Plus Query: 15 tccattcctttccattccattcaa 38 |||||||| ||||||||||||||| Sbjct: 82899 tccattccattccattccattcaa 82922 Score = 40.1 bits (20), Expect = 0.78 Identities = 23/24 (95%) Strand = Plus / Plus Query: 15 tccattcctttccattccattcaa 38 |||||||||||||||| ||||||| Sbjct: 78510 tccattcctttccattacattcaa 78533 Score = 40.1 bits (20), Expect = 0.78 Identities = 20/20 (100%) Strand = Plus / Plus Query: 17 cattcctttccattccattc 36 |||||||||||||||||||| Sbjct: 77451 cattcctttccattccattc 77470 Score = 40.1 bits (20), Expect = 0.78 Identities = 20/20 (100%) Strand = Plus / Plus Query: 17 cattcctttccattccattc 36 |||||||||||||||||||| Sbjct: 77071 cattcctttccattccattc 77090 Score = 40.1 bits (20), Expect = 0.78 Identities = 23/24 (95%) Strand = Plus / Plus Query: 15 tccattcctttccattccattcaa 38 |||||||| ||||||||||||||| Sbjct: 76369 tccattccattccattccattcaa 76392 Score = 40.1 bits (20), Expect = 0.78 Identities = 23/24 (95%) Strand = Plus / Plus Query: 15 tccattcctttccattccattcaa 38 |||||||| ||||||||||||||| Sbjct: 73122 tccattccattccattccattcaa 73145 Score = 40.1 bits (20), Expect = 0.78 Identities = 20/20 (100%) Strand = Plus / Plus Query: 17 cattcctttccattccattc 36 |||||||||||||||||||| Sbjct: 73099 cattcctttccattccattc 73118 Score = 40.1 bits (20), Expect = 0.78 Identities = 23/24 (95%) Strand = Plus / Plus Query: 15 tccattcctttccattccattcaa 38 |||||||||||||| ||||||||| Sbjct: 66705 tccattcctttccagtccattcaa 66728 Score = 40.1 bits (20), Expect = 0.78 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tccattcctttccattccat 34 |||||||||||||||||||| Sbjct: 64840 tccattcctttccattccat 64859 Score = 40.1 bits (20), Expect = 0.78 Identities = 23/24 (95%) Strand = Plus / Plus Query: 13 gatccattcctttccattccattc 36 |||||||||| ||||||||||||| Sbjct: 62723 gatccattccattccattccattc 62746 Score = 40.1 bits (20), Expect = 0.78 Identities = 23/24 (95%) Strand = Plus / Plus Query: 15 tccattcctttccattccattcaa 38 |||||||| ||||||||||||||| Sbjct: 58581 tccattccgttccattccattcaa 58604 Score = 40.1 bits (20), Expect = 0.78 Identities = 23/24 (95%) Strand = Plus / Plus Query: 15 tccattcctttccattccattcaa 38 |||||||| ||||||||||||||| Sbjct: 58173 tccattccattccattccattcaa 58196 Score = 40.1 bits (20), Expect = 0.78 Identities = 23/24 (95%) Strand = Plus / Plus Query: 15 tccattcctttccattccattcaa 38 ||||||||| |||||||||||||| Sbjct: 57296 tccattcctgtccattccattcaa 57319 Score = 40.1 bits (20), Expect = 0.78 Identities = 23/24 (95%) Strand = Plus / Plus Query: 15 tccattcctttccattccattcaa 38 |||||||| ||||||||||||||| Sbjct: 55805 tccattccattccattccattcaa 55828 Score = 40.1 bits (20), Expect = 0.78 Identities = 23/24 (95%) Strand = Plus / Plus Query: 15 tccattcctttccattccattcaa 38 |||||||| ||||||||||||||| Sbjct: 47726 tccattccattccattccattcaa 47749 Score = 40.1 bits (20), Expect = 0.78 Identities = 23/24 (95%) Strand = Plus / Plus Query: 15 tccattcctttccattccattcaa 38 |||||||| ||||||||||||||| Sbjct: 43325 tccattccattccattccattcaa 43348 Score = 40.1 bits (20), Expect = 0.78 Identities = 23/24 (95%) Strand = Plus / Plus Query: 15 tccattcctttccattccattcaa 38 |||||||| ||||||||||||||| Sbjct: 43240 tccattccattccattccattcaa 43263 Score = 40.1 bits (20), Expect = 0.78 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tccattcctttccattccat 34 |||||||||||||||||||| Sbjct: 37575 tccattcctttccattccat 37594 Score = 40.1 bits (20), Expect = 0.78 Identities = 20/20 (100%) Strand = Plus / Plus Query: 18 attcctttccattccattca 37 |||||||||||||||||||| Sbjct: 32772 attcctttccattccattca 32791 Score = 40.1 bits (20), Expect = 0.78 Identities = 20/20 (100%) Strand = Plus / Plus Query: 17 cattcctttccattccattc 36 |||||||||||||||||||| Sbjct: 31711 cattcctttccattccattc 31730 Score = 40.1 bits (20), Expect = 0.78 Identities = 23/24 (95%) Strand = Plus / Plus Query: 15 tccattcctttccattccattcaa 38 |||||||| ||||||||||||||| Sbjct: 24642 tccattcccttccattccattcaa 24665 Score = 40.1 bits (20), Expect = 0.78 Identities = 20/20 (100%) Strand = Plus / Plus Query: 19 ttcctttccattccattcaa 38 |||||||||||||||||||| Sbjct: 23791 ttcctttccattccattcaa 23810 Score = 40.1 bits (20), Expect = 0.78 Identities = 20/20 (100%) Strand = Plus / Plus Query: 19 ttcctttccattccattcaa 38 |||||||||||||||||||| Sbjct: 23072 ttcctttccattccattcaa 23091 Score = 40.1 bits (20), Expect = 0.78 Identities = 23/24 (95%) Strand = Plus / Plus Query: 15 tccattcctttccattccattcaa 38 |||||||| ||||||||||||||| Sbjct: 22455 tccattccattccattccattcaa 22478 Score = 40.1 bits (20), Expect = 0.78 Identities = 23/24 (95%) Strand = Plus / Plus Query: 15 tccattcctttccattccattcaa 38 |||||||| ||||||||||||||| Sbjct: 19770 tccattccattccattccattcaa 19793 Score = 40.1 bits (20), Expect = 0.78 Identities = 23/24 (95%) Strand = Plus / Plus Query: 15 tccattcctttccattccattcaa 38 ||||||||||| |||||||||||| Sbjct: 19010 tccattccttttcattccattcaa 19033 Score = 40.1 bits (20), Expect = 0.78 Identities = 23/24 (95%) Strand = Plus / Plus Query: 15 tccattcctttccattccattcaa 38 |||||||| ||||||||||||||| Sbjct: 14864 tccattcccttccattccattcaa 14887 Score = 40.1 bits (20), Expect = 0.78 Identities = 20/20 (100%) Strand = Plus / Plus Query: 19 ttcctttccattccattcaa 38 |||||||||||||||||||| Sbjct: 14018 ttcctttccattccattcaa 14037 Score = 40.1 bits (20), Expect = 0.78 Identities = 23/24 (95%) Strand = Plus / Plus Query: 15 tccattcctttccattccattcaa 38 |||||||| ||||||||||||||| Sbjct: 13520 tccattccattccattccattcaa 13543 Score = 40.1 bits (20), Expect = 0.78 Identities = 20/20 (100%) Strand = Plus / Plus Query: 19 ttcctttccattccattcaa 38 |||||||||||||||||||| Sbjct: 13319 ttcctttccattccattcaa 13338 Score = 40.1 bits (20), Expect = 0.78 Identities = 20/20 (100%) Strand = Plus / Plus Query: 19 ttcctttccattccattcaa 38 |||||||||||||||||||| Sbjct: 12574 ttcctttccattccattcaa 12593 Score = 40.1 bits (20), Expect = 0.78 Identities = 23/24 (95%) Strand = Plus / Plus Query: 15 tccattcctttccattccattcaa 38 |||||||||||||||||| ||||| Sbjct: 11930 tccattcctttccattccgttcaa 11953 Score = 40.1 bits (20), Expect = 0.78 Identities = 20/20 (100%) Strand = Plus / Plus Query: 19 ttcctttccattccattcaa 38 |||||||||||||||||||| Sbjct: 9804 ttcctttccattccattcaa 9823 Score = 40.1 bits (20), Expect = 0.78 Identities = 23/24 (95%) Strand = Plus / Plus Query: 15 tccattcctttccattccattcaa 38 |||||||| ||||||||||||||| Sbjct: 6069 tccattccattccattccattcaa 6092 Score = 40.1 bits (20), Expect = 0.78 Identities = 20/20 (100%) Strand = Plus / Plus Query: 17 cattcctttccattccattc 36 |||||||||||||||||||| Sbjct: 4274 cattcctttccattccattc 4293 Score = 40.1 bits (20), Expect = 0.78 Identities = 23/24 (95%) Strand = Plus / Plus Query: 15 tccattcctttccattccattcaa 38 ||||||| |||||||||||||||| Sbjct: 3156 tccattcatttccattccattcaa 3179 Score = 40.1 bits (20), Expect = 0.78 Identities = 20/20 (100%) Strand = Plus / Plus Query: 17 cattcctttccattccattc 36 |||||||||||||||||||| Sbjct: 2607 cattcctttccattccattc 2626 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Plus Query: 15 tccattcctttccattcca 33 ||||||||||||||||||| Sbjct: 79634 tccattcctttccattcca 79652 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Plus Query: 14 atccattcctttccattccattc 36 ||||||||| ||||||||||||| Sbjct: 78233 atccattccattccattccattc 78255 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Plus Query: 15 tccattcctttccattcca 33 ||||||||||||||||||| Sbjct: 75164 tccattcctttccattcca 75182 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Plus Query: 15 tccattcctttccattcca 33 ||||||||||||||||||| Sbjct: 74869 tccattcctttccattcca 74887 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Plus Query: 18 attcctttccattccattc 36 ||||||||||||||||||| Sbjct: 73539 attcctttccattccattc 73557 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Plus Query: 15 tccattcctttccattccattca 37 |||||||| |||||||||||||| Sbjct: 61164 tccattccattccattccattca 61186 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Plus Query: 17 cattcctttccattccattcaaa 39 |||||| |||||||||||||||| Sbjct: 60847 cattccattccattccattcaaa 60869 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Plus Query: 14 atccattcctttccattccattc 36 ||||||||| ||||||||||||| Sbjct: 59484 atccattccattccattccattc 59506 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Plus Query: 18 attcctttccattccattc 36 ||||||||||||||||||| Sbjct: 57603 attcctttccattccattc 57621 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Plus Query: 15 tccattcctttccattccattca 37 |||||||| |||||||||||||| Sbjct: 54195 tccattccattccattccattca 54217 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Plus Query: 20 tcctttccattccattcaa 38 ||||||||||||||||||| Sbjct: 50774 tcctttccattccattcaa 50792 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Plus Query: 14 atccattcctttccattccattc 36 |||||||| |||||||||||||| Sbjct: 50228 atccattcttttccattccattc 50250 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Plus Query: 18 attcctttccattccattc 36 ||||||||||||||||||| Sbjct: 49023 attcctttccattccattc 49041 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Plus Query: 15 tccattcctttccattcca 33 ||||||||||||||||||| Sbjct: 40477 tccattcctttccattcca 40495 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Plus Query: 15 tccattcctttccattccattca 37 |||||||| |||||||||||||| Sbjct: 38935 tccattccattccattccattca 38957 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Plus Query: 14 atccattcctttccattccattc 36 |||| |||||||||||||||||| Sbjct: 37799 atcctttcctttccattccattc 37821 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Plus Query: 15 tccattcctttccattcca 33 ||||||||||||||||||| Sbjct: 32064 tccattcctttccattcca 32082 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Plus Query: 14 atccattcctttccattccattc 36 ||||||||| ||||||||||||| Sbjct: 29954 atccattccattccattccattc 29976 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Plus Query: 14 atccattcctttccattcc 32 ||||||||||||||||||| Sbjct: 25871 atccattcctttccattcc 25889 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Plus Query: 18 attcctttccattccattc 36 ||||||||||||||||||| Sbjct: 25532 attcctttccattccattc 25550 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Plus Query: 14 atccattcctttccattccattc 36 ||||||||| ||||||||||||| Sbjct: 24895 atccattccattccattccattc 24917 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Plus Query: 15 tccattcctttccattcca 33 ||||||||||||||||||| Sbjct: 23422 tccattcctttccattcca 23440 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Plus Query: 15 tccattcctttccattccattca 37 |||||||| |||||||||||||| Sbjct: 23123 tccattccattccattccattca 23145 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Plus Query: 18 attcctttccattccattc 36 ||||||||||||||||||| Sbjct: 22268 attcctttccattccattc 22286 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Plus Query: 14 atccattcctttccattccattc 36 ||||||||| ||||||||||||| Sbjct: 22134 atccattccattccattccattc 22156 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Plus Query: 14 atccattcctttccattccattc 36 ||||||||| ||||||||||||| Sbjct: 20432 atccattccattccattccattc 20454 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Plus Query: 15 tccattcctttccattcca 33 ||||||||||||||||||| Sbjct: 20403 tccattcctttccattcca 20421 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Plus Query: 15 tccattcctttccattccattca 37 |||||||| |||||||||||||| Sbjct: 19944 tccattccattccattccattca 19966 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Plus Query: 18 attcctttccattccattc 36 ||||||||||||||||||| Sbjct: 18443 attcctttccattccattc 18461 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Plus Query: 14 atccattcctttccattcc 32 ||||||||||||||||||| Sbjct: 16093 atccattcctttccattcc 16111 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Plus Query: 18 attcctttccattccattc 36 ||||||||||||||||||| Sbjct: 15754 attcctttccattccattc 15772 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Plus Query: 15 tccattcctttccattcca 33 ||||||||||||||||||| Sbjct: 13669 tccattcctttccattcca 13687 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Plus Query: 14 atccattcctttccattccattc 36 ||||||||| ||||||||||||| Sbjct: 13514 atccattccattccattccattc 13536 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Plus Query: 15 tccattcctttccattccattca 37 |||||||| |||||||||||||| Sbjct: 13370 tccattccattccattccattca 13392 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Plus Query: 14 atccattcctttccattccattc 36 ||||||||| ||||||||||||| Sbjct: 11844 atccattccattccattccattc 11866 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Plus Query: 15 tccattcctttccattccattca 37 |||||||| |||||||||||||| Sbjct: 11710 tccattccattccattccattca 11732 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Plus Query: 16 ccattcctttccattccattcaa 38 ||||||| ||||||||||||||| Sbjct: 10991 ccattccattccattccattcaa 11013 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Plus Query: 16 ccattcctttccattccattcaa 38 ||||||| ||||||||||||||| Sbjct: 10896 ccattccattccattccattcaa 10918 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Plus Query: 16 ccattcctttccattccattcaa 38 ||||||| ||||||||||||||| Sbjct: 10811 ccattccattccattccattcaa 10833 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Plus Query: 14 atccattcctttccattccattc 36 ||||||||||| ||||||||||| Sbjct: 9000 atccattccttaccattccattc 9022 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Plus Query: 15 tccattcctttccattcca 33 ||||||||||||||||||| Sbjct: 8064 tccattcctttccattcca 8082 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Plus Query: 14 atccattcctttccattccattc 36 ||||||||| ||||||||||||| Sbjct: 8013 atccattccattccattccattc 8035 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Plus Query: 14 atccattcctttccattccattc 36 ||||||||| ||||||||||||| Sbjct: 7663 atccattccattccattccattc 7685 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Plus Query: 18 attcctttccattccattc 36 ||||||||||||||||||| Sbjct: 7020 attcctttccattccattc 7038 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Plus Query: 14 atccattcctttccattccattc 36 ||||||||| ||||||||||||| Sbjct: 6831 atccattccattccattccattc 6853 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Plus Query: 18 attcctttccattccattc 36 ||||||||||||||||||| Sbjct: 6012 attcctttccattccattc 6030 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Plus Query: 15 tccattcctttccattccattca 37 |||||||| |||||||||||||| Sbjct: 5829 tccattccattccattccattca 5851 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Plus Query: 15 tccattcctttccattcca 33 ||||||||||||||||||| Sbjct: 5634 tccattcctttccattcca 5652 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Plus Query: 16 ccattcctttccattccattcaa 38 ||||||| ||||||||||||||| Sbjct: 5397 ccattccattccattccattcaa 5419 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Plus Query: 18 attcctttccattccattc 36 ||||||||||||||||||| Sbjct: 4005 attcctttccattccattc 4023 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Plus Query: 18 attcctttccattccattc 36 ||||||||||||||||||| Sbjct: 1284 attcctttccattccattc 1302
>emb|BX322613.6| Human DNA sequence from clone RP11-745D9 on chromosome 10 Contains a CpG island, complete sequence Length = 191752 Score = 46.1 bits (23), Expect = 0.013 Identities = 23/23 (100%) Strand = Plus / Plus Query: 15 tccattcctttccattccattca 37 ||||||||||||||||||||||| Sbjct: 26037 tccattcctttccattccattca 26059 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Plus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 27875 tccattcctttccattccattc 27896 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Plus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 25967 tccattcctttccattccattc 25988 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Plus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 25552 tccattcctttccattccattc 25573 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Plus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 24812 tccattcctttccattccattc 24833 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Plus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 24527 tccattcctttccattccattc 24548 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Plus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 22949 tccattcctttccattccattc 22970 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Plus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 22854 tccattcctttccattccattc 22875 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Plus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 21101 tccattcctttccattccattc 21122 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Plus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 20766 tccattcctttccattccattc 20787 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Plus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 17062 tccattcctttccattccattc 17083 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Plus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 16592 tccattcctttccattccattc 16613 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Plus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 16517 tccattcctttccattccattc 16538 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Plus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 16242 tccattcctttccattccattc 16263 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Plus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 15668 tccattcctttccattccattc 15689 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Plus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 15299 tccattcctttccattccattc 15320 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Plus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 15189 tccattcctttccattccattc 15210 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Plus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 14699 tccattcctttccattccattc 14720 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Plus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 14469 tccattcctttccattccattc 14490 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Plus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 14274 tccattcctttccattccattc 14295 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Plus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 12142 tccattcctttccattccattc 12163 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Plus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 11687 tccattcctttccattccattc 11708 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Plus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 11612 tccattcctttccattccattc 11633 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Plus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 11332 tccattcctttccattccattc 11353 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Plus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 10627 tccattcctttccattccattc 10648 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Plus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 9548 tccattcctttccattccattc 9569 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Plus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 9423 tccattcctttccattccattc 9444 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Plus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 9388 tccattcctttccattccattc 9409 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Plus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 9098 tccattcctttccattccattc 9119 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Plus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 9023 tccattcctttccattccattc 9044 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Plus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 8079 tccattcctttccattccattc 8100 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Plus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 7111 tccattcctttccattccattc 7132 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Plus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 6259 tccattcctttccattccattc 6280 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Plus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 4768 tccattcctttccattccattc 4789 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Plus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 4713 tccattcctttccattccattc 4734 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Plus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 3070 tccattcctttccattccattc 3091 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Plus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 2547 tccattcctttccattccattc 2568 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Plus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 803 tccattcctttccattccattc 824 Score = 42.1 bits (21), Expect = 0.20 Identities = 21/21 (100%) Strand = Plus / Plus Query: 15 tccattcctttccattccatt 35 ||||||||||||||||||||| Sbjct: 27167 tccattcctttccattccatt 27187 Score = 42.1 bits (21), Expect = 0.20 Identities = 21/21 (100%) Strand = Plus / Plus Query: 15 tccattcctttccattccatt 35 ||||||||||||||||||||| Sbjct: 1492 tccattcctttccattccatt 1512 Score = 40.1 bits (20), Expect = 0.78 Identities = 23/24 (95%) Strand = Plus / Plus Query: 14 atccattcctttccattccattca 37 ||||||||| |||||||||||||| Sbjct: 27640 atccattccattccattccattca 27663 Score = 40.1 bits (20), Expect = 0.78 Identities = 23/24 (95%) Strand = Plus / Plus Query: 14 atccattcctttccattccattca 37 ||||||||| |||||||||||||| Sbjct: 23443 atccattccattccattccattca 23466 Score = 40.1 bits (20), Expect = 0.78 Identities = 23/24 (95%) Strand = Plus / Plus Query: 14 atccattcctttccattccattca 37 ||||||||| |||||||||||||| Sbjct: 21974 atccattccattccattccattca 21997 Score = 40.1 bits (20), Expect = 0.78 Identities = 20/20 (100%) Strand = Plus / Plus Query: 17 cattcctttccattccattc 36 |||||||||||||||||||| Sbjct: 19839 cattcctttccattccattc 19858 Score = 40.1 bits (20), Expect = 0.78 Identities = 23/24 (95%) Strand = Plus / Plus Query: 15 tccattcctttccattccattcaa 38 |||||||| ||||||||||||||| Sbjct: 17745 tccattccattccattccattcaa 17768 Score = 40.1 bits (20), Expect = 0.78 Identities = 23/24 (95%) Strand = Plus / Plus Query: 15 tccattcctttccattccattcaa 38 |||||||| ||||||||||||||| Sbjct: 14014 tccattccattccattccattcaa 14037 Score = 40.1 bits (20), Expect = 0.78 Identities = 23/24 (95%) Strand = Plus / Plus Query: 15 tccattcctttccattccattcaa 38 |||||||| ||||||||||||||| Sbjct: 12820 tccattccattccattccattcaa 12843 Score = 40.1 bits (20), Expect = 0.78 Identities = 20/20 (100%) Strand = Plus / Plus Query: 17 cattcctttccattccattc 36 |||||||||||||||||||| Sbjct: 9315 cattcctttccattccattc 9334 Score = 40.1 bits (20), Expect = 0.78 Identities = 23/24 (95%) Strand = Plus / Plus Query: 15 tccattcctttccattccattcaa 38 |||||||| ||||||||||||||| Sbjct: 9158 tccattccattccattccattcaa 9181 Score = 40.1 bits (20), Expect = 0.78 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tccattcctttccattccat 34 |||||||||||||||||||| Sbjct: 5032 tccattcctttccattccat 5051 Score = 40.1 bits (20), Expect = 0.78 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tccattcctttccattccat 34 |||||||||||||||||||| Sbjct: 2517 tccattcctttccattccat 2536 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Plus Query: 15 tccattcctttccattccattca 37 |||||||| |||||||||||||| Sbjct: 27307 tccattccattccattccattca 27329 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Plus Query: 18 attcctttccattccattc 36 ||||||||||||||||||| Sbjct: 26835 attcctttccattccattc 26853 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Plus Query: 14 atccattcctttccattccattc 36 ||||||||| ||||||||||||| Sbjct: 26711 atccattccattccattccattc 26733 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Plus Query: 14 atccattcctttccattccattc 36 ||||||||| ||||||||||||| Sbjct: 22038 atccattccattccattccattc 22060 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Plus Query: 14 atccattcctttccattccattc 36 ||||||||| ||||||||||||| Sbjct: 21769 atccattccattccattccattc 21791 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Plus Query: 15 tccattcctttccattccattca 37 |||||||| |||||||||||||| Sbjct: 21686 tccattccgttccattccattca 21708 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Plus Query: 15 tccattcctttccattccattca 37 |||||||| |||||||||||||| Sbjct: 20986 tccattccattccattccattca 21008 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Plus Query: 15 tccattcctttccattccattca 37 |||||||| |||||||||||||| Sbjct: 17176 tccattccattccattccattca 17198 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Plus Query: 15 tccattcctttccattccattca 37 ||||||| ||||||||||||||| Sbjct: 17082 tccattcatttccattccattca 17104 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Plus Query: 15 tccattcctttccattccattca 37 ||||||| ||||||||||||||| Sbjct: 15444 tccattcatttccattccattca 15466 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Plus Query: 18 attcctttccattccattc 36 ||||||||||||||||||| Sbjct: 15127 attcctttccattccattc 15145 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Plus Query: 15 tccattcctttccattccattca 37 |||||||| |||||||||||||| Sbjct: 12251 tccattccattccattccattca 12273 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Plus Query: 15 tccattcctttccattccattca 37 ||||||| ||||||||||||||| Sbjct: 12162 tccattcatttccattccattca 12184 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Plus Query: 15 tccattcctttccattccattca 37 |||||||| |||||||||||||| Sbjct: 10517 tccattccattccattccattca 10539 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Plus Query: 15 tccattcctttccattccattca 37 ||||||| ||||||||||||||| Sbjct: 9568 tccattcatttccattccattca 9590 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Plus Query: 14 atccattcctttccattccattc 36 ||||||||| ||||||||||||| Sbjct: 8357 atccattccattccattccattc 8379 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Plus Query: 14 atccattcctttccattccattc 36 ||||||||| ||||||||||||| Sbjct: 8302 atccattccattccattccattc 8324 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Plus Query: 15 tccattcctttccattccattca 37 |||||||||||||| |||||||| Sbjct: 7280 tccattcctttccagtccattca 7302 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Plus Query: 15 tccattcctttccattccattca 37 ||||||| ||||||||||||||| Sbjct: 7131 tccattcatttccattccattca 7153 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Plus Query: 15 tccattcctttccattccattca 37 |||||||| |||||||||||||| Sbjct: 6418 tccattccattccattccattca 6440 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Plus Query: 14 atccattcctttccattccattc 36 ||||||||| ||||||||||||| Sbjct: 4528 atccattccattccattccattc 4550 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Plus Query: 15 tccattcctttccattccattca 37 |||||||| |||||||||||||| Sbjct: 4400 tccattccattccattccattca 4422 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Plus Query: 14 atccattcctttccattccattc 36 ||||||||| ||||||||||||| Sbjct: 4394 atccattccattccattccattc 4416 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Plus Query: 14 atccattcctttccattccattc 36 ||||||||| ||||||||||||| Sbjct: 3969 atccattccattccattccattc 3991 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Plus Query: 15 tccattcctttccattcca 33 ||||||||||||||||||| Sbjct: 703 tccattcctttccattcca 721 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Plus Query: 14 atccattcctttccattccattc 36 ||||||||| ||||||||||||| Sbjct: 602 atccattccattccattccattc 624
>gb|AC020760.6| Homo sapiens chromosome 16 clone RP11-151C19, complete sequence Length = 188872 Score = 46.1 bits (23), Expect = 0.013 Identities = 23/23 (100%) Strand = Plus / Minus Query: 15 tccattcctttccattccattca 37 ||||||||||||||||||||||| Sbjct: 21310 tccattcctttccattccattca 21288 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Minus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 52493 tccattcctttccattccattc 52472 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Minus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 40764 tccattcctttccattccattc 40743 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Minus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 37930 tccattcctttccattccattc 37909 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Minus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 35348 tccattcctttccattccattc 35327 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Minus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 34945 tccattcctttccattccattc 34924 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Minus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 32365 tccattcctttccattccattc 32344 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Minus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 31431 tccattcctttccattccattc 31410 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Plus Query: 17 cattcctttccattccattcaa 38 |||||||||||||||||||||| Sbjct: 9839 cattcctttccattccattcaa 9860 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Plus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 8738 tccattcctttccattccattc 8759 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Plus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 8118 tccattcctttccattccattc 8139 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Plus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 7219 tccattcctttccattccattc 7240 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Plus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 4092 tccattcctttccattccattc 4113 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Plus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 1290 tccattcctttccattccattc 1311 Score = 42.1 bits (21), Expect = 0.20 Identities = 21/21 (100%) Strand = Plus / Minus Query: 19 ttcctttccattccattcaaa 39 ||||||||||||||||||||| Sbjct: 55008 ttcctttccattccattcaaa 54988 Score = 42.1 bits (21), Expect = 0.20 Identities = 24/25 (96%) Strand = Plus / Minus Query: 14 atccattcctttccattccattcaa 38 ||||||||| ||||||||||||||| Sbjct: 45372 atccattccattccattccattcaa 45348 Score = 42.1 bits (21), Expect = 0.20 Identities = 21/21 (100%) Strand = Plus / Minus Query: 15 tccattcctttccattccatt 35 ||||||||||||||||||||| Sbjct: 42736 tccattcctttccattccatt 42716 Score = 42.1 bits (21), Expect = 0.20 Identities = 21/21 (100%) Strand = Plus / Minus Query: 15 tccattcctttccattccatt 35 ||||||||||||||||||||| Sbjct: 33700 tccattcctttccattccatt 33680 Score = 42.1 bits (21), Expect = 0.20 Identities = 21/21 (100%) Strand = Plus / Minus Query: 15 tccattcctttccattccatt 35 ||||||||||||||||||||| Sbjct: 27721 tccattcctttccattccatt 27701 Score = 42.1 bits (21), Expect = 0.20 Identities = 21/21 (100%) Strand = Plus / Plus Query: 15 tccattcctttccattccatt 35 ||||||||||||||||||||| Sbjct: 10746 tccattcctttccattccatt 10766 Score = 40.1 bits (20), Expect = 0.78 Identities = 23/24 (95%) Strand = Plus / Minus Query: 15 tccattcctttccattccattcaa 38 |||||||||||| ||||||||||| Sbjct: 40450 tccattcctttcgattccattcaa 40427 Score = 40.1 bits (20), Expect = 0.78 Identities = 20/20 (100%) Strand = Plus / Minus Query: 15 tccattcctttccattccat 34 |||||||||||||||||||| Sbjct: 34380 tccattcctttccattccat 34361 Score = 40.1 bits (20), Expect = 0.78 Identities = 23/24 (95%) Strand = Plus / Minus Query: 15 tccattcctttccattccattcaa 38 ||||||| |||||||||||||||| Sbjct: 23675 tccattcgtttccattccattcaa 23652 Score = 40.1 bits (20), Expect = 0.78 Identities = 23/24 (95%) Strand = Plus / Plus Query: 15 tccattcctttccattccattcaa 38 |||||||| ||||||||||||||| Sbjct: 17457 tccattccattccattccattcaa 17480 Score = 40.1 bits (20), Expect = 0.78 Identities = 20/20 (100%) Strand = Plus / Plus Query: 18 attcctttccattccattca 37 |||||||||||||||||||| Sbjct: 16446 attcctttccattccattca 16465 Score = 40.1 bits (20), Expect = 0.78 Identities = 23/24 (95%) Strand = Plus / Plus Query: 15 tccattcctttccattccattcaa 38 |||||||| ||||||||||||||| Sbjct: 11399 tccattccattccattccattcaa 11422 Score = 40.1 bits (20), Expect = 0.78 Identities = 23/24 (95%) Strand = Plus / Plus Query: 15 tccattcctttccattccattcaa 38 |||||||| ||||||||||||||| Sbjct: 6754 tccattccattccattccattcaa 6777 Score = 40.1 bits (20), Expect = 0.78 Identities = 23/24 (95%) Strand = Plus / Plus Query: 15 tccattcctttccattccattcaa 38 |||| ||||||||||||||||||| Sbjct: 6414 tccagtcctttccattccattcaa 6437 Score = 40.1 bits (20), Expect = 0.78 Identities = 20/20 (100%) Strand = Plus / Plus Query: 18 attcctttccattccattca 37 |||||||||||||||||||| Sbjct: 2338 attcctttccattccattca 2357 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Minus Query: 18 attcctttccattccattc 36 ||||||||||||||||||| Sbjct: 54289 attcctttccattccattc 54271 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Minus Query: 17 cattcctttccattccattcaaa 39 ||||| ||||||||||||||||| Sbjct: 52656 cattcgtttccattccattcaaa 52634 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Minus Query: 18 attcctttccattccattc 36 ||||||||||||||||||| Sbjct: 51067 attcctttccattccattc 51049 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Minus Query: 18 attcctttccattccattc 36 ||||||||||||||||||| Sbjct: 50887 attcctttccattccattc 50869 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Minus Query: 18 attcctttccattccattc 36 ||||||||||||||||||| Sbjct: 49928 attcctttccattccattc 49910 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Minus Query: 15 tccattcctttccattccattca 37 |||||||| |||||||||||||| Sbjct: 48271 tccattccattccattccattca 48249 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Minus Query: 14 atccattcctttccattccattc 36 ||||||||| ||||||||||||| Sbjct: 47854 atccattccattccattccattc 47832 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Minus Query: 18 attcctttccattccattc 36 ||||||||||||||||||| Sbjct: 40272 attcctttccattccattc 40254 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Minus Query: 15 tccattcctttccattccattca 37 ||||||| ||||||||||||||| Sbjct: 39625 tccattcatttccattccattca 39603 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Minus Query: 18 attcctttccattccattc 36 ||||||||||||||||||| Sbjct: 36529 attcctttccattccattc 36511 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Minus Query: 18 attcctttccattccattc 36 ||||||||||||||||||| Sbjct: 33712 attcctttccattccattc 33694 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Minus Query: 18 attcctttccattccattc 36 ||||||||||||||||||| Sbjct: 33241 attcctttccattccattc 33223 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Minus Query: 18 attcctttccattccattc 36 ||||||||||||||||||| Sbjct: 30515 attcctttccattccattc 30497 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Minus Query: 17 cattcctttccattccatt 35 ||||||||||||||||||| Sbjct: 28632 cattcctttccattccatt 28614 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Minus Query: 15 tccattcctttccattccattca 37 |||||||||||||||| |||||| Sbjct: 26180 tccattcctttccatttcattca 26158 Score = 38.2 bits (19), Expect = 3.1 Identities = 25/27 (92%) Strand = Plus / Minus Query: 12 cgatccattcctttccattccattcaa 38 ||||||||||||||| ||||| ||||| Sbjct: 20253 cgatccattcctttcgattccgttcaa 20227 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Plus Query: 18 attcctttccattccattc 36 ||||||||||||||||||| Sbjct: 17620 attcctttccattccattc 17638 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Plus Query: 15 tccattcctttccattccattca 37 |||||||||||||| |||||||| Sbjct: 16483 tccattcctttccactccattca 16505 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Plus Query: 14 atccattcctttccattccattc 36 ||||||||| ||||||||||||| Sbjct: 16392 atccattccattccattccattc 16414 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Plus Query: 18 attcctttccattccattc 36 ||||||||||||||||||| Sbjct: 14124 attcctttccattccattc 14142 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Plus Query: 18 attcctttccattccattc 36 ||||||||||||||||||| Sbjct: 12340 attcctttccattccattc 12358 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Plus Query: 18 attcctttccattccattc 36 ||||||||||||||||||| Sbjct: 9455 attcctttccattccattc 9473 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Plus Query: 18 attcctttccattccattc 36 ||||||||||||||||||| Sbjct: 7871 attcctttccattccattc 7889
>gb|AC073880.5|AC073880 Homo sapiens BAC clone RP11-1136L22 from Y, complete sequence Length = 34210 Score = 46.1 bits (23), Expect = 0.013 Identities = 23/23 (100%) Strand = Plus / Minus Query: 14 atccattcctttccattccattc 36 ||||||||||||||||||||||| Sbjct: 23719 atccattcctttccattccattc 23697 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Minus Query: 17 cattcctttccattccattcaa 38 |||||||||||||||||||||| Sbjct: 31576 cattcctttccattccattcaa 31555 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Minus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 30422 tccattcctttccattccattc 30401 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Minus Query: 17 cattcctttccattccattcaa 38 |||||||||||||||||||||| Sbjct: 27745 cattcctttccattccattcaa 27724 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Minus Query: 17 cattcctttccattccattcaa 38 |||||||||||||||||||||| Sbjct: 24892 cattcctttccattccattcaa 24871 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Minus Query: 17 cattcctttccattccattcaa 38 |||||||||||||||||||||| Sbjct: 22044 cattcctttccattccattcaa 22023 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Minus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 20029 tccattcctttccattccattc 20008 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Minus Query: 17 cattcctttccattccattcaa 38 |||||||||||||||||||||| Sbjct: 19151 cattcctttccattccattcaa 19130 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Minus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 17992 tccattcctttccattccattc 17971 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Minus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 15127 tccattcctttccattccattc 15106 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Minus Query: 17 cattcctttccattccattcaa 38 |||||||||||||||||||||| Sbjct: 12641 cattcctttccattccattcaa 12620 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Minus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 10641 tccattcctttccattccattc 10620 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Minus Query: 17 cattcctttccattccattcaa 38 |||||||||||||||||||||| Sbjct: 9768 cattcctttccattccattcaa 9747 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Minus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 8594 tccattcctttccattccattc 8573 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Minus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 7762 tccattcctttccattccattc 7741 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Minus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 2998 tccattcctttccattccattc 2977 Score = 42.1 bits (21), Expect = 0.20 Identities = 21/21 (100%) Strand = Plus / Minus Query: 15 tccattcctttccattccatt 35 ||||||||||||||||||||| Sbjct: 28619 tccattcctttccattccatt 28599 Score = 40.1 bits (20), Expect = 0.78 Identities = 23/24 (95%) Strand = Plus / Minus Query: 15 tccattcctttccattccattcaa 38 |||||||| ||||||||||||||| Sbjct: 16945 tccattccattccattccattcaa 16922 Score = 40.1 bits (20), Expect = 0.78 Identities = 23/24 (95%) Strand = Plus / Minus Query: 15 tccattcctttccattccattcaa 38 ||||||| |||||||||||||||| Sbjct: 16378 tccattcttttccattccattcaa 16355 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Minus Query: 16 ccattcctttccattccattcaa 38 ||||||||| ||||||||||||| Sbjct: 29833 ccattccttcccattccattcaa 29811 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Minus Query: 18 attcctttccattccattc 36 ||||||||||||||||||| Sbjct: 13318 attcctttccattccattc 13300 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Minus Query: 15 tccattcctttccattccattca 37 |||||||| |||||||||||||| Sbjct: 10706 tccattccattccattccattca 10684 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Minus Query: 15 tccattcctttccattcca 33 ||||||||||||||||||| Sbjct: 1813 tccattcctttccattcca 1795 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Minus Query: 15 tccattcctttccattcca 33 ||||||||||||||||||| Sbjct: 1140 tccattcctttccattcca 1122
>gb|AC138777.3| Homo sapiens BAC clone RP11-1220P14 from 2, complete sequence Length = 220281 Score = 46.1 bits (23), Expect = 0.013 Identities = 23/23 (100%) Strand = Plus / Plus Query: 14 atccattcctttccattccattc 36 ||||||||||||||||||||||| Sbjct: 213033 atccattcctttccattccattc 213055 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Plus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 220002 tccattcctttccattccattc 220023 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Plus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 219882 tccattcctttccattccattc 219903 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Plus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 218627 tccattcctttccattccattc 218648 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Plus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 218168 tccattcctttccattccattc 218189 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Plus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 216764 tccattcctttccattccattc 216785 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Plus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 216559 tccattcctttccattccattc 216580 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Plus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 214685 tccattcctttccattccattc 214706 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Plus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 210541 tccattcctttccattccattc 210562 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Plus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 209292 tccattcctttccattccattc 209313 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Plus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 208000 tccattcctttccattccattc 208021 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Plus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 204349 tccattcctttccattccattc 204370 Score = 42.1 bits (21), Expect = 0.20 Identities = 21/21 (100%) Strand = Plus / Plus Query: 18 attcctttccattccattcaa 38 ||||||||||||||||||||| Sbjct: 218865 attcctttccattccattcaa 218885 Score = 42.1 bits (21), Expect = 0.20 Identities = 21/21 (100%) Strand = Plus / Plus Query: 18 attcctttccattccattcaa 38 ||||||||||||||||||||| Sbjct: 217401 attcctttccattccattcaa 217421 Score = 40.1 bits (20), Expect = 0.78 Identities = 20/20 (100%) Strand = Plus / Plus Query: 17 cattcctttccattccattc 36 |||||||||||||||||||| Sbjct: 220243 cattcctttccattccattc 220262 Score = 40.1 bits (20), Expect = 0.78 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tccattcctttccattccat 34 |||||||||||||||||||| Sbjct: 218652 tccattcctttccattccat 218671 Score = 40.1 bits (20), Expect = 0.78 Identities = 23/24 (95%) Strand = Plus / Plus Query: 15 tccattcctttccattccattcaa 38 |||||||| ||||||||||||||| Sbjct: 217138 tccattccattccattccattcaa 217161 Score = 40.1 bits (20), Expect = 0.78 Identities = 23/24 (95%) Strand = Plus / Plus Query: 15 tccattcctttccattccattcaa 38 |||||||| ||||||||||||||| Sbjct: 210081 tccattccattccattccattcaa 210104 Score = 40.1 bits (20), Expect = 0.78 Identities = 23/24 (95%) Strand = Plus / Plus Query: 15 tccattcctttccattccattcaa 38 |||||| ||||||||||||||||| Sbjct: 209634 tccattgctttccattccattcaa 209657 Score = 40.1 bits (20), Expect = 0.78 Identities = 23/24 (95%) Strand = Plus / Plus Query: 15 tccattcctttccattccattcaa 38 |||||||| ||||||||||||||| Sbjct: 204921 tccattccattccattccattcaa 204944 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Plus Query: 15 tccattcctttccattcca 33 ||||||||||||||||||| Sbjct: 219362 tccattcctttccattcca 219380 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Plus Query: 14 atccattcctttccattccattc 36 ||||||||| ||||||||||||| Sbjct: 219126 atccattccattccattccattc 219148 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Plus Query: 18 attcctttccattccattc 36 ||||||||||||||||||| Sbjct: 218076 attcctttccattccattc 218094 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Plus Query: 18 attcctttccattccattc 36 ||||||||||||||||||| Sbjct: 216677 attcctttccattccattc 216695 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Plus Query: 15 tccattcctttccattccattca 37 |||||||| |||||||||||||| Sbjct: 216374 tccattccattccattccattca 216396 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Plus Query: 15 tccattcctttccattcca 33 ||||||||||||||||||| Sbjct: 216224 tccattcctttccattcca 216242 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Plus Query: 15 tccattcctttccattcca 33 ||||||||||||||||||| Sbjct: 216155 tccattcctttccattcca 216173 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Plus Query: 15 tccattcctttccattccattca 37 |||||||| |||||||||||||| Sbjct: 215660 tccattccattccattccattca 215682 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Plus Query: 18 attcctttccattccattc 36 ||||||||||||||||||| Sbjct: 214149 attcctttccattccattc 214167 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Plus Query: 15 tccattcctttccattccattca 37 |||||||| |||||||||||||| Sbjct: 212904 tccattccattccattccattca 212926 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Plus Query: 14 atccattcctttccattccattc 36 ||||||||| ||||||||||||| Sbjct: 212798 atccattccattccattccattc 212820 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Plus Query: 15 tccattcctttccattccattca 37 |||||||| |||||||||||||| Sbjct: 211689 tccattccattccattccattca 211711 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Plus Query: 15 tccattcctttccattcca 33 ||||||||||||||||||| Sbjct: 211470 tccattcctttccattcca 211488 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Plus Query: 14 atccattcctttccattccattc 36 ||||||||| ||||||||||||| Sbjct: 211140 atccattccgttccattccattc 211162 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Plus Query: 18 attcctttccattccattc 36 ||||||||||||||||||| Sbjct: 210919 attcctttccattccattc 210937 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Plus Query: 14 atccattcctttccattccattc 36 ||||||||| ||||||||||||| Sbjct: 206989 atccattccattccattccattc 207011 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Plus Query: 15 tccattcctttccattccattca 37 |||||||| |||||||||||||| Sbjct: 205884 tccattccattccattccattca 205906 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Plus Query: 15 tccattcctttccattcca 33 ||||||||||||||||||| Sbjct: 205675 tccattcctttccattcca 205693 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Plus Query: 14 atccattcctttccattccattc 36 ||||||||| ||||||||||||| Sbjct: 205335 atccattccgttccattccattc 205357 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Plus Query: 18 attcctttccattccattc 36 ||||||||||||||||||| Sbjct: 205114 attcctttccattccattc 205132
>gb|AC026131.4| Homo sapiens chromosome 11, clone RP11-458M15, complete sequence Length = 174688 Score = 46.1 bits (23), Expect = 0.013 Identities = 23/23 (100%) Strand = Plus / Minus Query: 15 tccattcctttccattccattca 37 ||||||||||||||||||||||| Sbjct: 154535 tccattcctttccattccattca 154513 Score = 46.1 bits (23), Expect = 0.013 Identities = 23/23 (100%) Strand = Plus / Minus Query: 15 tccattcctttccattccattca 37 ||||||||||||||||||||||| Sbjct: 117640 tccattcctttccattccattca 117618 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Minus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 173950 tccattcctttccattccattc 173929 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Minus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 173850 tccattcctttccattccattc 173829 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Minus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 173666 tccattcctttccattccattc 173645 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Minus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 173611 tccattcctttccattccattc 173590 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Minus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 173231 tccattcctttccattccattc 173210 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Minus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 172358 tccattcctttccattccattc 172337 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Minus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 172158 tccattcctttccattccattc 172137 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Minus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 171928 tccattcctttccattccattc 171907 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Minus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 170705 tccattcctttccattccattc 170684 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Minus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 170396 tccattcctttccattccattc 170375 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Minus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 170166 tccattcctttccattccattc 170145 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Minus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 169232 tccattcctttccattccattc 169211 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Minus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 168697 tccattcctttccattccattc 168676 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Minus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 167294 tccattcctttccattccattc 167273 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Minus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 165003 tccattcctttccattccattc 164982 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Minus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 164933 tccattcctttccattccattc 164912 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Minus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 164628 tccattcctttccattccattc 164607 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Minus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 164608 tccattcctttccattccattc 164587 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Minus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 164008 tccattcctttccattccattc 163987 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Minus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 162350 tccattcctttccattccattc 162329 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Minus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 160795 tccattcctttccattccattc 160774 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Minus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 158988 tccattcctttccattccattc 158967 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Minus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 158538 tccattcctttccattccattc 158517 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Minus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 158518 tccattcctttccattccattc 158497 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Minus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 157903 tccattcctttccattccattc 157882 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Minus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 157838 tccattcctttccattccattc 157817 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Minus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 156524 tccattcctttccattccattc 156503 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Minus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 154785 tccattcctttccattccattc 154764 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Minus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 153850 tccattcctttccattccattc 153829 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Minus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 153550 tccattcctttccattccattc 153529 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Minus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 151327 tccattcctttccattccattc 151306 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Minus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 151157 tccattcctttccattccattc 151136 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Minus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 151027 tccattcctttccattccattc 151006 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Minus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 150842 tccattcctttccattccattc 150821 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Minus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 150822 tccattcctttccattccattc 150801 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Minus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 150034 tccattcctttccattccattc 150013 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Minus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 148649 tccattcctttccattccattc 148628 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Minus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 147644 tccattcctttccattccattc 147623 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Minus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 146474 tccattcctttccattccattc 146453 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Minus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 146015 tccattcctttccattccattc 145994 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Minus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 144791 tccattcctttccattccattc 144770 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Minus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 144436 tccattcctttccattccattc 144415 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Minus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 142894 tccattcctttccattccattc 142873 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Minus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 141150 tccattcctttccattccattc 141129 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Minus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 140627 tccattcctttccattccattc 140606 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Minus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 138984 tccattcctttccattccattc 138963 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Minus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 138929 tccattcctttccattccattc 138908 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Minus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 137433 tccattcctttccattccattc 137412 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Minus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 136581 tccattcctttccattccattc 136560 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Minus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 135613 tccattcctttccattccattc 135592 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Minus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 134669 tccattcctttccattccattc 134648 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Minus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 134594 tccattcctttccattccattc 134573 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Minus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 134304 tccattcctttccattccattc 134283 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Minus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 134269 tccattcctttccattccattc 134248 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Minus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 134144 tccattcctttccattccattc 134123 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Minus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 133065 tccattcctttccattccattc 133044 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Minus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 132360 tccattcctttccattccattc 132339 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Minus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 132080 tccattcctttccattccattc 132059 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Minus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 132005 tccattcctttccattccattc 131984 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Minus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 131550 tccattcctttccattccattc 131529 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Minus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 129403 tccattcctttccattccattc 129382 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Minus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 129208 tccattcctttccattccattc 129187 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Minus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 128978 tccattcctttccattccattc 128957 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Minus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 128488 tccattcctttccattccattc 128467 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Minus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 128378 tccattcctttccattccattc 128357 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Minus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 128009 tccattcctttccattccattc 127988 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Minus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 127435 tccattcctttccattccattc 127414 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Minus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 127160 tccattcctttccattccattc 127139 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Minus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 127085 tccattcctttccattccattc 127064 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Minus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 126615 tccattcctttccattccattc 126594 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Minus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 122911 tccattcctttccattccattc 122890 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Minus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 122576 tccattcctttccattccattc 122555 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Minus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 120823 tccattcctttccattccattc 120802 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Minus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 120728 tccattcctttccattccattc 120707 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Minus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 119150 tccattcctttccattccattc 119129 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Minus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 118865 tccattcctttccattccattc 118844 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Minus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 118125 tccattcctttccattccattc 118104 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Minus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 117710 tccattcctttccattccattc 117689 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Minus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 115802 tccattcctttccattccattc 115781 Score = 42.1 bits (21), Expect = 0.20 Identities = 21/21 (100%) Strand = Plus / Minus Query: 15 tccattcctttccattccatt 35 ||||||||||||||||||||| Sbjct: 174180 tccattcctttccattccatt 174160 Score = 42.1 bits (21), Expect = 0.20 Identities = 21/21 (100%) Strand = Plus / Minus Query: 15 tccattcctttccattccatt 35 ||||||||||||||||||||| Sbjct: 160690 tccattcctttccattccatt 160670 Score = 42.1 bits (21), Expect = 0.20 Identities = 21/21 (100%) Strand = Plus / Minus Query: 15 tccattcctttccattccatt 35 ||||||||||||||||||||| Sbjct: 156579 tccattcctttccattccatt 156559 Score = 42.1 bits (21), Expect = 0.20 Identities = 21/21 (100%) Strand = Plus / Minus Query: 15 tccattcctttccattccatt 35 ||||||||||||||||||||| Sbjct: 148339 tccattcctttccattccatt 148319 Score = 42.1 bits (21), Expect = 0.20 Identities = 21/21 (100%) Strand = Plus / Minus Query: 15 tccattcctttccattccatt 35 ||||||||||||||||||||| Sbjct: 142205 tccattcctttccattccatt 142185 Score = 42.1 bits (21), Expect = 0.20 Identities = 21/21 (100%) Strand = Plus / Minus Query: 15 tccattcctttccattccatt 35 ||||||||||||||||||||| Sbjct: 116510 tccattcctttccattccatt 116490 Score = 40.1 bits (20), Expect = 0.78 Identities = 23/24 (95%) Strand = Plus / Minus Query: 14 atccattcctttccattccattca 37 ||||||||| |||||||||||||| Sbjct: 171399 atccattccattccattccattca 171376 Score = 40.1 bits (20), Expect = 0.78 Identities = 20/20 (100%) Strand = Plus / Minus Query: 17 cattcctttccattccattc 36 |||||||||||||||||||| Sbjct: 168202 cattcctttccattccattc 168183 Score = 40.1 bits (20), Expect = 0.78 Identities = 23/24 (95%) Strand = Plus / Minus Query: 15 tccattcctttccattccattcaa 38 |||||||| ||||||||||||||| Sbjct: 161850 tccattccattccattccattcaa 161827 Score = 40.1 bits (20), Expect = 0.78 Identities = 23/24 (95%) Strand = Plus / Minus Query: 15 tccattcctttccattccattcaa 38 ||||||| |||||||||||||||| Sbjct: 161715 tccattcgtttccattccattcaa 161692 Score = 40.1 bits (20), Expect = 0.78 Identities = 23/24 (95%) Strand = Plus / Minus Query: 15 tccattcctttccattccattcaa 38 |||||||| ||||||||||||||| Sbjct: 159773 tccattccattccattccattcaa 159750 Score = 40.1 bits (20), Expect = 0.78 Identities = 20/20 (100%) Strand = Plus / Minus Query: 15 tccattcctttccattccat 34 |||||||||||||||||||| Sbjct: 157518 tccattcctttccattccat 157499 Score = 40.1 bits (20), Expect = 0.78 Identities = 23/24 (95%) Strand = Plus / Minus Query: 15 tccattcctttccattccattcaa 38 |||||||| ||||||||||||||| Sbjct: 156818 tccattccattccattccattcaa 156795 Score = 40.1 bits (20), Expect = 0.78 Identities = 20/20 (100%) Strand = Plus / Minus Query: 17 cattcctttccattccattc 36 |||||||||||||||||||| Sbjct: 150087 cattcctttccattccattc 150068 Score = 40.1 bits (20), Expect = 0.78 Identities = 23/24 (95%) Strand = Plus / Minus Query: 15 tccattcctttccattccattcaa 38 |||||||| ||||||||||||||| Sbjct: 147284 tccattccattccattccattcaa 147261 Score = 40.1 bits (20), Expect = 0.78 Identities = 23/24 (95%) Strand = Plus / Minus Query: 15 tccattcctttccattccattcaa 38 ||||||| |||||||||||||||| Sbjct: 145365 tccattcgtttccattccattcaa 145342 Score = 40.1 bits (20), Expect = 0.78 Identities = 20/20 (100%) Strand = Plus / Minus Query: 15 tccattcctttccattccat 34 |||||||||||||||||||| Sbjct: 141180 tccattcctttccattccat 141161 Score = 40.1 bits (20), Expect = 0.78 Identities = 20/20 (100%) Strand = Plus / Minus Query: 15 tccattcctttccattccat 34 |||||||||||||||||||| Sbjct: 138660 tccattcctttccattccat 138641 Score = 40.1 bits (20), Expect = 0.78 Identities = 23/24 (95%) Strand = Plus / Minus Query: 15 tccattcctttccattccattcaa 38 |||||||| ||||||||||||||| Sbjct: 134534 tccattccattccattccattcaa 134511 Score = 40.1 bits (20), Expect = 0.78 Identities = 20/20 (100%) Strand = Plus / Minus Query: 17 cattcctttccattccattc 36 |||||||||||||||||||| Sbjct: 134377 cattcctttccattccattc 134358 Score = 40.1 bits (20), Expect = 0.78 Identities = 23/24 (95%) Strand = Plus / Minus Query: 15 tccattcctttccattccattcaa 38 |||||||| ||||||||||||||| Sbjct: 130872 tccattccattccattccattcaa 130849 Score = 40.1 bits (20), Expect = 0.78 Identities = 23/24 (95%) Strand = Plus / Minus Query: 15 tccattcctttccattccattcaa 38 |||||||| ||||||||||||||| Sbjct: 129663 tccattccattccattccattcaa 129640 Score = 40.1 bits (20), Expect = 0.78 Identities = 23/24 (95%) Strand = Plus / Minus Query: 15 tccattcctttccattccattcaa 38 |||||||| ||||||||||||||| Sbjct: 125932 tccattccattccattccattcaa 125909 Score = 40.1 bits (20), Expect = 0.78 Identities = 20/20 (100%) Strand = Plus / Minus Query: 17 cattcctttccattccattc 36 |||||||||||||||||||| Sbjct: 123838 cattcctttccattccattc 123819 Score = 40.1 bits (20), Expect = 0.78 Identities = 23/24 (95%) Strand = Plus / Minus Query: 14 atccattcctttccattccattca 37 ||||||||| |||||||||||||| Sbjct: 121703 atccattccattccattccattca 121680 Score = 40.1 bits (20), Expect = 0.78 Identities = 23/24 (95%) Strand = Plus / Minus Query: 14 atccattcctttccattccattca 37 ||||||||| |||||||||||||| Sbjct: 120234 atccattccattccattccattca 120211 Score = 40.1 bits (20), Expect = 0.78 Identities = 23/24 (95%) Strand = Plus / Minus Query: 14 atccattcctttccattccattca 37 ||||||||| |||||||||||||| Sbjct: 116037 atccattccattccattccattca 116014 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Minus Query: 14 atccattcctttccattccattc 36 ||||||||| ||||||||||||| Sbjct: 173971 atccattccattccattccattc 173949 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Minus Query: 15 tccattcctttccattccattca 37 |||||||| |||||||||||||| Sbjct: 173351 tccattccattccattccattca 173329 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Minus Query: 15 tccattcctttccattccattca 37 |||||||| |||||||||||||| Sbjct: 172767 tccattccattccattccattca 172745 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Minus Query: 15 tccattcctttccattccattca 37 |||||||| |||||||||||||| Sbjct: 171783 tccattccattccattccattca 171761 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Minus Query: 15 tccattcctttccattccattca 37 |||||||| |||||||||||||| Sbjct: 171369 tccattccattccattccattca 171347 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Minus Query: 14 atccattcctttccattccattc 36 ||||||||| ||||||||||||| Sbjct: 171320 atccattccattccattccattc 171298 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Minus Query: 18 attcctttccattccattc 36 ||||||||||||||||||| Sbjct: 170338 attcctttccattccattc 170320 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Minus Query: 14 atccattcctttccattccattc 36 ||||||||| ||||||||||||| Sbjct: 169543 atccattccgttccattccattc 169521 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Minus Query: 14 atccattcctttccattccattc 36 ||||||||| ||||||||||||| Sbjct: 169503 atccattccattccattccattc 169481 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Minus Query: 15 tccattcctttccattccattca 37 |||||||| |||||||||||||| Sbjct: 168687 tccattccattccattccattca 168665 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Minus Query: 18 attcctttccattccattc 36 ||||||||||||||||||| Sbjct: 168570 attcctttccattccattc 168552 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Minus Query: 15 tccattcctttccattccattca 37 |||||||| |||||||||||||| Sbjct: 168548 tccattccattccattccattca 168526 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Minus Query: 15 tccattcctttccattccattca 37 |||||||| |||||||||||||| Sbjct: 167974 tccattccattccattccattca 167952 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Minus Query: 15 tccattcctttccattccattca 37 |||||||| |||||||||||||| Sbjct: 167587 tccattccattccattccattca 167565 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Minus Query: 18 attcctttccattccattc 36 ||||||||||||||||||| Sbjct: 167271 attcctttccattccattc 167253 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Minus Query: 15 tccattcctttccattccattca 37 |||||||| |||||||||||||| Sbjct: 166664 tccattccattccattccattca 166642 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Minus Query: 14 atccattcctttccattccattc 36 ||||||||| ||||||||||||| Sbjct: 166152 atccattccattccattccattc 166130 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Minus Query: 14 atccattcctttccattccattc 36 ||||||||| ||||||||||||| Sbjct: 165402 atccattccattccattccattc 165380 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Minus Query: 15 tccattcctttccattccattca 37 |||||||| |||||||||||||| Sbjct: 164118 tccattccattccattccattca 164096 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Minus Query: 15 tccattcctttccattccattca 37 |||||||| |||||||||||||| Sbjct: 163773 tccattccattccattccattca 163751 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Minus Query: 14 atccattcctttccattccattc 36 ||||||||| ||||||||||||| Sbjct: 163695 atccattccattccattccattc 163673 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Minus Query: 15 tccattcctttccattccattca 37 |||||||| |||||||||||||| Sbjct: 162529 tccattccattccattccattca 162507 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Minus Query: 14 atccattcctttccattccattc 36 ||||||||| ||||||||||||| Sbjct: 161946 atccattccattccattccattc 161924 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Minus Query: 15 tccattcctttccattccattca 37 |||||||| |||||||||||||| Sbjct: 161770 tccattccattccattccattca 161748 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Minus Query: 15 tccattcctttccattcca 33 ||||||||||||||||||| Sbjct: 161485 tccattcctttccattcca 161467 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Minus Query: 14 atccattcctttccattccattc 36 ||||||||| ||||||||||||| Sbjct: 158229 atccattccattccattccattc 158207 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Minus Query: 15 tccattcctttccattcca 33 ||||||||||||||||||| Sbjct: 157688 tccattcctttccattcca 157670 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Minus Query: 15 tccattcctttccattccattca 37 |||||||| |||||||||||||| Sbjct: 157638 tccattccattccattccattca 157616 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Minus Query: 14 atccattcctttccattccattc 36 ||||||||| ||||||||||||| Sbjct: 157194 atccattccattccattccattc 157172 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Minus Query: 15 tccattcctttccattcca 33 ||||||||||||||||||| Sbjct: 156918 tccattcctttccattcca 156900 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Minus Query: 14 atccattcctttccattccattc 36 ||||||||| ||||||||||||| Sbjct: 156140 atccattccattccattccattc 156118 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Minus Query: 18 attcctttccattccattc 36 ||||||||||||||||||| Sbjct: 156051 attcctttccattccattc 156033 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Minus Query: 18 attcctttccattccattc 36 ||||||||||||||||||| Sbjct: 155176 attcctttccattccattc 155158 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Minus Query: 15 tccattcctttccattccattca 37 |||||||| |||||||||||||| Sbjct: 155149 tccattccattccattccattca 155127 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Minus Query: 15 tccattcctttccattccattca 37 |||||||| |||||||||||||| Sbjct: 154172 tccattccattccattccattca 154150 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Minus Query: 15 tccattcctttccattccattca 37 |||||||| |||||||||||||| Sbjct: 154138 tccattccattccattccattca 154116 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Minus Query: 18 attcctttccattccattc 36 ||||||||||||||||||| Sbjct: 153827 attcctttccattccattc 153809 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Minus Query: 15 tccattcctttccattccattca 37 |||||||| |||||||||||||| Sbjct: 153261 tccattccattccattccattca 153239 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Minus Query: 14 atccattcctttccattccattc 36 ||||||||| ||||||||||||| Sbjct: 150478 atccattccattccattccattc 150456 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Minus Query: 15 tccattcctttccattccattca 37 |||||||| |||||||||||||| Sbjct: 150467 tccattccattccattccattca 150445 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Minus Query: 15 tccattcctttccattccattca 37 |||||||| |||||||||||||| Sbjct: 149824 tccattccattccattccattca 149802 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Minus Query: 14 atccattcctttccattccattc 36 ||||||||| ||||||||||||| Sbjct: 149730 atccattccattccattccattc 149708 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Minus Query: 15 tccattcctttccattccattca 37 |||||||| |||||||||||||| Sbjct: 149714 tccattccattccattccattca 149692 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Minus Query: 14 atccattcctttccattccattc 36 ||||||||| ||||||||||||| Sbjct: 149605 atccattccattccattccattc 149583 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Minus Query: 15 tccattcctttccattccattca 37 |||||||| |||||||||||||| Sbjct: 149589 tccattccattccattccattca 149567 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Minus Query: 14 atccattcctttccattccattc 36 ||||||||| ||||||||||||| Sbjct: 149490 atccattccattccattccattc 149468 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Minus Query: 15 tccattcctttccattcca 33 ||||||||||||||||||| Sbjct: 147909 tccattcctttccattcca 147891 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Minus Query: 15 tccattcctttccattcca 33 ||||||||||||||||||| Sbjct: 147849 tccattcctttccattcca 147831 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Minus Query: 15 tccattcctttccattcca 33 ||||||||||||||||||| Sbjct: 145590 tccattcctttccattcca 145572 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Minus Query: 15 tccattcctttccattccattca 37 |||||||| |||||||||||||| Sbjct: 145420 tccattccattccattccattca 145398 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Minus Query: 15 tccattcctttccattcca 33 ||||||||||||||||||| Sbjct: 145136 tccattcctttccattcca 145118 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Minus Query: 14 atccattcctttccattccattc 36 ||||||||| ||||||||||||| Sbjct: 143095 atccattccattccattccattc 143073 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Minus Query: 15 tccattcctttccattcca 33 ||||||||||||||||||| Sbjct: 142994 tccattcctttccattcca 142976 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Minus Query: 14 atccattcctttccattccattc 36 ||||||||| ||||||||||||| Sbjct: 139728 atccattccattccattccattc 139706 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Minus Query: 14 atccattcctttccattccattc 36 ||||||||| ||||||||||||| Sbjct: 139303 atccattccattccattccattc 139281 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Minus Query: 15 tccattcctttccattccattca 37 |||||||| |||||||||||||| Sbjct: 139297 tccattccattccattccattca 139275 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Minus Query: 14 atccattcctttccattccattc 36 ||||||||| ||||||||||||| Sbjct: 139169 atccattccattccattccattc 139147 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Minus Query: 15 tccattcctttccattccattca 37 |||||||| |||||||||||||| Sbjct: 137274 tccattccattccattccattca 137252 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Minus Query: 15 tccattcctttccattccattca 37 ||||||| ||||||||||||||| Sbjct: 136561 tccattcatttccattccattca 136539 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Minus Query: 15 tccattcctttccattccattca 37 |||||||||||||| |||||||| Sbjct: 136412 tccattcctttccagtccattca 136390 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Minus Query: 14 atccattcctttccattccattc 36 ||||||||| ||||||||||||| Sbjct: 135390 atccattccattccattccattc 135368 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Minus Query: 14 atccattcctttccattccattc 36 ||||||||| ||||||||||||| Sbjct: 135335 atccattccattccattccattc 135313 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Minus Query: 15 tccattcctttccattccattca 37 ||||||| ||||||||||||||| Sbjct: 134124 tccattcatttccattccattca 134102 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Minus Query: 15 tccattcctttccattccattca 37 |||||||| |||||||||||||| Sbjct: 133175 tccattccattccattccattca 133153 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Minus Query: 15 tccattcctttccattccattca 37 ||||||| ||||||||||||||| Sbjct: 131530 tccattcatttccattccattca 131508 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Minus Query: 15 tccattcctttccattccattca 37 |||||||| |||||||||||||| Sbjct: 131441 tccattccattccattccattca 131419 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Minus Query: 18 attcctttccattccattc 36 ||||||||||||||||||| Sbjct: 128550 attcctttccattccattc 128532 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Minus Query: 15 tccattcctttccattccattca 37 ||||||| ||||||||||||||| Sbjct: 128233 tccattcatttccattccattca 128211 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Minus Query: 15 tccattcctttccattccattca 37 ||||||| ||||||||||||||| Sbjct: 126595 tccattcatttccattccattca 126573 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Minus Query: 15 tccattcctttccattccattca 37 |||||||| |||||||||||||| Sbjct: 126501 tccattccattccattccattca 126479 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Minus Query: 15 tccattcctttccattccattca 37 |||||||| |||||||||||||| Sbjct: 122691 tccattccattccattccattca 122669 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Minus Query: 15 tccattcctttccattccattca 37 |||||||| |||||||||||||| Sbjct: 121991 tccattccgttccattccattca 121969 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Minus Query: 14 atccattcctttccattccattc 36 ||||||||| ||||||||||||| Sbjct: 121908 atccattccattccattccattc 121886 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Minus Query: 14 atccattcctttccattccattc 36 ||||||||| ||||||||||||| Sbjct: 121639 atccattccattccattccattc 121617 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Minus Query: 14 atccattcctttccattccattc 36 ||||||||| ||||||||||||| Sbjct: 116966 atccattccattccattccattc 116944 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Minus Query: 18 attcctttccattccattc 36 ||||||||||||||||||| Sbjct: 116842 attcctttccattccattc 116824 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Minus Query: 15 tccattcctttccattccattca 37 |||||||| |||||||||||||| Sbjct: 116370 tccattccattccattccattca 116348
>gb|AC119751.3| Homo sapiens BAC clone RP11-241F15 from 4, complete sequence Length = 171176 Score = 46.1 bits (23), Expect = 0.013 Identities = 23/23 (100%) Strand = Plus / Minus Query: 15 tccattcctttccattccattca 37 ||||||||||||||||||||||| Sbjct: 165313 tccattcctttccattccattca 165291 Score = 46.1 bits (23), Expect = 0.013 Identities = 23/23 (100%) Strand = Plus / Minus Query: 14 atccattcctttccattccattc 36 ||||||||||||||||||||||| Sbjct: 152716 atccattcctttccattccattc 152694 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Minus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 171047 tccattcctttccattccattc 171026 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Minus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 168599 tccattcctttccattccattc 168578 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Minus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 167980 tccattcctttccattccattc 167959 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Minus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 166977 tccattcctttccattccattc 166956 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Minus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 166677 tccattcctttccattccattc 166656 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Minus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 164954 tccattcctttccattccattc 164933 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Minus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 163680 tccattcctttccattccattc 163659 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Minus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 161432 tccattcctttccattccattc 161411 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Minus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 159319 tccattcctttccattccattc 159298 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Minus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 159064 tccattcctttccattccattc 159043 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Minus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 158825 tccattcctttccattccattc 158804 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Minus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 158026 tccattcctttccattccattc 158005 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Minus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 157577 tccattcctttccattccattc 157556 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Minus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 156036 tccattcctttccattccattc 156015 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Minus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 155866 tccattcctttccattccattc 155845 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Minus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 153139 tccattcctttccattccattc 153118 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Minus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 151942 tccattcctttccattccattc 151921 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Minus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 150609 tccattcctttccattccattc 150588 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Minus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 150499 tccattcctttccattccattc 150478 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Minus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 145807 tccattcctttccattccattc 145786 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Minus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 145277 tccattcctttccattccattc 145256 Score = 42.1 bits (21), Expect = 0.20 Identities = 21/21 (100%) Strand = Plus / Minus Query: 15 tccattcctttccattccatt 35 ||||||||||||||||||||| Sbjct: 169114 tccattcctttccattccatt 169094 Score = 42.1 bits (21), Expect = 0.20 Identities = 21/21 (100%) Strand = Plus / Minus Query: 18 attcctttccattccattcaa 38 ||||||||||||||||||||| Sbjct: 166475 attcctttccattccattcaa 166455 Score = 42.1 bits (21), Expect = 0.20 Identities = 24/25 (96%) Strand = Plus / Minus Query: 12 cgatccattcctttccattccattc 36 ||||||||||| ||||||||||||| Sbjct: 162094 cgatccattccattccattccattc 162070 Score = 42.1 bits (21), Expect = 0.20 Identities = 24/25 (96%) Strand = Plus / Minus Query: 12 cgatccattcctttccattccattc 36 ||||||||||| ||||||||||||| Sbjct: 156418 cgatccattccattccattccattc 156394 Score = 42.1 bits (21), Expect = 0.20 Identities = 21/21 (100%) Strand = Plus / Minus Query: 15 tccattcctttccattccatt 35 ||||||||||||||||||||| Sbjct: 148212 tccattcctttccattccatt 148192 Score = 42.1 bits (21), Expect = 0.20 Identities = 21/21 (100%) Strand = Plus / Minus Query: 15 tccattcctttccattccatt 35 ||||||||||||||||||||| Sbjct: 147104 tccattcctttccattccatt 147084 Score = 40.1 bits (20), Expect = 0.78 Identities = 20/20 (100%) Strand = Plus / Minus Query: 15 tccattcctttccattccat 34 |||||||||||||||||||| Sbjct: 167222 tccattcctttccattccat 167203 Score = 40.1 bits (20), Expect = 0.78 Identities = 20/20 (100%) Strand = Plus / Minus Query: 19 ttcctttccattccattcaa 38 |||||||||||||||||||| Sbjct: 165339 ttcctttccattccattcaa 165320 Score = 40.1 bits (20), Expect = 0.78 Identities = 20/20 (100%) Strand = Plus / Minus Query: 17 cattcctttccattccattc 36 |||||||||||||||||||| Sbjct: 165292 cattcctttccattccattc 165273 Score = 40.1 bits (20), Expect = 0.78 Identities = 23/24 (95%) Strand = Plus / Minus Query: 15 tccattcctttccattccattcaa 38 |||||||| ||||||||||||||| Sbjct: 164835 tccattccattccattccattcaa 164812 Score = 40.1 bits (20), Expect = 0.78 Identities = 23/24 (95%) Strand = Plus / Minus Query: 13 gatccattcctttccattccattc 36 |||||||||| ||||||||||||| Sbjct: 163842 gatccattccattccattccattc 163819 Score = 40.1 bits (20), Expect = 0.78 Identities = 23/24 (95%) Strand = Plus / Minus Query: 15 tccattcctttccattccattcaa 38 |||||||| ||||||||||||||| Sbjct: 162391 tccattccattccattccattcaa 162368 Score = 40.1 bits (20), Expect = 0.78 Identities = 20/20 (100%) Strand = Plus / Minus Query: 17 cattcctttccattccattc 36 |||||||||||||||||||| Sbjct: 159437 cattcctttccattccattc 159418 Score = 40.1 bits (20), Expect = 0.78 Identities = 23/24 (95%) Strand = Plus / Minus Query: 15 tccattcctttccattccattcaa 38 |||||||| ||||||||||||||| Sbjct: 158925 tccattccattccattccattcaa 158902 Score = 40.1 bits (20), Expect = 0.78 Identities = 23/24 (95%) Strand = Plus / Minus Query: 15 tccattcctttccattccattcaa 38 |||||||| ||||||||||||||| Sbjct: 156773 tccattccattccattccattcaa 156750 Score = 40.1 bits (20), Expect = 0.78 Identities = 20/20 (100%) Strand = Plus / Minus Query: 17 cattcctttccattccattc 36 |||||||||||||||||||| Sbjct: 153487 cattcctttccattccattc 153468 Score = 40.1 bits (20), Expect = 0.78 Identities = 20/20 (100%) Strand = Plus / Minus Query: 15 tccattcctttccattccat 34 |||||||||||||||||||| Sbjct: 152207 tccattcctttccattccat 152188 Score = 40.1 bits (20), Expect = 0.78 Identities = 23/24 (95%) Strand = Plus / Minus Query: 15 tccattcctttccattccattcaa 38 |||||||| ||||||||||||||| Sbjct: 148672 tccattccattccattccattcaa 148649 Score = 40.1 bits (20), Expect = 0.78 Identities = 20/20 (100%) Strand = Plus / Minus Query: 17 cattcctttccattccattc 36 |||||||||||||||||||| Sbjct: 147382 cattcctttccattccattc 147363 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Minus Query: 18 attcctttccattccattc 36 ||||||||||||||||||| Sbjct: 170819 attcctttccattccattc 170801 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Minus Query: 18 attcctttccattccattc 36 ||||||||||||||||||| Sbjct: 169091 attcctttccattccattc 169073 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Minus Query: 15 tccattcctttccattccattca 37 |||| |||||||||||||||||| Sbjct: 168444 tccactcctttccattccattca 168422 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Minus Query: 18 attcctttccattccattc 36 ||||||||||||||||||| Sbjct: 167129 attcctttccattccattc 167111 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Minus Query: 18 attcctttccattccattc 36 ||||||||||||||||||| Sbjct: 166799 attcctttccattccattc 166781 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Minus Query: 18 attcctttccattccattc 36 ||||||||||||||||||| Sbjct: 166030 attcctttccattccattc 166012 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Minus Query: 18 attcctttccattccattc 36 ||||||||||||||||||| Sbjct: 165685 attcctttccattccattc 165667 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Minus Query: 14 atccattcctttccattccattc 36 ||||||||| ||||||||||||| Sbjct: 165419 atccattccattccattccattc 165397 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Minus Query: 14 atccattcctttccattccattc 36 ||||||||| ||||||||||||| Sbjct: 164309 atccattccattccattccattc 164287 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Minus Query: 18 attcctttccattccattc 36 ||||||||||||||||||| Sbjct: 163757 attcctttccattccattc 163739 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Minus Query: 18 attcctttccattccattc 36 ||||||||||||||||||| Sbjct: 160839 attcctttccattccattc 160821 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Minus Query: 18 attcctttccattccattc 36 ||||||||||||||||||| Sbjct: 160484 attcctttccattccattc 160466 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Minus Query: 18 attcctttccattccattc 36 ||||||||||||||||||| Sbjct: 160120 attcctttccattccattc 160102 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Minus Query: 18 attcctttccattccattc 36 ||||||||||||||||||| Sbjct: 159765 attcctttccattccattc 159747 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Minus Query: 14 atccattcctttccattccattc 36 ||||||||| ||||||||||||| Sbjct: 159484 atccattccattccattccattc 159462 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Minus Query: 15 tccattcctttccattccattca 37 |||||||| |||||||||||||| Sbjct: 159458 tccattccattccattccattca 159436 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Minus Query: 15 tccattcctttccattcca 33 ||||||||||||||||||| Sbjct: 159029 tccattcctttccattcca 159011 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Minus Query: 15 tccattcctttccattccattca 37 |||||||| |||||||||||||| Sbjct: 158666 tccattccattccattccattca 158644 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Minus Query: 15 tccattcctttccattccattca 37 |||||||| |||||||||||||| Sbjct: 158526 tccattccattccattccattca 158504 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Minus Query: 18 attcctttccattccattc 36 ||||||||||||||||||| Sbjct: 158233 attcctttccattccattc 158215 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Minus Query: 14 atccattcctttccattccattc 36 ||||||||| ||||||||||||| Sbjct: 157898 atccattccattccattccattc 157876 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Minus Query: 18 attcctttccattccattc 36 ||||||||||||||||||| Sbjct: 157694 attcctttccattccattc 157676 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Minus Query: 14 atccattcctttccattccattc 36 ||||||||| ||||||||||||| Sbjct: 155134 atccattccattccattccattc 155112 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Minus Query: 18 attcctttccattccattc 36 ||||||||||||||||||| Sbjct: 155020 attcctttccattccattc 155002 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Minus Query: 14 atccattcctttccattccattc 36 ||||||||| ||||||||||||| Sbjct: 154954 atccattccattccattccattc 154932 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Minus Query: 18 attcctttccattccattc 36 ||||||||||||||||||| Sbjct: 154780 attcctttccattccattc 154762 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Minus Query: 18 attcctttccattccattc 36 ||||||||||||||||||| Sbjct: 154345 attcctttccattccattc 154327 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Minus Query: 18 attcctttccattccattc 36 ||||||||||||||||||| Sbjct: 153985 attcctttccattccattc 153967 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Minus Query: 14 atccattcctttccattccattc 36 ||||||||| ||||||||||||| Sbjct: 153949 atccattccgttccattccattc 153927 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Minus Query: 18 attcctttccattccattc 36 ||||||||||||||||||| Sbjct: 153855 attcctttccattccattc 153837 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Minus Query: 15 tccattcctttccattccattca 37 |||||||| |||||||||||||| Sbjct: 153508 tccattccattccattccattca 153486 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Minus Query: 15 tccattcctttccattcca 33 ||||||||||||||||||| Sbjct: 153104 tccattcctttccattcca 153086 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Minus Query: 18 attcctttccattccattc 36 ||||||||||||||||||| Sbjct: 152807 attcctttccattccattc 152789 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Minus Query: 18 attcctttccattccattc 36 ||||||||||||||||||| Sbjct: 152329 attcctttccattccattc 152311 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Minus Query: 18 attcctttccattccattc 36 ||||||||||||||||||| Sbjct: 151635 attcctttccattccattc 151617 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Minus Query: 18 attcctttccattccattc 36 ||||||||||||||||||| Sbjct: 151345 attcctttccattccattc 151327 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Minus Query: 15 tccattcctttccattccattca 37 |||||||| |||||||||||||| Sbjct: 151318 tccattccattccattccattca 151296 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Minus Query: 14 atccattcctttccattccattc 36 ||||||||| ||||||||||||| Sbjct: 151024 atccattccattccattccattc 151002 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Minus Query: 15 tccattcctttccattcca 33 ||||||||||||||||||| Sbjct: 150913 tccattcctttccattcca 150895 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Minus Query: 18 attcctttccattccattc 36 ||||||||||||||||||| Sbjct: 150621 attcctttccattccattc 150603 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Minus Query: 15 tccattcctttccattcca 33 ||||||||||||||||||| Sbjct: 150544 tccattcctttccattcca 150526 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Minus Query: 15 tccattcctttccattccattca 37 |||||||| |||||||||||||| Sbjct: 150049 tccattccattccattccattca 150027 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Minus Query: 18 attcctttccattccattc 36 ||||||||||||||||||| Sbjct: 150021 attcctttccattccattc 150003 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Minus Query: 18 attcctttccattccattc 36 ||||||||||||||||||| Sbjct: 148469 attcctttccattccattc 148451 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Minus Query: 18 attcctttccattccattc 36 ||||||||||||||||||| Sbjct: 147729 attcctttccattccattc 147711 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Minus Query: 15 tccattcctttccattcca 33 ||||||||||||||||||| Sbjct: 146914 tccattcctttccattcca 146896 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Minus Query: 15 tccattcctttccattccattca 37 |||||||| |||||||||||||| Sbjct: 146770 tccattccattccattccattca 146748 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Minus Query: 18 attcctttccattccattc 36 ||||||||||||||||||| Sbjct: 146453 attcctttccattccattc 146435 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Minus Query: 15 tccattcctttccattccattca 37 ||||||| ||||||||||||||| Sbjct: 146176 tccattcttttccattccattca 146154 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Minus Query: 18 attcctttccattccattc 36 ||||||||||||||||||| Sbjct: 145924 attcctttccattccattc 145906 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Minus Query: 15 tccattcctttccattccattca 37 |||||||| |||||||||||||| Sbjct: 145412 tccattccattccattccattca 145390 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Minus Query: 15 tccattcctttccattcca 33 ||||||||||||||||||| Sbjct: 144435 tccattcctttccattcca 144417
>gb|AY598347.1| Homo sapiens heterochromatic block map Yq12 transcribed DYZ1 sequence mRNA, partial sequence Length = 770 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Plus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 297 tccattcctttccattccattc 318 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Plus Query: 18 attcctttccattccattc 36 ||||||||||||||||||| Sbjct: 671 attcctttccattccattc 689
>gb|AY598345.1| Homo sapiens heterochromatic block map Yq12 DYZ1 partial sequence Length = 2189 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Minus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 1081 tccattcctttccattccattc 1060 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Minus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 415 tccattcctttccattccattc 394 Score = 40.1 bits (20), Expect = 0.78 Identities = 23/24 (95%) Strand = Plus / Minus Query: 15 tccattcctttccattccattcaa 38 |||||||| ||||||||||||||| Sbjct: 1968 tccattccattccattccattcaa 1945 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Minus Query: 18 attcctttccattccattc 36 ||||||||||||||||||| Sbjct: 41 attcctttccattccattc 23
>gb|AF110368.1| Homo sapiens chromosome 9 map 9q11 sequence Length = 1395 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Minus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 573 tccattcctttccattccattc 552 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Minus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 203 tccattcctttccattccattc 182 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Minus Query: 14 atccattcctttccattccattc 36 ||||||||| ||||||||||||| Sbjct: 429 atccattccattccattccattc 407
>gb|AC150278.1| Pan troglodytes BAC clone CH251-126G17 from Y, complete sequence Length = 171976 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Minus Query: 17 cattcctttccattccattcaa 38 |||||||||||||||||||||| Sbjct: 24846 cattcctttccattccattcaa 24825 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Minus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 12040 tccattcctttccattccattc 12019 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Minus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 322 tccattcctttccattccattc 301 Score = 42.1 bits (21), Expect = 0.20 Identities = 21/21 (100%) Strand = Plus / Minus Query: 15 tccattcctttccattccatt 35 ||||||||||||||||||||| Sbjct: 20901 tccattcctttccattccatt 20881 Score = 42.1 bits (21), Expect = 0.20 Identities = 21/21 (100%) Strand = Plus / Minus Query: 15 tccattcctttccattccatt 35 ||||||||||||||||||||| Sbjct: 20856 tccattcctttccattccatt 20836 Score = 40.1 bits (20), Expect = 0.78 Identities = 23/24 (95%) Strand = Plus / Minus Query: 15 tccattcctttccattccattcaa 38 |||||||| ||||||||||||||| Sbjct: 26877 tccattccattccattccattcaa 26854 Score = 40.1 bits (20), Expect = 0.78 Identities = 23/24 (95%) Strand = Plus / Minus Query: 15 tccattcctttccattccattcaa 38 |||||| ||||||||||||||||| Sbjct: 26151 tccatttctttccattccattcaa 26128 Score = 40.1 bits (20), Expect = 0.78 Identities = 23/24 (95%) Strand = Plus / Minus Query: 15 tccattcctttccattccattcaa 38 |||||||| ||||||||||||||| Sbjct: 18643 tccattccattccattccattcaa 18620 Score = 40.1 bits (20), Expect = 0.78 Identities = 23/24 (95%) Strand = Plus / Minus Query: 15 tccattcctttccattccattcaa 38 |||||||| ||||||||||||||| Sbjct: 17884 tccattcccttccattccattcaa 17861 Score = 40.1 bits (20), Expect = 0.78 Identities = 23/24 (95%) Strand = Plus / Minus Query: 15 tccattcctttccattccattcaa 38 ||||||||||| |||||||||||| Sbjct: 17629 tccattcctttgcattccattcaa 17606 Score = 40.1 bits (20), Expect = 0.78 Identities = 20/20 (100%) Strand = Plus / Minus Query: 19 ttcctttccattccattcaa 38 |||||||||||||||||||| Sbjct: 16851 ttcctttccattccattcaa 16832 Score = 40.1 bits (20), Expect = 0.78 Identities = 23/24 (95%) Strand = Plus / Minus Query: 15 tccattcctttccattccattcaa 38 |||||||| ||||||||||||||| Sbjct: 14624 tccattccattccattccattcaa 14601 Score = 40.1 bits (20), Expect = 0.78 Identities = 23/24 (95%) Strand = Plus / Minus Query: 15 tccattcctttccattccattcaa 38 |||||||||| ||||||||||||| Sbjct: 12025 tccattccttcccattccattcaa 12002 Score = 40.1 bits (20), Expect = 0.78 Identities = 23/24 (95%) Strand = Plus / Minus Query: 12 cgatccattcctttccattccatt 35 ||||||||||| |||||||||||| Sbjct: 11858 cgatccattccattccattccatt 11835 Score = 40.1 bits (20), Expect = 0.78 Identities = 23/24 (95%) Strand = Plus / Minus Query: 15 tccattcctttccattccattcaa 38 ||||||| |||||||||||||||| Sbjct: 10450 tccattcatttccattccattcaa 10427 Score = 40.1 bits (20), Expect = 0.78 Identities = 23/24 (95%) Strand = Plus / Minus Query: 15 tccattcctttccattccattcaa 38 |||||||| ||||||||||||||| Sbjct: 5899 tccattccattccattccattcaa 5876 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Minus Query: 15 tccattcctttccattcca 33 ||||||||||||||||||| Sbjct: 26011 tccattcctttccattcca 25993 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Minus Query: 14 atccattcctttccattccattc 36 ||||||||| ||||||||||||| Sbjct: 23765 atccattccattccattccattc 23743 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Minus Query: 18 attcctttccattccattc 36 ||||||||||||||||||| Sbjct: 22657 attcctttccattccattc 22639 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Minus Query: 14 atccattcctttccattccattc 36 ||||||||| ||||||||||||| Sbjct: 22126 atccattccattccattccattc 22104 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Minus Query: 18 attcctttccattccattc 36 ||||||||||||||||||| Sbjct: 16987 attcctttccattccattc 16969 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Minus Query: 14 atccattcctttccattccattc 36 ||||||||| ||||||||||||| Sbjct: 14805 atccattccattccattccattc 14783 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Minus Query: 18 attcctttccattccattc 36 ||||||||||||||||||| Sbjct: 14636 attcctttccattccattc 14618 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Minus Query: 14 atccattcctttccattccattc 36 ||||||||||| ||||||||||| Sbjct: 13741 atccattccttcccattccattc 13719 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Minus Query: 15 tccattcctttccattccattca 37 |||||||| |||||||||||||| Sbjct: 10465 tccattccattccattccattca 10443 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Minus Query: 14 atccattcctttccattccattc 36 ||||||||| ||||||||||||| Sbjct: 9474 atccattccattccattccattc 9452 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Minus Query: 14 atccattcctttccattccattc 36 ||||||||| ||||||||||||| Sbjct: 3493 atccattccattccattccattc 3471 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Minus Query: 15 tccattcctttccattccattca 37 |||||||| |||||||||||||| Sbjct: 2510 tccattccattccattccattca 2488 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Minus Query: 18 attcctttccattccattc 36 ||||||||||||||||||| Sbjct: 1702 attcctttccattccattc 1684
>gb|AC147648.4| Homo sapiens BAC clone RP11-1413M17 from UL, complete sequence Length = 188992 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Minus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 79077 tccattcctttccattccattc 79056 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Minus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 78607 tccattcctttccattccattc 78586 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Minus Query: 14 atccattcctttccattccatt 35 |||||||||||||||||||||| Sbjct: 77729 atccattcctttccattccatt 77708 Score = 42.1 bits (21), Expect = 0.20 Identities = 21/21 (100%) Strand = Plus / Minus Query: 15 tccattcctttccattccatt 35 ||||||||||||||||||||| Sbjct: 85657 tccattcctttccattccatt 85637 Score = 42.1 bits (21), Expect = 0.20 Identities = 24/25 (96%) Strand = Plus / Minus Query: 15 tccattcctttccattccattcaaa 39 |||||||| |||||||||||||||| Sbjct: 80271 tccattccattccattccattcaaa 80247 Score = 42.1 bits (21), Expect = 0.20 Identities = 21/21 (100%) Strand = Plus / Minus Query: 15 tccattcctttccattccatt 35 ||||||||||||||||||||| Sbjct: 79822 tccattcctttccattccatt 79802 Score = 40.1 bits (20), Expect = 0.78 Identities = 20/20 (100%) Strand = Plus / Minus Query: 19 ttcctttccattccattcaa 38 |||||||||||||||||||| Sbjct: 87552 ttcctttccattccattcaa 87533 Score = 40.1 bits (20), Expect = 0.78 Identities = 23/24 (95%) Strand = Plus / Minus Query: 15 tccattcctttccattccattcaa 38 |||||||||||| ||||||||||| Sbjct: 87236 tccattcctttctattccattcaa 87213 Score = 40.1 bits (20), Expect = 0.78 Identities = 20/20 (100%) Strand = Plus / Minus Query: 19 ttcctttccattccattcaa 38 |||||||||||||||||||| Sbjct: 82234 ttcctttccattccattcaa 82215 Score = 40.1 bits (20), Expect = 0.78 Identities = 20/20 (100%) Strand = Plus / Minus Query: 17 cattcctttccattccattc 36 |||||||||||||||||||| Sbjct: 79220 cattcctttccattccattc 79201 Score = 40.1 bits (20), Expect = 0.78 Identities = 20/20 (100%) Strand = Plus / Minus Query: 17 cattcctttccattccattc 36 |||||||||||||||||||| Sbjct: 77706 cattcctttccattccattc 77687 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Minus Query: 15 tccattcctttccattcca 33 ||||||||||||||||||| Sbjct: 89341 tccattcctttccattcca 89323 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Minus Query: 18 attcctttccattccattc 36 ||||||||||||||||||| Sbjct: 86239 attcctttccattccattc 86221 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Minus Query: 15 tccattcctttccattccattca 37 |||||||| |||||||||||||| Sbjct: 85292 tccattccattccattccattca 85270 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Minus Query: 15 tccattcctttccattcca 33 ||||||||||||||||||| Sbjct: 84903 tccattcctttccattcca 84885 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Minus Query: 15 tccattcctttccattcca 33 ||||||||||||||||||| Sbjct: 84003 tccattcctttccattcca 83985 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Minus Query: 18 attcctttccattccattc 36 ||||||||||||||||||| Sbjct: 78984 attcctttccattccattc 78966 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Minus Query: 14 atccattcctttccattccattc 36 ||||||||| ||||||||||||| Sbjct: 78738 atccattccattccattccattc 78716 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Minus Query: 14 atccattcctttccattccattc 36 |||||||||||||||||| |||| Sbjct: 78663 atccattcctttccattctattc 78641 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Minus Query: 18 attcctttccattccattc 36 ||||||||||||||||||| Sbjct: 77979 attcctttccattccattc 77961
>gb|AC146428.3| Pan troglodytes BAC clone RP43-22M18 from 7, complete sequence Length = 194995 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Plus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 7753 tccattcctttccattccattc 7774
>gb|AC145613.2| Homo sapiens BAC clone RP11-1266H24 from UL, complete sequence Length = 178925 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Minus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 55869 tccattcctttccattccattc 55848 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Minus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 55399 tccattcctttccattccattc 55378 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Minus Query: 14 atccattcctttccattccatt 35 |||||||||||||||||||||| Sbjct: 54521 atccattcctttccattccatt 54500 Score = 42.1 bits (21), Expect = 0.20 Identities = 21/21 (100%) Strand = Plus / Minus Query: 15 tccattcctttccattccatt 35 ||||||||||||||||||||| Sbjct: 62449 tccattcctttccattccatt 62429 Score = 42.1 bits (21), Expect = 0.20 Identities = 24/25 (96%) Strand = Plus / Minus Query: 15 tccattcctttccattccattcaaa 39 |||||||| |||||||||||||||| Sbjct: 57063 tccattccattccattccattcaaa 57039 Score = 42.1 bits (21), Expect = 0.20 Identities = 21/21 (100%) Strand = Plus / Minus Query: 15 tccattcctttccattccatt 35 ||||||||||||||||||||| Sbjct: 56614 tccattcctttccattccatt 56594 Score = 40.1 bits (20), Expect = 0.78 Identities = 20/20 (100%) Strand = Plus / Minus Query: 19 ttcctttccattccattcaa 38 |||||||||||||||||||| Sbjct: 64359 ttcctttccattccattcaa 64340 Score = 40.1 bits (20), Expect = 0.78 Identities = 23/24 (95%) Strand = Plus / Minus Query: 15 tccattcctttccattccattcaa 38 |||||||||||| ||||||||||| Sbjct: 64038 tccattcctttctattccattcaa 64015 Score = 40.1 bits (20), Expect = 0.78 Identities = 20/20 (100%) Strand = Plus / Minus Query: 19 ttcctttccattccattcaa 38 |||||||||||||||||||| Sbjct: 59026 ttcctttccattccattcaa 59007 Score = 40.1 bits (20), Expect = 0.78 Identities = 20/20 (100%) Strand = Plus / Minus Query: 17 cattcctttccattccattc 36 |||||||||||||||||||| Sbjct: 56012 cattcctttccattccattc 55993 Score = 40.1 bits (20), Expect = 0.78 Identities = 20/20 (100%) Strand = Plus / Minus Query: 17 cattcctttccattccattc 36 |||||||||||||||||||| Sbjct: 54498 cattcctttccattccattc 54479 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Minus Query: 15 tccattcctttccattcca 33 ||||||||||||||||||| Sbjct: 66153 tccattcctttccattcca 66135 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Minus Query: 18 attcctttccattccattc 36 ||||||||||||||||||| Sbjct: 63031 attcctttccattccattc 63013 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Minus Query: 15 tccattcctttccattccattca 37 |||||||| |||||||||||||| Sbjct: 62084 tccattccattccattccattca 62062 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Minus Query: 15 tccattcctttccattcca 33 ||||||||||||||||||| Sbjct: 61695 tccattcctttccattcca 61677 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Minus Query: 15 tccattcctttccattcca 33 ||||||||||||||||||| Sbjct: 60795 tccattcctttccattcca 60777 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Minus Query: 18 attcctttccattccattc 36 ||||||||||||||||||| Sbjct: 55776 attcctttccattccattc 55758 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Minus Query: 14 atccattcctttccattccattc 36 ||||||||| ||||||||||||| Sbjct: 55530 atccattccattccattccattc 55508 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Minus Query: 14 atccattcctttccattccattc 36 |||||||||||||||||| |||| Sbjct: 55455 atccattcctttccattctattc 55433 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Minus Query: 18 attcctttccattccattc 36 ||||||||||||||||||| Sbjct: 54771 attcctttccattccattc 54753
>gb|AC140113.3| Homo sapiens PAC clone RP1-85D24 from Y, complete sequence Length = 155655 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Minus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 154408 tccattcctttccattccattc 154387 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Minus Query: 14 atccattcctttccattccattc 36 ||||| ||||||||||||||||| Sbjct: 153807 atccactcctttccattccattc 153785
>gb|AC134879.3| Homo sapiens BAC clone RP11-295P22 from Y, complete sequence Length = 205515 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Plus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 96070 tccattcctttccattccattc 96091 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Plus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 67962 tccattcctttccattccattc 67983 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Plus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 63970 tccattcctttccattccattc 63991 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Plus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 56795 tccattcctttccattccattc 56816 Score = 42.1 bits (21), Expect = 0.20 Identities = 24/25 (96%) Strand = Plus / Plus Query: 14 atccattcctttccattccattcaa 38 |||||||| |||||||||||||||| Sbjct: 100531 atccattcatttccattccattcaa 100555 Score = 42.1 bits (21), Expect = 0.20 Identities = 21/21 (100%) Strand = Plus / Plus Query: 15 tccattcctttccattccatt 35 ||||||||||||||||||||| Sbjct: 97819 tccattcctttccattccatt 97839 Score = 42.1 bits (21), Expect = 0.20 Identities = 21/21 (100%) Strand = Plus / Plus Query: 18 attcctttccattccattcaa 38 ||||||||||||||||||||| Sbjct: 91870 attcctttccattccattcaa 91890 Score = 42.1 bits (21), Expect = 0.20 Identities = 21/21 (100%) Strand = Plus / Plus Query: 15 tccattcctttccattccatt 35 ||||||||||||||||||||| Sbjct: 89821 tccattcctttccattccatt 89841 Score = 42.1 bits (21), Expect = 0.20 Identities = 24/25 (96%) Strand = Plus / Plus Query: 14 atccattcctttccattccattcaa 38 ||||||||| ||||||||||||||| Sbjct: 85915 atccattccattccattccattcaa 85939 Score = 42.1 bits (21), Expect = 0.20 Identities = 21/21 (100%) Strand = Plus / Plus Query: 16 ccattcctttccattccattc 36 ||||||||||||||||||||| Sbjct: 85807 ccattcctttccattccattc 85827 Score = 42.1 bits (21), Expect = 0.20 Identities = 21/21 (100%) Strand = Plus / Plus Query: 15 tccattcctttccattccatt 35 ||||||||||||||||||||| Sbjct: 81687 tccattcctttccattccatt 81707 Score = 42.1 bits (21), Expect = 0.20 Identities = 24/25 (96%) Strand = Plus / Plus Query: 15 tccattcctttccattccattcaaa 39 |||||| |||||||||||||||||| Sbjct: 50355 tccattgctttccattccattcaaa 50379 Score = 42.1 bits (21), Expect = 0.20 Identities = 24/25 (96%) Strand = Plus / Plus Query: 15 tccattcctttccattccattcaaa 39 |||||| |||||||||||||||||| Sbjct: 46994 tccattgctttccattccattcaaa 47018 Score = 42.1 bits (21), Expect = 0.20 Identities = 21/21 (100%) Strand = Plus / Plus Query: 14 atccattcctttccattccat 34 ||||||||||||||||||||| Sbjct: 38753 atccattcctttccattccat 38773 Score = 42.1 bits (21), Expect = 0.20 Identities = 21/21 (100%) Strand = Plus / Plus Query: 14 atccattcctttccattccat 34 ||||||||||||||||||||| Sbjct: 33112 atccattcctttccattccat 33132 Score = 42.1 bits (21), Expect = 0.20 Identities = 21/21 (100%) Strand = Plus / Plus Query: 14 atccattcctttccattccat 34 ||||||||||||||||||||| Sbjct: 27505 atccattcctttccattccat 27525 Score = 42.1 bits (21), Expect = 0.20 Identities = 21/21 (100%) Strand = Plus / Plus Query: 14 atccattcctttccattccat 34 ||||||||||||||||||||| Sbjct: 21908 atccattcctttccattccat 21928 Score = 42.1 bits (21), Expect = 0.20 Identities = 21/21 (100%) Strand = Plus / Plus Query: 14 atccattcctttccattccat 34 ||||||||||||||||||||| Sbjct: 16296 atccattcctttccattccat 16316 Score = 42.1 bits (21), Expect = 0.20 Identities = 21/21 (100%) Strand = Plus / Plus Query: 14 atccattcctttccattccat 34 ||||||||||||||||||||| Sbjct: 10690 atccattcctttccattccat 10710 Score = 42.1 bits (21), Expect = 0.20 Identities = 21/21 (100%) Strand = Plus / Plus Query: 14 atccattcctttccattccat 34 ||||||||||||||||||||| Sbjct: 5083 atccattcctttccattccat 5103 Score = 40.1 bits (20), Expect = 0.78 Identities = 23/24 (95%) Strand = Plus / Plus Query: 15 tccattcctttccattccattcaa 38 |||||||| ||||||||||||||| Sbjct: 91181 tccattccattccattccattcaa 91204 Score = 40.1 bits (20), Expect = 0.78 Identities = 23/24 (95%) Strand = Plus / Plus Query: 15 tccattcctttccattccattcaa 38 |||||||| ||||||||||||||| Sbjct: 84941 tccattccattccattccattcaa 84964 Score = 40.1 bits (20), Expect = 0.78 Identities = 23/24 (95%) Strand = Plus / Plus Query: 15 tccattcctttccattccattcaa 38 ||||||||||||| |||||||||| Sbjct: 78388 tccattcctttccgttccattcaa 78411 Score = 40.1 bits (20), Expect = 0.78 Identities = 23/24 (95%) Strand = Plus / Plus Query: 15 tccattcctttccattccattcaa 38 ||||| |||||||||||||||||| Sbjct: 76662 tccatacctttccattccattcaa 76685 Score = 40.1 bits (20), Expect = 0.78 Identities = 20/20 (100%) Strand = Plus / Plus Query: 17 cattcctttccattccattc 36 |||||||||||||||||||| Sbjct: 72417 cattcctttccattccattc 72436 Score = 40.1 bits (20), Expect = 0.78 Identities = 23/24 (95%) Strand = Plus / Plus Query: 15 tccattcctttccattccattcaa 38 |||||||| ||||||||||||||| Sbjct: 70219 tccattccattccattccattcaa 70242 Score = 40.1 bits (20), Expect = 0.78 Identities = 23/24 (95%) Strand = Plus / Plus Query: 15 tccattcctttccattccattcaa 38 ||||||| |||||||||||||||| Sbjct: 68476 tccattcatttccattccattcaa 68499 Score = 40.1 bits (20), Expect = 0.78 Identities = 23/24 (95%) Strand = Plus / Plus Query: 15 tccattcctttccattccattcaa 38 |||||||| ||||||||||||||| Sbjct: 66335 tccattccattccattccattcaa 66358 Score = 40.1 bits (20), Expect = 0.78 Identities = 23/24 (95%) Strand = Plus / Plus Query: 15 tccattcctttccattccattcaa 38 |||||||| ||||||||||||||| Sbjct: 61510 tccattccattccattccattcaa 61533 Score = 40.1 bits (20), Expect = 0.78 Identities = 23/24 (95%) Strand = Plus / Plus Query: 15 tccattcctttccattccattcaa 38 |||||| ||||||||||||||||| Sbjct: 59267 tccattgctttccattccattcaa 59290 Score = 40.1 bits (20), Expect = 0.78 Identities = 23/24 (95%) Strand = Plus / Plus Query: 15 tccattcctttccattccattcaa 38 |||||||| ||||||||||||||| Sbjct: 55678 tccattccattccattccattcaa 55701 Score = 40.1 bits (20), Expect = 0.78 Identities = 23/24 (95%) Strand = Plus / Plus Query: 15 tccattcctttccattccattcaa 38 ||||||||| |||||||||||||| Sbjct: 54321 tccattcctgtccattccattcaa 54344 Score = 40.1 bits (20), Expect = 0.78 Identities = 23/24 (95%) Strand = Plus / Plus Query: 15 tccattcctttccattccattcaa 38 |||||| ||||||||||||||||| Sbjct: 53716 tccattgctttccattccattcaa 53739 Score = 40.1 bits (20), Expect = 0.78 Identities = 23/24 (95%) Strand = Plus / Plus Query: 15 tccattcctttccattccattcaa 38 |||||||| ||||||||||||||| Sbjct: 50960 tccattccattccattccattcaa 50983 Score = 40.1 bits (20), Expect = 0.78 Identities = 23/24 (95%) Strand = Plus / Plus Query: 15 tccattcctttccattccattcaa 38 |||||||| ||||||||||||||| Sbjct: 47599 tccattccattccattccattcaa 47622 Score = 40.1 bits (20), Expect = 0.78 Identities = 23/24 (95%) Strand = Plus / Plus Query: 15 tccattcctttccattccattcaa 38 |||||||| ||||||||||||||| Sbjct: 43321 tccattccattccattccattcaa 43344 Score = 40.1 bits (20), Expect = 0.78 Identities = 23/24 (95%) Strand = Plus / Plus Query: 15 tccattcctttccattccattcaa 38 ||||||||| |||||||||||||| Sbjct: 41970 tccattcctgtccattccattcaa 41993 Score = 40.1 bits (20), Expect = 0.78 Identities = 23/24 (95%) Strand = Plus / Plus Query: 15 tccattcctttccattccattcaa 38 |||||| ||||||||||||||||| Sbjct: 41370 tccattgctttccattccattcaa 41393 Score = 40.1 bits (20), Expect = 0.78 Identities = 23/24 (95%) Strand = Plus / Plus Query: 15 tccattcctttccattccattcaa 38 |||||||| ||||||||||||||| Sbjct: 38604 tccattccattccattccattcaa 38627 Score = 40.1 bits (20), Expect = 0.78 Identities = 23/24 (95%) Strand = Plus / Plus Query: 15 tccattcctttccattccattcaa 38 |||||||| ||||||||||||||| Sbjct: 37443 tccattccattccattccattcaa 37466 Score = 40.1 bits (20), Expect = 0.78 Identities = 23/24 (95%) Strand = Plus / Plus Query: 15 tccattcctttccattccattcaa 38 ||||||||| |||||||||||||| Sbjct: 36270 tccattcctgtccattccattcaa 36293 Score = 40.1 bits (20), Expect = 0.78 Identities = 23/24 (95%) Strand = Plus / Plus Query: 15 tccattcctttccattccattcaa 38 |||||| ||||||||||||||||| Sbjct: 30097 tccattgctttccattccattcaa 30120 Score = 40.1 bits (20), Expect = 0.78 Identities = 23/24 (95%) Strand = Plus / Plus Query: 15 tccattcctttccattccattcaa 38 ||||||||| |||||||||||||| Sbjct: 25121 tccattcctgtccattccattcaa 25144 Score = 40.1 bits (20), Expect = 0.78 Identities = 23/24 (95%) Strand = Plus / Plus Query: 15 tccattcctttccattccattcaa 38 |||||| ||||||||||||||||| Sbjct: 24520 tccattgctttccattccattcaa 24543 Score = 40.1 bits (20), Expect = 0.78 Identities = 23/24 (95%) Strand = Plus / Plus Query: 15 tccattcctttccattccattcaa 38 ||||||||| |||||||||||||| Sbjct: 19519 tccattcctgtccattccattcaa 19542 Score = 40.1 bits (20), Expect = 0.78 Identities = 23/24 (95%) Strand = Plus / Plus Query: 15 tccattcctttccattccattcaa 38 |||||| ||||||||||||||||| Sbjct: 18918 tccattgctttccattccattcaa 18941 Score = 40.1 bits (20), Expect = 0.78 Identities = 23/24 (95%) Strand = Plus / Plus Query: 15 tccattcctttccattccattcaa 38 ||||||||| |||||||||||||| Sbjct: 13912 tccattcctgtccattccattcaa 13935 Score = 40.1 bits (20), Expect = 0.78 Identities = 23/24 (95%) Strand = Plus / Plus Query: 15 tccattcctttccattccattcaa 38 |||||| ||||||||||||||||| Sbjct: 13311 tccattgctttccattccattcaa 13334 Score = 40.1 bits (20), Expect = 0.78 Identities = 23/24 (95%) Strand = Plus / Plus Query: 15 tccattcctttccattccattcaa 38 ||||||||| |||||||||||||| Sbjct: 8306 tccattcctgtccattccattcaa 8329 Score = 40.1 bits (20), Expect = 0.78 Identities = 23/24 (95%) Strand = Plus / Plus Query: 15 tccattcctttccattccattcaa 38 |||||| ||||||||||||||||| Sbjct: 7705 tccattgctttccattccattcaa 7728 Score = 40.1 bits (20), Expect = 0.78 Identities = 23/24 (95%) Strand = Plus / Plus Query: 15 tccattcctttccattccattcaa 38 ||||||||| |||||||||||||| Sbjct: 2704 tccattcctgtccattccattcaa 2727 Score = 40.1 bits (20), Expect = 0.78 Identities = 23/24 (95%) Strand = Plus / Plus Query: 15 tccattcctttccattccattcaa 38 |||||| ||||||||||||||||| Sbjct: 2103 tccattgctttccattccattcaa 2126 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Plus Query: 18 attcctttccattccattc 36 ||||||||||||||||||| Sbjct: 97202 attcctttccattccattc 97220 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Plus Query: 19 ttcctttccattccattca 37 ||||||||||||||||||| Sbjct: 96344 ttcctttccattccattca 96362 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Plus Query: 17 cattcctttccattccatt 35 ||||||||||||||||||| Sbjct: 92618 cattcctttccattccatt 92636 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Plus Query: 18 attcctttccattccattc 36 ||||||||||||||||||| Sbjct: 87440 attcctttccattccattc 87458 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Plus Query: 18 attcctttccattccattc 36 ||||||||||||||||||| Sbjct: 85654 attcctttccattccattc 85672 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Plus Query: 15 tccattcctttccattccattca 37 |||||||| |||||||||||||| Sbjct: 67817 tccattccattccattccattca 67839 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Plus Query: 18 attcctttccattccattc 36 ||||||||||||||||||| Sbjct: 66788 attcctttccattccattc 66806 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Plus Query: 14 atccattcctttccattcc 32 ||||||||||||||||||| Sbjct: 56700 atccattcctttccattcc 56718 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Plus Query: 17 cattcctttccattccatt 35 ||||||||||||||||||| Sbjct: 54183 cattcctttccattccatt 54201 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Plus Query: 14 atccattcctttccattccattc 36 ||||||||| ||||||||||||| Sbjct: 53800 atccattccattccattccattc 53822 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Plus Query: 14 atccattcctttccattccattc 36 ||||||||| ||||||||||||| Sbjct: 50439 atccattccattccattccattc 50461 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Plus Query: 14 atccattcctttccattccattc 36 ||||||||| ||||||||||||| Sbjct: 47078 atccattccattccattccattc 47100 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Plus Query: 17 cattcctttccattccatt 35 ||||||||||||||||||| Sbjct: 41832 cattcctttccattccatt 41850 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Plus Query: 14 atccattcctttccattccattc 36 ||||||||| ||||||||||||| Sbjct: 37407 atccattccattccattccattc 37429 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Plus Query: 14 atccattcctttccattccattc 36 ||||||||| ||||||||||||| Sbjct: 35748 atccattccattccattccattc 35770 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Plus Query: 14 atccattcctttccattccattc 36 ||||||||| ||||||||||||| Sbjct: 31845 atccattccattccattccattc 31867 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Plus Query: 18 attcctttccattccattc 36 ||||||||||||||||||| Sbjct: 31445 attcctttccattccattc 31463 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Plus Query: 14 atccattcctttccattccattc 36 ||||||||| ||||||||||||| Sbjct: 30181 atccattccattccattccattc 30203 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Plus Query: 14 atccattcctttccattccattc 36 ||||||||| ||||||||||||| Sbjct: 26243 atccattccattccattccattc 26265 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Plus Query: 18 attcctttccattccattc 36 ||||||||||||||||||| Sbjct: 25843 attcctttccattccattc 25861 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Plus Query: 18 attcctttccattccattc 36 ||||||||||||||||||| Sbjct: 23794 attcctttccattccattc 23812 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Plus Query: 14 atccattcctttccattccattc 36 ||||||||| ||||||||||||| Sbjct: 20641 atccattccattccattccattc 20663 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Plus Query: 18 attcctttccattccattc 36 ||||||||||||||||||| Sbjct: 20241 attcctttccattccattc 20259 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Plus Query: 18 attcctttccattccattc 36 ||||||||||||||||||| Sbjct: 18192 attcctttccattccattc 18210 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Plus Query: 14 atccattcctttccattccattc 36 ||||||||| ||||||||||||| Sbjct: 15029 atccattccattccattccattc 15051 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Plus Query: 18 attcctttccattccattc 36 ||||||||||||||||||| Sbjct: 14629 attcctttccattccattc 14647 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Plus Query: 15 tccattcctttccattccattca 37 ||||||||||||||||| ||||| Sbjct: 12692 tccattcctttccattcaattca 12714 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Plus Query: 18 attcctttccattccattc 36 ||||||||||||||||||| Sbjct: 12586 attcctttccattccattc 12604 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Plus Query: 14 atccattcctttccattccattc 36 ||||||||| ||||||||||||| Sbjct: 9423 atccattccattccattccattc 9445 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Plus Query: 18 attcctttccattccattc 36 ||||||||||||||||||| Sbjct: 9023 attcctttccattccattc 9041 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Plus Query: 15 tccattcctttccattccattca 37 ||||||||||||||||| ||||| Sbjct: 7085 tccattcctttccattcaattca 7107 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Plus Query: 18 attcctttccattccattc 36 ||||||||||||||||||| Sbjct: 6979 attcctttccattccattc 6997 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Plus Query: 14 atccattcctttccattccattc 36 ||||||||| ||||||||||||| Sbjct: 3816 atccattccattccattccattc 3838 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Plus Query: 18 attcctttccattccattc 36 ||||||||||||||||||| Sbjct: 3416 attcctttccattccattc 3434 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Plus Query: 15 tccattcctttccattccattca 37 ||||||||||||||||| ||||| Sbjct: 1483 tccattcctttccattcaattca 1505 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Plus Query: 18 attcctttccattccattc 36 ||||||||||||||||||| Sbjct: 1377 attcctttccattccattc 1395
>gb|AC073927.9| Homo sapiens BAC clone RP11-604B16 from 7, complete sequence Length = 185676 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Minus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 8456 tccattcctttccattccattc 8435
>gb|AC092175.5| Homo sapiens BAC clone RP11-1324A7 from 7, complete sequence Length = 100645 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Minus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 30302 tccattcctttccattccattc 30281 Score = 42.1 bits (21), Expect = 0.20 Identities = 21/21 (100%) Strand = Plus / Minus Query: 16 ccattcctttccattccattc 36 ||||||||||||||||||||| Sbjct: 37406 ccattcctttccattccattc 37386 Score = 40.1 bits (20), Expect = 0.78 Identities = 23/24 (95%) Strand = Plus / Minus Query: 15 tccattcctttccattccattcaa 38 |||||||| ||||||||||||||| Sbjct: 38256 tccattccattccattccattcaa 38233
>emb|AL669831.13| Human DNA sequence from clone RP11-206L10 on chromosome 1 Contains thirteen novel genes, a novel pseudogene, a novel gene similar to the F-box only protein 25 gene(FBXO25), a novel pseudogene similar to the beta-tubulin family and a CpG island, complete sequence Length = 179567 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Minus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 94109 tccattcctttccattccattc 94088
>gb|BC056263.1| Homo sapiens cDNA clone IMAGE:6618467, partial cds Length = 970 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Minus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 314 tccattcctttccattccattc 293
>emb|AL121723.36|HSJ854E16 Human DNA sequence from clone RP5-854E16 on chromosome 20 Contains a DKKL1-pending (soggy-1) (SGY-1) pseudogene and part of a CDK5 regulatory subunit associated protein 3 (CDK5RAP3) pseudogene, complete sequence Length = 70452 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Minus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 27028 tccattcctttccattccattc 27007 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Minus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 19119 tccattcctttccattccattc 19098 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Minus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 9850 tccattcctttccattccattc 9829 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Minus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 9835 tccattcctttccattccattc 9814 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Minus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 8070 tccattcctttccattccattc 8049 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Minus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 4971 tccattcctttccattccattc 4950 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Minus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 2788 tccattcctttccattccattc 2767 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Minus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 1284 tccattcctttccattccattc 1263 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Minus Query: 14 atccattcctttccattccatt 35 |||||||||||||||||||||| Sbjct: 832 atccattcctttccattccatt 811 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Minus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 52 tccattcctttccattccattc 31 Score = 42.1 bits (21), Expect = 0.20 Identities = 24/25 (96%) Strand = Plus / Minus Query: 15 tccattcctttccattccattcaaa 39 |||||||| |||||||||||||||| Sbjct: 22846 tccattccattccattccattcaaa 22822 Score = 42.1 bits (21), Expect = 0.20 Identities = 24/25 (96%) Strand = Plus / Minus Query: 14 atccattcctttccattccattcaa 38 ||||||||| ||||||||||||||| Sbjct: 3199 atccattccattccattccattcaa 3175 Score = 40.1 bits (20), Expect = 0.78 Identities = 20/20 (100%) Strand = Plus / Minus Query: 19 ttcctttccattccattcaa 38 |||||||||||||||||||| Sbjct: 17735 ttcctttccattccattcaa 17716 Score = 40.1 bits (20), Expect = 0.78 Identities = 20/20 (100%) Strand = Plus / Minus Query: 17 cattcctttccattccattc 36 |||||||||||||||||||| Sbjct: 15932 cattcctttccattccattc 15913 Score = 40.1 bits (20), Expect = 0.78 Identities = 23/24 (95%) Strand = Plus / Minus Query: 15 tccattcctttccattccattcaa 38 |||||||| ||||||||||||||| Sbjct: 14601 tccattccattccattccattcaa 14578 Score = 40.1 bits (20), Expect = 0.78 Identities = 23/24 (95%) Strand = Plus / Minus Query: 15 tccattcctttccattccattcaa 38 |||| ||||||||||||||||||| Sbjct: 8800 tccaatcctttccattccattcaa 8777 Score = 40.1 bits (20), Expect = 0.78 Identities = 23/24 (95%) Strand = Plus / Minus Query: 15 tccattcctttccattccattcaa 38 |||||||| ||||||||||||||| Sbjct: 8225 tccattccattccattccattcaa 8202 Score = 40.1 bits (20), Expect = 0.78 Identities = 23/24 (95%) Strand = Plus / Minus Query: 15 tccattcctttccattccattcaa 38 |||||||| ||||||||||||||| Sbjct: 6610 tccattccattccattccattcaa 6587 Score = 40.1 bits (20), Expect = 0.78 Identities = 23/24 (95%) Strand = Plus / Minus Query: 15 tccattcctttccattccattcaa 38 |||||||||||| ||||||||||| Sbjct: 2973 tccattcctttctattccattcaa 2950 Score = 40.1 bits (20), Expect = 0.78 Identities = 23/24 (95%) Strand = Plus / Minus Query: 15 tccattcctttccattccattcaa 38 |||||||| ||||||||||||||| Sbjct: 861 tccattccattccattccattcaa 838 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Minus Query: 14 atccattcctttccattccattc 36 ||||||||| ||||||||||||| Sbjct: 26217 atccattccattccattccattc 26195 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Minus Query: 14 atccattcctttccattccattc 36 ||||||||||||| ||||||||| Sbjct: 25288 atccattcctttcaattccattc 25266 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Minus Query: 15 tccattcctttccattcca 33 ||||||||||||||||||| Sbjct: 25073 tccattcctttccattcca 25055 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Minus Query: 14 atccattcctttccattccattc 36 ||||||||| ||||||||||||| Sbjct: 23770 atccattccattccattccattc 23748 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Minus Query: 18 attcctttccattccattc 36 ||||||||||||||||||| Sbjct: 21774 attcctttccattccattc 21756 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Minus Query: 15 tccattcctttccattcca 33 ||||||||||||||||||| Sbjct: 21287 tccattcctttccattcca 21269 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Minus Query: 14 atccattcctttccattccattc 36 ||||||||| ||||||||||||| Sbjct: 20102 atccattccattccattccattc 20080 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Minus Query: 14 atccattcctttccattccattc 36 ||||||||||||||| ||||||| Sbjct: 19070 atccattcctttccagtccattc 19048 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Minus Query: 14 atccattcctttccattccattc 36 ||||||||| ||||||||||||| Sbjct: 18155 atccattccattccattccattc 18133 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Minus Query: 15 tccattcctttccattcca 33 ||||||||||||||||||| Sbjct: 14411 tccattcctttccattcca 14393 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Minus Query: 15 tccattcctttccattcca 33 ||||||||||||||||||| Sbjct: 12512 tccattcctttccattcca 12494 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Minus Query: 18 attcctttccattccattc 36 ||||||||||||||||||| Sbjct: 10177 attcctttccattccattc 10159 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Minus Query: 15 tccattcctttccattccattca 37 |||||||| |||||||||||||| Sbjct: 7980 tccattccattccattccattca 7958 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Minus Query: 14 atccattcctttccattccattc 36 |||| |||||||||||||||||| Sbjct: 6216 atccgttcctttccattccattc 6194 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Minus Query: 14 atccattcctttccattccattc 36 ||||||||| ||||||||||||| Sbjct: 5661 atccattccattccattccattc 5639 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Minus Query: 18 attcctttccattccattc 36 ||||||||||||||||||| Sbjct: 3430 attcctttccattccattc 3412 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Minus Query: 14 atccattcctttccattccattc 36 ||||||||| ||||||||||||| Sbjct: 2245 atccattccattccattccattc 2223 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Minus Query: 14 atccattcctttccattccattc 36 ||||||||| ||||||||||||| Sbjct: 867 atccattccattccattccattc 845 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Minus Query: 14 atccattcctttccattccattc 36 ||||||||| ||||||||||||| Sbjct: 672 atccattccattccattccattc 650
>emb|AL133173.20| Human DNA sequence from clone RP11-453N3 on chromosome 10 Contains a RING finger protein 18 (RNF18) pseudogene, an actin-related protein 3 homolog (yeast) (ACTR3) pseudogene, a poly(A) cytoplasmic binding protein 3 (PABPC3) pseudogene, a gene for a novel protein similar to ATP-binding cassette sub-family D (ALD) member 1 (ABCD1), two novel genes and two CpG islands, complete sequence Length = 206192 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Plus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 205095 tccattcctttccattccattc 205116 Score = 44.1 bits (22), Expect = 0.050 Identities = 25/26 (96%) Strand = Plus / Plus Query: 13 gatccattcctttccattccattcaa 38 |||||||||| ||||||||||||||| Sbjct: 200955 gatccattccattccattccattcaa 200980 Score = 42.1 bits (21), Expect = 0.20 Identities = 21/21 (100%) Strand = Plus / Plus Query: 17 cattcctttccattccattca 37 ||||||||||||||||||||| Sbjct: 203903 cattcctttccattccattca 203923 Score = 40.1 bits (20), Expect = 0.78 Identities = 23/24 (95%) Strand = Plus / Plus Query: 15 tccattcctttccattccattcaa 38 |||||||| ||||||||||||||| Sbjct: 204786 tccattccattccattccattcaa 204809 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Plus Query: 14 atccattcctttccattccattc 36 ||||||||| ||||||||||||| Sbjct: 205239 atccattccattccattccattc 205261 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Plus Query: 14 atccattcctttccattccattc 36 ||||||||| ||||||||||||| Sbjct: 202344 atccattccattccattccattc 202366 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Plus Query: 14 atccattcctttccattccattc 36 ||||||||| ||||||||||||| Sbjct: 201345 atccattccattccattccattc 201367 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Plus Query: 14 atccattcctttccattccattc 36 ||||||||| ||||||||||||| Sbjct: 200436 atccattccattccattccattc 200458 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Plus Query: 18 attcctttccattccattc 36 ||||||||||||||||||| Sbjct: 200380 attcctttccattccattc 200398
>gb|AC136932.4| Homo sapiens chromosome 16 clone CTD-2522B17, complete sequence Length = 171882 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Plus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 153411 tccattcctttccattccattc 153432 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Plus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 147584 tccattcctttccattccattc 147605 Score = 42.1 bits (21), Expect = 0.20 Identities = 21/21 (100%) Strand = Plus / Plus Query: 18 attcctttccattccattcaa 38 ||||||||||||||||||||| Sbjct: 138189 attcctttccattccattcaa 138209 Score = 40.1 bits (20), Expect = 0.78 Identities = 20/20 (100%) Strand = Plus / Plus Query: 17 cattcctttccattccattc 36 |||||||||||||||||||| Sbjct: 154467 cattcctttccattccattc 154486 Score = 40.1 bits (20), Expect = 0.78 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tccattcctttccattccat 34 |||||||||||||||||||| Sbjct: 153089 tccattcctttccattccat 153108 Score = 40.1 bits (20), Expect = 0.78 Identities = 23/24 (95%) Strand = Plus / Plus Query: 15 tccattcctttccattccattcaa 38 |||||||| ||||||||||||||| Sbjct: 149059 tccattccattccattccattcaa 149082 Score = 40.1 bits (20), Expect = 0.78 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tccattcctttccattccat 34 |||||||||||||||||||| Sbjct: 147272 tccattcctttccattccat 147291
>gb|AC069061.11| Homo sapiens chromosome 17, clone RP11-260A9, complete sequence Length = 178558 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Minus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 1440 tccattcctttccattccattc 1419
>gb|AC110072.3| Homo sapiens BAC clone RP11-18C16 from 4, complete sequence Length = 188672 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Minus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 52183 tccattcctttccattccattc 52162 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Minus Query: 14 atccattcctttccattccatt 35 |||||||||||||||||||||| Sbjct: 167 atccattcctttccattccatt 146 Score = 40.1 bits (20), Expect = 0.78 Identities = 23/24 (95%) Strand = Plus / Plus Query: 17 cattcctttccattccattcaaag 40 |||||| ||||||||||||||||| Sbjct: 78058 cattccattccattccattcaaag 78081 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Minus Query: 18 attcctttccattccattc 36 ||||||||||||||||||| Sbjct: 7771 attcctttccattccattc 7753
>dbj|AK128024.1| Homo sapiens cDNA FLJ46143 fis, clone TESTI2053561 Length = 1986 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Plus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 1678 tccattcctttccattccattc 1699 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Plus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 1012 tccattcctttccattccattc 1033
>gb|AC079801.2| Homo sapiens BAC clone RP11-717F1 from 16, complete sequence Length = 177312 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Minus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 111520 tccattcctttccattccattc 111499 Score = 40.1 bits (20), Expect = 0.78 Identities = 20/20 (100%) Strand = Plus / Minus Query: 17 cattcctttccattccattc 36 |||||||||||||||||||| Sbjct: 113462 cattcctttccattccattc 113443 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Minus Query: 15 tccattcctttccattcca 33 ||||||||||||||||||| Sbjct: 113439 tccattcctttccattcca 113421 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Minus Query: 15 tccattcctttccattcca 33 ||||||||||||||||||| Sbjct: 111205 tccattcctttccattcca 111187
>gb|AC149092.6| Pan troglodytes BAC clone CH251-553I6 from chromosome 7, complete sequence Length = 194702 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Plus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 23912 tccattcctttccattccattc 23933 Score = 40.1 bits (20), Expect = 0.78 Identities = 23/24 (95%) Strand = Plus / Plus Query: 15 tccattcctttccattccattcaa 38 |||||||| ||||||||||||||| Sbjct: 8656 tccattccgttccattccattcaa 8679 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Plus Query: 15 tccattcctttccattcca 33 ||||||||||||||||||| Sbjct: 16139 tccattcctttccattcca 16157 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Plus Query: 16 ccattcctttccattccattcaa 38 ||||||| ||||||||||||||| Sbjct: 8876 ccattccattccattccattcaa 8898
>ref|XM_942028.1| PREDICTED: Homo sapiens hypothetical protein LOC652538 (LOC652538), mRNA Length = 117 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Minus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 95 tccattcctttccattccattc 74
>gb|AC161019.3| Pan troglodytes BAC clone CH251-7O2 from chromosome 7, complete sequence Length = 165769 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Minus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 111578 tccattcctttccattccattc 111557 Score = 40.1 bits (20), Expect = 0.78 Identities = 23/24 (95%) Strand = Plus / Minus Query: 15 tccattcctttccattccattcaa 38 |||||||| ||||||||||||||| Sbjct: 126834 tccattccgttccattccattcaa 126811 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Minus Query: 16 ccattcctttccattccattcaa 38 ||||||| ||||||||||||||| Sbjct: 126614 ccattccattccattccattcaa 126592 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Minus Query: 15 tccattcctttccattcca 33 ||||||||||||||||||| Sbjct: 119351 tccattcctttccattcca 119333
>gb|AF298194.1|AF298194 Homo sapiens clone pW-1 microsatellite III sequence Length = 1524 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Minus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 516 tccattcctttccattccattc 495 Score = 40.1 bits (20), Expect = 0.78 Identities = 20/20 (100%) Strand = Plus / Minus Query: 19 ttcctttccattccattcaa 38 |||||||||||||||||||| Sbjct: 1201 ttcctttccattccattcaa 1182 Score = 40.1 bits (20), Expect = 0.78 Identities = 23/24 (95%) Strand = Plus / Minus Query: 15 tccattcctttccattccattcaa 38 |||| ||||||||||||||||||| Sbjct: 1005 tccaatcctttccattccattcaa 982 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Minus Query: 14 atccattcctttccattccattc 36 ||||||||| ||||||||||||| Sbjct: 1301 atccattccattccattccattc 1279
>gb|AF298191.1|AF298191 Homo sapiens clone pR-1 microsatellite III sequence Length = 1529 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Minus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 1405 tccattcctttccattccattc 1384 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Minus Query: 15 tccattcctttccattccattca 37 |||||||| |||||||||||||| Sbjct: 328 tccattccattccattccattca 306
>gb|AC069323.5|AC069323 Homo sapiens BAC clone RP11-1126J10 from Y, complete sequence Length = 39401 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Plus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 37653 tccattcctttccattccattc 37674 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Plus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 36083 tccattcctttccattccattc 36104 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Plus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 34785 tccattcctttccattccattc 34806 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Plus Query: 14 atccattcctttccattccattc 36 ||||||||| ||||||||||||| Sbjct: 37128 atccattccattccattccattc 37150
>gb|AC068123.5|AC068123 Homo sapiens BAC clone RP11-242E13 from Y, complete sequence Length = 98295 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Plus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 95947 tccattcctttccattccattc 95968 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Plus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 90394 tccattcctttccattccattc 90415 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Plus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 86810 tccattcctttccattccattc 86831 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Plus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 83252 tccattcctttccattccattc 83273 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Plus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 79673 tccattcctttccattccattc 79694 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Plus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 76114 tccattcctttccattccattc 76135 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Plus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 72535 tccattcctttccattccattc 72556 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Plus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 69993 tccattcctttccattccattc 70014 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Plus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 68956 tccattcctttccattccattc 68977 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Plus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 65387 tccattcctttccattccattc 65408 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Plus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 61873 tccattcctttccattccattc 61894 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Plus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 59326 tccattcctttccattccattc 59347 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Plus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 58289 tccattcctttccattccattc 58310 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Plus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 54715 tccattcctttccattccattc 54736 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Plus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 47582 tccattcctttccattccattc 47603 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Plus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 43988 tccattcctttccattccattc 44009 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Plus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 40406 tccattcctttccattccattc 40427 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Plus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 36832 tccattcctttccattccattc 36853 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Plus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 33288 tccattcctttccattccattc 33309 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Plus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 29709 tccattcctttccattccattc 29730 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Plus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 26130 tccattcctttccattccattc 26151 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Plus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 22540 tccattcctttccattccattc 22561 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Plus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 19066 tccattcctttccattccattc 19087 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Plus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 15502 tccattcctttccattccattc 15523 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Plus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 11953 tccattcctttccattccattc 11974 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Plus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 8379 tccattcctttccattccattc 8400 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Plus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 4830 tccattcctttccattccattc 4851 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Plus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 1242 tccattcctttccattccattc 1263 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Plus Query: 18 attcctttccattccattc 36 ||||||||||||||||||| Sbjct: 91434 attcctttccattccattc 91452 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Plus Query: 18 attcctttccattccattc 36 ||||||||||||||||||| Sbjct: 87850 attcctttccattccattc 87868 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Plus Query: 18 attcctttccattccattc 36 ||||||||||||||||||| Sbjct: 84292 attcctttccattccattc 84310 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Plus Query: 18 attcctttccattccattc 36 ||||||||||||||||||| Sbjct: 80713 attcctttccattccattc 80731 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Plus Query: 18 attcctttccattccattc 36 ||||||||||||||||||| Sbjct: 77154 attcctttccattccattc 77172 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Plus Query: 18 attcctttccattccattc 36 ||||||||||||||||||| Sbjct: 73575 attcctttccattccattc 73593 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Plus Query: 18 attcctttccattccattc 36 ||||||||||||||||||| Sbjct: 66412 attcctttccattccattc 66430 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Plus Query: 18 attcctttccattccattc 36 ||||||||||||||||||| Sbjct: 62883 attcctttccattccattc 62901 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Plus Query: 18 attcctttccattccattc 36 ||||||||||||||||||| Sbjct: 55755 attcctttccattccattc 55773 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Plus Query: 18 attcctttccattccattc 36 ||||||||||||||||||| Sbjct: 52196 attcctttccattccattc 52214 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Plus Query: 18 attcctttccattccattc 36 ||||||||||||||||||| Sbjct: 48622 attcctttccattccattc 48640 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Plus Query: 18 attcctttccattccattc 36 ||||||||||||||||||| Sbjct: 45028 attcctttccattccattc 45046 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Plus Query: 18 attcctttccattccattc 36 ||||||||||||||||||| Sbjct: 41446 attcctttccattccattc 41464 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Plus Query: 18 attcctttccattccattc 36 ||||||||||||||||||| Sbjct: 37872 attcctttccattccattc 37890 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Plus Query: 18 attcctttccattccattc 36 ||||||||||||||||||| Sbjct: 34328 attcctttccattccattc 34346 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Plus Query: 18 attcctttccattccattc 36 ||||||||||||||||||| Sbjct: 30749 attcctttccattccattc 30767 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Plus Query: 18 attcctttccattccattc 36 ||||||||||||||||||| Sbjct: 27170 attcctttccattccattc 27188 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Plus Query: 18 attcctttccattccattc 36 ||||||||||||||||||| Sbjct: 23580 attcctttccattccattc 23598 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Plus Query: 18 attcctttccattccattc 36 ||||||||||||||||||| Sbjct: 20001 attcctttccattccattc 20019 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Plus Query: 18 attcctttccattccattc 36 ||||||||||||||||||| Sbjct: 16542 attcctttccattccattc 16560 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Plus Query: 18 attcctttccattccattc 36 ||||||||||||||||||| Sbjct: 12993 attcctttccattccattc 13011 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Plus Query: 18 attcctttccattccattc 36 ||||||||||||||||||| Sbjct: 9404 attcctttccattccattc 9422 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Plus Query: 18 attcctttccattccattc 36 ||||||||||||||||||| Sbjct: 5855 attcctttccattccattc 5873 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Plus Query: 18 attcctttccattccattc 36 ||||||||||||||||||| Sbjct: 2282 attcctttccattccattc 2300
>gb|AC004902.2|AC004902 Homo sapiens PAC clone RP5-823F17 from 7q36, complete sequence Length = 104154 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Minus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 58482 tccattcctttccattccattc 58461 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Minus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 56715 tccattcctttccattccattc 56694 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Minus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 53748 tccattcctttccattccattc 53727 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Minus Query: 15 tccattcctttccattcca 33 ||||||||||||||||||| Sbjct: 57130 tccattcctttccattcca 57112 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Minus Query: 14 atccattcctttccattccattc 36 ||||||||| ||||||||||||| Sbjct: 53075 atccattccattccattccattc 53053
>gb|AC118282.4| Homo sapiens BAC clone RP11-1281K21 from 4, complete sequence Length = 208765 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Plus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 80688 tccattcctttccattccattc 80709 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Plus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 78861 tccattcctttccattccattc 78882 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Plus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 78377 tccattcctttccattccattc 78398 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Plus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 76785 tccattcctttccattccattc 76806 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Plus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 74342 tccattcctttccattccattc 74363 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Plus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 72659 tccattcctttccattccattc 72680 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Plus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 71193 tccattcctttccattccattc 71214 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Plus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 69091 tccattcctttccattccattc 69112 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Plus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 68709 tccattcctttccattccattc 68730 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Plus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 67945 tccattcctttccattccattc 67966 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Plus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 66861 tccattcctttccattccattc 66882 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Plus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 66686 tccattcctttccattccattc 66707 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Plus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 65506 tccattcctttccattccattc 65527 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Plus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 64422 tccattcctttccattccattc 64443 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Plus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 64247 tccattcctttccattccattc 64268 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Plus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 63007 tccattcctttccattccattc 63028 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Plus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 62473 tccattcctttccattccattc 62494 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Plus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 62308 tccattcctttccattccattc 62329 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Plus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 60130 tccattcctttccattccattc 60151 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Plus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 60075 tccattcctttccattccattc 60096 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Plus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 58801 tccattcctttccattccattc 58822 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Plus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 57887 tccattcctttccattccattc 57908 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Plus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 56974 tccattcctttccattccattc 56995 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Plus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 55399 tccattcctttccattccattc 55420 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Plus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 55244 tccattcctttccattccattc 55265 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Plus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 52303 tccattcctttccattccattc 52324 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Plus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 52248 tccattcctttccattccattc 52269 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Plus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 51004 tccattcctttccattccattc 51025 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Plus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 50105 tccattcctttccattccattc 50126 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Plus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 49187 tccattcctttccattccattc 49208 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Plus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 48113 tccattcctttccattccattc 48134 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Plus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 47948 tccattcctttccattccattc 47969 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Plus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 44888 tccattcctttccattccattc 44909 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Plus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 44319 tccattcctttccattccattc 44340 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Plus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 43430 tccattcctttccattccattc 43451 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Plus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 40906 tccattcctttccattccattc 40927 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Plus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 38982 tccattcctttccattccattc 39003 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Plus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 37913 tccattcctttccattccattc 37934 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Plus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 37103 tccattcctttccattccattc 37124 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Plus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 37043 tccattcctttccattccattc 37064 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Plus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 35914 tccattcctttccattccattc 35935 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Plus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 33849 tccattcctttccattccattc 33870 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Plus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 33834 tccattcctttccattccattc 33855 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Plus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 32411 tccattcctttccattccattc 32432 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Plus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 31970 tccattcctttccattccattc 31991 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Plus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 31746 tccattcctttccattccattc 31767 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Plus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 30888 tccattcctttccattccattc 30909 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Plus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 30336 tccattcctttccattccattc 30357 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Plus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 26648 tccattcctttccattccattc 26669 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Plus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 26222 tccattcctttccattccattc 26243 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Plus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 25998 tccattcctttccattccattc 26019 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Plus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 25090 tccattcctttccattccattc 25111 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Plus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 24867 tccattcctttccattccattc 24888 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Plus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 24728 tccattcctttccattccattc 24749 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Plus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 24084 tccattcctttccattccattc 24105 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Plus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 23720 tccattcctttccattccattc 23741 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Plus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 23331 tccattcctttccattccattc 23352 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Plus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 21490 tccattcctttccattccattc 21511 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Plus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 20815 tccattcctttccattccattc 20836 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Plus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 19901 tccattcctttccattccattc 19922 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Plus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 19206 tccattcctttccattccattc 19227 Score = 42.1 bits (21), Expect = 0.20 Identities = 21/21 (100%) Strand = Plus / Plus Query: 15 tccattcctttccattccatt 35 ||||||||||||||||||||| Sbjct: 38747 tccattcctttccattccatt 38767 Score = 42.1 bits (21), Expect = 0.20 Identities = 21/21 (100%) Strand = Plus / Plus Query: 15 tccattcctttccattccatt 35 ||||||||||||||||||||| Sbjct: 38462 tccattcctttccattccatt 38482 Score = 42.1 bits (21), Expect = 0.20 Identities = 21/21 (100%) Strand = Plus / Plus Query: 15 tccattcctttccattccatt 35 ||||||||||||||||||||| Sbjct: 36618 tccattcctttccattccatt 36638 Score = 42.1 bits (21), Expect = 0.20 Identities = 21/21 (100%) Strand = Plus / Plus Query: 15 tccattcctttccattccatt 35 ||||||||||||||||||||| Sbjct: 30630 tccattcctttccattccatt 30650 Score = 42.1 bits (21), Expect = 0.20 Identities = 21/21 (100%) Strand = Plus / Plus Query: 18 attcctttccattccattcaa 38 ||||||||||||||||||||| Sbjct: 29735 attcctttccattccattcaa 29755 Score = 42.1 bits (21), Expect = 0.20 Identities = 21/21 (100%) Strand = Plus / Plus Query: 15 tccattcctttccattccatt 35 ||||||||||||||||||||| Sbjct: 25065 tccattcctttccattccatt 25085 Score = 42.1 bits (21), Expect = 0.20 Identities = 21/21 (100%) Strand = Plus / Plus Query: 15 tccattcctttccattccatt 35 ||||||||||||||||||||| Sbjct: 24842 tccattcctttccattccatt 24862 Score = 42.1 bits (21), Expect = 0.20 Identities = 21/21 (100%) Strand = Plus / Plus Query: 15 tccattcctttccattccatt 35 ||||||||||||||||||||| Sbjct: 24059 tccattcctttccattccatt 24079 Score = 42.1 bits (21), Expect = 0.20 Identities = 21/21 (100%) Strand = Plus / Plus Query: 18 attcctttccattccattcaa 38 ||||||||||||||||||||| Sbjct: 22661 attcctttccattccattcaa 22681 Score = 42.1 bits (21), Expect = 0.20 Identities = 21/21 (100%) Strand = Plus / Plus Query: 18 attcctttccattccattcaa 38 ||||||||||||||||||||| Sbjct: 21263 attcctttccattccattcaa 21283 Score = 42.1 bits (21), Expect = 0.20 Identities = 21/21 (100%) Strand = Plus / Plus Query: 15 tccattcctttccattccatt 35 ||||||||||||||||||||| Sbjct: 20790 tccattcctttccattccatt 20810 Score = 42.1 bits (21), Expect = 0.20 Identities = 21/21 (100%) Strand = Plus / Plus Query: 18 attcctttccattccattcaa 38 ||||||||||||||||||||| Sbjct: 19654 attcctttccattccattcaa 19674 Score = 42.1 bits (21), Expect = 0.20 Identities = 21/21 (100%) Strand = Plus / Plus Query: 15 tccattcctttccattccatt 35 ||||||||||||||||||||| Sbjct: 19181 tccattcctttccattccatt 19201 Score = 40.1 bits (20), Expect = 0.78 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tccattcctttccattccat 34 |||||||||||||||||||| Sbjct: 81570 tccattcctttccattccat 81589 Score = 40.1 bits (20), Expect = 0.78 Identities = 23/24 (95%) Strand = Plus / Plus Query: 15 tccattcctttccattccattcaa 38 |||||||| ||||||||||||||| Sbjct: 80213 tccattccattccattccattcaa 80236 Score = 40.1 bits (20), Expect = 0.78 Identities = 20/20 (100%) Strand = Plus / Plus Query: 17 cattcctttccattccattc 36 |||||||||||||||||||| Sbjct: 79680 cattcctttccattccattc 79699 Score = 40.1 bits (20), Expect = 0.78 Identities = 23/24 (95%) Strand = Plus / Plus Query: 15 tccattcctttccattccattcaa 38 |||||||| ||||||||||||||| Sbjct: 78347 tccattccattccattccattcaa 78370 Score = 40.1 bits (20), Expect = 0.78 Identities = 23/24 (95%) Strand = Plus / Plus Query: 15 tccattcctttccattccattcaa 38 |||||||| ||||||||||||||| Sbjct: 78107 tccattccattccattccattcaa 78130 Score = 40.1 bits (20), Expect = 0.78 Identities = 23/24 (95%) Strand = Plus / Plus Query: 15 tccattcctttccattccattcaa 38 |||||||| ||||||||||||||| Sbjct: 76430 tccattccattccattccattcaa 76453 Score = 40.1 bits (20), Expect = 0.78 Identities = 23/24 (95%) Strand = Plus / Plus Query: 15 tccattcctttccattccattcaa 38 |||||||| ||||||||||||||| Sbjct: 74087 tccattccattccattccattcaa 74110 Score = 40.1 bits (20), Expect = 0.78 Identities = 23/24 (95%) Strand = Plus / Plus Query: 15 tccattcctttccattccattcaa 38 |||||||| ||||||||||||||| Sbjct: 73872 tccattccattccattccattcaa 73895 Score = 40.1 bits (20), Expect = 0.78 Identities = 23/24 (95%) Strand = Plus / Plus Query: 15 tccattcctttccattccattcaa 38 |||||||| ||||||||||||||| Sbjct: 72069 tccattccattccattccattcaa 72092 Score = 40.1 bits (20), Expect = 0.78 Identities = 23/24 (95%) Strand = Plus / Plus Query: 15 tccattcctttccattccattcaa 38 |||||||| ||||||||||||||| Sbjct: 69281 tccattccattccattccattcaa 69304 Score = 40.1 bits (20), Expect = 0.78 Identities = 23/24 (95%) Strand = Plus / Plus Query: 15 tccattcctttccattccattcaa 38 |||||||| ||||||||||||||| Sbjct: 68941 tccattccattccattccattcaa 68964 Score = 40.1 bits (20), Expect = 0.78 Identities = 23/24 (95%) Strand = Plus / Plus Query: 15 tccattcctttccattccattcaa 38 ||||||||||| |||||||||||| Sbjct: 66479 tccattcctttgcattccattcaa 66502 Score = 40.1 bits (20), Expect = 0.78 Identities = 23/24 (95%) Strand = Plus / Plus Query: 15 tccattcctttccattccattcaa 38 ||||||||||| |||||||||||| Sbjct: 64040 tccattcctttgcattccattcaa 64063 Score = 40.1 bits (20), Expect = 0.78 Identities = 23/24 (95%) Strand = Plus / Plus Query: 15 tccattcctttccattccattcaa 38 |||||||| ||||||||||||||| Sbjct: 58811 tccattccattccattccattcaa 58834 Score = 40.1 bits (20), Expect = 0.78 Identities = 23/24 (95%) Strand = Plus / Plus Query: 15 tccattcctttccattccattcaa 38 ||||||||||| |||||||||||| Sbjct: 56587 tccattcctttgcattccattcaa 56610 Score = 40.1 bits (20), Expect = 0.78 Identities = 23/24 (95%) Strand = Plus / Plus Query: 15 tccattcctttccattccattcaa 38 |||||||| ||||||||||||||| Sbjct: 51014 tccattccattccattccattcaa 51037 Score = 40.1 bits (20), Expect = 0.78 Identities = 20/20 (100%) Strand = Plus / Plus Query: 14 atccattcctttccattcca 33 |||||||||||||||||||| Sbjct: 45477 atccattcctttccattcca 45496 Score = 40.1 bits (20), Expect = 0.78 Identities = 23/24 (95%) Strand = Plus / Plus Query: 15 tccattcctttccattccattcaa 38 |||||||| ||||||||||||||| Sbjct: 43285 tccattccgttccattccattcaa 43308 Score = 40.1 bits (20), Expect = 0.78 Identities = 23/24 (95%) Strand = Plus / Plus Query: 15 tccattcctttccattccattcaa 38 |||||||| ||||||||||||||| Sbjct: 43081 tccattccattccattccattcaa 43104 Score = 40.1 bits (20), Expect = 0.78 Identities = 23/24 (95%) Strand = Plus / Plus Query: 15 tccattcctttccattccattcaa 38 |||||||| ||||||||||||||| Sbjct: 41090 tccattccattccattccattcaa 41113 Score = 40.1 bits (20), Expect = 0.78 Identities = 20/20 (100%) Strand = Plus / Plus Query: 14 atccattcctttccattcca 33 |||||||||||||||||||| Sbjct: 35441 atccattcctttccattcca 35460 Score = 40.1 bits (20), Expect = 0.78 Identities = 20/20 (100%) Strand = Plus / Plus Query: 14 atccattcctttccattcca 33 |||||||||||||||||||| Sbjct: 34583 atccattcctttccattcca 34602 Score = 40.1 bits (20), Expect = 0.78 Identities = 20/20 (100%) Strand = Plus / Plus Query: 14 atccattcctttccattcca 33 |||||||||||||||||||| Sbjct: 33190 atccattcctttccattcca 33209 Score = 40.1 bits (20), Expect = 0.78 Identities = 20/20 (100%) Strand = Plus / Plus Query: 17 cattcctttccattccattc 36 |||||||||||||||||||| Sbjct: 32398 cattcctttccattccattc 32417 Score = 40.1 bits (20), Expect = 0.78 Identities = 20/20 (100%) Strand = Plus / Plus Query: 17 cattcctttccattccattc 36 |||||||||||||||||||| Sbjct: 30403 cattcctttccattccattc 30422 Score = 40.1 bits (20), Expect = 0.78 Identities = 23/24 (95%) Strand = Plus / Plus Query: 15 tccattcctttccattccattcaa 38 |||||||| ||||||||||||||| Sbjct: 30301 tccattccattccattccattcaa 30324 Score = 40.1 bits (20), Expect = 0.78 Identities = 20/20 (100%) Strand = Plus / Plus Query: 14 atccattcctttccattcca 33 |||||||||||||||||||| Sbjct: 28385 atccattcctttccattcca 28404 Score = 40.1 bits (20), Expect = 0.78 Identities = 20/20 (100%) Strand = Plus / Plus Query: 14 atccattcctttccattcca 33 |||||||||||||||||||| Sbjct: 27387 atccattcctttccattcca 27406 Score = 40.1 bits (20), Expect = 0.78 Identities = 20/20 (100%) Strand = Plus / Plus Query: 17 cattcctttccattccattc 36 |||||||||||||||||||| Sbjct: 26635 cattcctttccattccattc 26654 Score = 40.1 bits (20), Expect = 0.78 Identities = 20/20 (100%) Strand = Plus / Plus Query: 17 cattcctttccattccattc 36 |||||||||||||||||||| Sbjct: 25023 cattcctttccattccattc 25042 Score = 40.1 bits (20), Expect = 0.78 Identities = 20/20 (100%) Strand = Plus / Plus Query: 17 cattcctttccattccattc 36 |||||||||||||||||||| Sbjct: 24016 cattcctttccattccattc 24035 Score = 40.1 bits (20), Expect = 0.78 Identities = 20/20 (100%) Strand = Plus / Plus Query: 17 cattcctttccattccattc 36 |||||||||||||||||||| Sbjct: 20747 cattcctttccattccattc 20766 Score = 40.1 bits (20), Expect = 0.78 Identities = 23/24 (95%) Strand = Plus / Plus Query: 15 tccattcctttccattccattcaa 38 |||||||| ||||||||||||||| Sbjct: 20266 tccattccattccattccattcaa 20289 Score = 40.1 bits (20), Expect = 0.78 Identities = 20/20 (100%) Strand = Plus / Plus Query: 17 cattcctttccattccattc 36 |||||||||||||||||||| Sbjct: 19138 cattcctttccattccattc 19157 Score = 40.1 bits (20), Expect = 0.78 Identities = 23/24 (95%) Strand = Plus / Plus Query: 15 tccattcctttccattccattcaa 38 |||||||| ||||||||||||||| Sbjct: 18647 tccattccattccattccattcaa 18670 Score = 40.1 bits (20), Expect = 0.78 Identities = 20/20 (100%) Strand = Plus / Plus Query: 17 cattcctttccattccattc 36 |||||||||||||||||||| Sbjct: 17445 cattcctttccattccattc 17464 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Plus Query: 15 tccattcctttccattcca 33 ||||||||||||||||||| Sbjct: 81849 tccattcctttccattcca 81867 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Plus Query: 14 atccattcctttccattccattc 36 ||||||||| ||||||||||||| Sbjct: 81753 atccattccattccattccattc 81775 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Plus Query: 18 attcctttccattccattc 36 ||||||||||||||||||| Sbjct: 79601 attcctttccattccattc 79619 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Plus Query: 15 tccattcctttccattcca 33 ||||||||||||||||||| Sbjct: 79324 tccattcctttccattcca 79342 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Plus Query: 15 tccattcctttccattccattca 37 |||||||| |||||||||||||| Sbjct: 78946 tccattccattccattccattca 78968 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Plus Query: 18 attcctttccattccattc 36 ||||||||||||||||||| Sbjct: 78150 attcctttccattccattc 78168 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Plus Query: 18 attcctttccattccattc 36 ||||||||||||||||||| Sbjct: 77827 attcctttccattccattc 77845 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Plus Query: 18 attcctttccattccattc 36 ||||||||||||||||||| Sbjct: 77222 attcctttccattccattc 77240 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Plus Query: 18 attcctttccattccattc 36 ||||||||||||||||||| Sbjct: 76838 attcctttccattccattc 76856 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Plus Query: 15 tccattcctttccattccattca 37 |||||||| |||||||||||||| Sbjct: 75966 tccattccattccattccattca 75988 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Plus Query: 14 atccattcctttccattccattc 36 ||||||||| ||||||||||||| Sbjct: 74866 atccattccattccattccattc 74888 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Plus Query: 14 atccattcctttccattccattc 36 ||||||||| ||||||||||||| Sbjct: 74671 atccattccattccattccattc 74693 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Plus Query: 18 attcctttccattccattc 36 ||||||||||||||||||| Sbjct: 74305 attcctttccattccattc 74323 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Plus Query: 14 atccattcctttccattccattc 36 ||||||||| ||||||||||||| Sbjct: 72848 atccattccattccattccattc 72870 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Plus Query: 14 atccattcctttccattccattc 36 ||||||||| ||||||||||||| Sbjct: 72623 atccattccattccattccattc 72645 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Plus Query: 18 attcctttccattccattc 36 ||||||||||||||||||| Sbjct: 72422 attcctttccattccattc 72440 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Plus Query: 18 attcctttccattccattc 36 ||||||||||||||||||| Sbjct: 72112 attcctttccattccattc 72130 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Plus Query: 18 attcctttccattccattc 36 ||||||||||||||||||| Sbjct: 71724 attcctttccattccattc 71742 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Plus Query: 15 tccattcctttccattcca 33 ||||||||||||||||||| Sbjct: 71228 tccattcctttccattcca 71246 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Plus Query: 14 atccattcctttccattccattc 36 ||||||||| ||||||||||||| Sbjct: 70400 atccattccattccattccattc 70422 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Plus Query: 14 atccattcctttccattccattc 36 ||||||||| ||||||||||||| Sbjct: 69750 atccattccattccattccattc 69772 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Plus Query: 18 attcctttccattccattc 36 ||||||||||||||||||| Sbjct: 69484 attcctttccattccattc 69502 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Plus Query: 18 attcctttccattccattc 36 ||||||||||||||||||| Sbjct: 68757 attcctttccattccattc 68775 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Plus Query: 18 attcctttccattccattc 36 ||||||||||||||||||| Sbjct: 67229 attcctttccattccattc 67247 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Plus Query: 18 attcctttccattccattc 36 ||||||||||||||||||| Sbjct: 66208 attcctttccattccattc 66226 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Plus Query: 18 attcctttccattccattc 36 ||||||||||||||||||| Sbjct: 64790 attcctttccattccattc 64808 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Plus Query: 18 attcctttccattccattc 36 ||||||||||||||||||| Sbjct: 64088 attcctttccattccattc 64106 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Plus Query: 18 attcctttccattccattc 36 ||||||||||||||||||| Sbjct: 63769 attcctttccattccattc 63787 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Plus Query: 14 atccattcctttccattccattc 36 ||||||||| ||||||||||||| Sbjct: 61120 atccattccattccattccattc 61142 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Plus Query: 18 attcctttccattccattc 36 ||||||||||||||||||| Sbjct: 60593 attcctttccattccattc 60611 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Plus Query: 18 attcctttccattccattc 36 ||||||||||||||||||| Sbjct: 59808 attcctttccattccattc 59826 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Plus Query: 18 attcctttccattccattc 36 ||||||||||||||||||| Sbjct: 59239 attcctttccattccattc 59257 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Plus Query: 14 atccattcctttccattccattc 36 ||||||||| ||||||||||||| Sbjct: 58010 atccattccattccattccattc 58032 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Plus Query: 18 attcctttccattccattc 36 ||||||||||||||||||| Sbjct: 56635 attcctttccattccattc 56653 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Plus Query: 18 attcctttccattccattc 36 ||||||||||||||||||| Sbjct: 56316 attcctttccattccattc 56334 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Plus Query: 18 attcctttccattccattc 36 ||||||||||||||||||| Sbjct: 55802 attcctttccattccattc 55820 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Plus Query: 18 attcctttccattccattc 36 ||||||||||||||||||| Sbjct: 55477 attcctttccattccattc 55495 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Plus Query: 14 atccattcctttccattccattc 36 ||||||||| ||||||||||||| Sbjct: 53293 atccattccattccattccattc 53315 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Plus Query: 18 attcctttccattccattc 36 ||||||||||||||||||| Sbjct: 52771 attcctttccattccattc 52789 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Plus Query: 18 attcctttccattccattc 36 ||||||||||||||||||| Sbjct: 51981 attcctttccattccattc 51999 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Plus Query: 18 attcctttccattccattc 36 ||||||||||||||||||| Sbjct: 51432 attcctttccattccattc 51450 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Plus Query: 14 atccattcctttccattccattc 36 ||||||||| ||||||||||||| Sbjct: 50228 atccattccattccattccattc 50250 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Plus Query: 18 attcctttccattccattc 36 ||||||||||||||||||| Sbjct: 48516 attcctttccattccattc 48534 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Plus Query: 18 attcctttccattccattc 36 ||||||||||||||||||| Sbjct: 48181 attcctttccattccattc 48199 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Plus Query: 14 atccattcctttccattccattc 36 ||||||||| ||||||||||||| Sbjct: 46511 atccattccattccattccattc 46533 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Plus Query: 18 attcctttccattccattc 36 ||||||||||||||||||| Sbjct: 45081 attcctttccattccattc 45099 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Plus Query: 15 tccattcctttccattccattca 37 |||||||| |||||||||||||| Sbjct: 44463 tccattccattccattccattca 44485 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Plus Query: 18 attcctttccattccattc 36 ||||||||||||||||||| Sbjct: 43837 attcctttccattccattc 43855 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Plus Query: 18 attcctttccattccattc 36 ||||||||||||||||||| Sbjct: 43473 attcctttccattccattc 43491 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Plus Query: 15 tccattcctttccattccattca 37 |||||||| |||||||||||||| Sbjct: 42337 tccattccgttccattccattca 42359 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Plus Query: 18 attcctttccattccattc 36 ||||||||||||||||||| Sbjct: 42300 attcctttccattccattc 42318 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Plus Query: 14 atccattcctttccattccattc 36 ||||||||| ||||||||||||| Sbjct: 41821 atccattccattccattccattc 41843 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Plus Query: 18 attcctttccattccattc 36 ||||||||||||||||||| Sbjct: 39575 attcctttccattccattc 39593 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Plus Query: 18 attcctttccattccattc 36 ||||||||||||||||||| Sbjct: 39255 attcctttccattccattc 39273 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Plus Query: 18 attcctttccattccattc 36 ||||||||||||||||||| Sbjct: 37356 attcctttccattccattc 37374 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Plus Query: 14 atccattcctttccattccattc 36 ||||||||| ||||||||||||| Sbjct: 36003 atccattccattccattccattc 36025 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Plus Query: 18 attcctttccattccattc 36 ||||||||||||||||||| Sbjct: 32093 attcctttccattccattc 32111 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Plus Query: 17 cattcctttccattccatt 35 ||||||||||||||||||| Sbjct: 30587 cattcctttccattccatt 30605 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Plus Query: 18 attcctttccattccattc 36 ||||||||||||||||||| Sbjct: 26345 attcctttccattccattc 26363 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Plus Query: 18 attcctttccattccattc 36 ||||||||||||||||||| Sbjct: 25627 attcctttccattccattc 25645 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Plus Query: 15 tccattcctttccattccattca 37 |||||||| |||||||||||||| Sbjct: 25002 tccattccattccattccattca 25024 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Plus Query: 15 tccattcctttccattccattca 37 |||||||| |||||||||||||| Sbjct: 23995 tccattccattccattccattca 24017 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Plus Query: 18 attcctttccattccattc 36 ||||||||||||||||||| Sbjct: 21832 attcctttccattccattc 21850 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Plus Query: 15 tccattcctttccattccattca 37 |||||||| |||||||||||||| Sbjct: 20726 tccattccattccattccattca 20748 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Plus Query: 15 tccattcctttccattccattca 37 |||||||| |||||||||||||| Sbjct: 20506 tccattccattccattccattca 20528 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Plus Query: 18 attcctttccattccattc 36 ||||||||||||||||||| Sbjct: 20344 attcctttccattccattc 20362 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Plus Query: 15 tccattcctttccattccattca 37 |||||||| |||||||||||||| Sbjct: 20236 tccattccattccattccattca 20258 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Plus Query: 14 atccattcctttccattccattc 36 ||||||||| ||||||||||||| Sbjct: 20085 atccattccgttccattccattc 20107 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Plus Query: 15 tccattcctttccattccattca 37 |||||||| |||||||||||||| Sbjct: 19117 tccattccattccattccattca 19139 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Plus Query: 15 tccattcctttccattccattca 37 |||||||| |||||||||||||| Sbjct: 18897 tccattccattccattccattca 18919 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Plus Query: 18 attcctttccattccattc 36 ||||||||||||||||||| Sbjct: 18725 attcctttccattccattc 18743 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Plus Query: 15 tccattcctttccattccattca 37 |||||||| |||||||||||||| Sbjct: 18617 tccattccattccattccattca 18639 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Plus Query: 14 atccattcctttccattccattc 36 ||||||||| ||||||||||||| Sbjct: 18471 atccattccgttccattccattc 18493 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Plus Query: 17 cattcctttccattccatt 35 ||||||||||||||||||| Sbjct: 16946 cattcctttccattccatt 16964
>gb|AC025226.4|AC025226 Homo sapiens BAC clone RP11-57J19 from Y, complete sequence Length = 168066 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Minus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 162766 tccattcctttccattccattc 162745 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Minus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 162036 tccattcctttccattccattc 162015 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Minus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 160799 tccattcctttccattccattc 160778 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Minus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 157685 tccattcctttccattccattc 157664 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Minus Query: 15 tccattcctttccattcca 33 ||||||||||||||||||| Sbjct: 161204 tccattcctttccattcca 161186
>gb|AC137499.2| Homo sapiens chromosome 16 clone RP11-317D10, complete sequence Length = 159831 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Minus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 26597 tccattcctttccattccattc 26576 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Minus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 21867 tccattcctttccattccattc 21846 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Minus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 21522 tccattcctttccattccattc 21501 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Minus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 17034 tccattcctttccattccattc 17013 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Minus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 15795 tccattcctttccattccattc 15774 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Minus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 15555 tccattcctttccattccattc 15534 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Minus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 14163 tccattcctttccattccattc 14142 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Minus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 14088 tccattcctttccattccattc 14067 Score = 42.1 bits (21), Expect = 0.20 Identities = 24/25 (96%) Strand = Plus / Minus Query: 15 tccattcctttccattccattcaaa 39 |||||||||||| |||||||||||| Sbjct: 29932 tccattcctttcaattccattcaaa 29908 Score = 42.1 bits (21), Expect = 0.20 Identities = 21/21 (100%) Strand = Plus / Minus Query: 18 attcctttccattccattcaa 38 ||||||||||||||||||||| Sbjct: 26559 attcctttccattccattcaa 26539 Score = 40.1 bits (20), Expect = 0.78 Identities = 23/24 (95%) Strand = Plus / Minus Query: 15 tccattcctttccattccattcaa 38 |||||||| ||||||||||||||| Sbjct: 31996 tccattccattccattccattcaa 31973 Score = 40.1 bits (20), Expect = 0.78 Identities = 23/24 (95%) Strand = Plus / Minus Query: 15 tccattcctttccattccattcaa 38 |||||||| ||||||||||||||| Sbjct: 31222 tccattccattccattccattcaa 31199 Score = 40.1 bits (20), Expect = 0.78 Identities = 20/20 (100%) Strand = Plus / Minus Query: 17 cattcctttccattccattc 36 |||||||||||||||||||| Sbjct: 30780 cattcctttccattccattc 30761 Score = 40.1 bits (20), Expect = 0.78 Identities = 23/24 (95%) Strand = Plus / Minus Query: 15 tccattcctttccattccattcaa 38 |||||||| ||||||||||||||| Sbjct: 30342 tccattccattccattccattcaa 30319 Score = 40.1 bits (20), Expect = 0.78 Identities = 23/24 (95%) Strand = Plus / Minus Query: 15 tccattcctttccattccattcaa 38 |||||||| ||||||||||||||| Sbjct: 30282 tccattccattccattccattcaa 30259 Score = 40.1 bits (20), Expect = 0.78 Identities = 23/24 (95%) Strand = Plus / Minus Query: 14 atccattcctttccattccattca 37 ||||||||| |||||||||||||| Sbjct: 29648 atccattccattccattccattca 29625 Score = 40.1 bits (20), Expect = 0.78 Identities = 23/24 (95%) Strand = Plus / Minus Query: 15 tccattcctttccattccattcaa 38 |||||||| ||||||||||||||| Sbjct: 28277 tccattccattccattccattcaa 28254 Score = 40.1 bits (20), Expect = 0.78 Identities = 23/24 (95%) Strand = Plus / Minus Query: 15 tccattcctttccattccattcaa 38 |||||||| ||||||||||||||| Sbjct: 27897 tccattccattccattccattcaa 27874 Score = 40.1 bits (20), Expect = 0.78 Identities = 23/24 (95%) Strand = Plus / Minus Query: 15 tccattcctttccattccattcaa 38 |||||||| ||||||||||||||| Sbjct: 26932 tccattccattccattccattcaa 26909 Score = 40.1 bits (20), Expect = 0.78 Identities = 20/20 (100%) Strand = Plus / Minus Query: 17 cattcctttccattccattc 36 |||||||||||||||||||| Sbjct: 26735 cattcctttccattccattc 26716 Score = 40.1 bits (20), Expect = 0.78 Identities = 20/20 (100%) Strand = Plus / Minus Query: 15 tccattcctttccattccat 34 |||||||||||||||||||| Sbjct: 26032 tccattcctttccattccat 26013 Score = 40.1 bits (20), Expect = 0.78 Identities = 23/24 (95%) Strand = Plus / Minus Query: 15 tccattcctttccattccattcaa 38 |||||||||||||||||| ||||| Sbjct: 21357 tccattcctttccattcctttcaa 21334 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Minus Query: 14 atccattcctttccattccattc 36 ||||||||| ||||||||||||| Sbjct: 32497 atccattccattccattccattc 32475 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Minus Query: 18 attcctttccattccattc 36 ||||||||||||||||||| Sbjct: 32373 attcctttccattccattc 32355 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Minus Query: 15 tccattcctttccattccattca 37 |||||||| |||||||||||||| Sbjct: 32346 tccattccattccattccattca 32324 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Minus Query: 14 atccattcctttccattccattc 36 ||||||||| ||||||||||||| Sbjct: 31368 atccattccattccattccattc 31346 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Minus Query: 15 tccattcctttccattccattca 37 |||||||||||||||| |||||| Sbjct: 30562 tccattcctttccatttcattca 30540 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Minus Query: 15 tccattcctttccattccattca 37 |||||||||||||||| |||||| Sbjct: 30502 tccattcctttccatttcattca 30480 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Minus Query: 15 tccattcctttccattcca 33 ||||||||||||||||||| Sbjct: 27587 tccattcctttccattcca 27569 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Minus Query: 14 atccattcctttccattccattc 36 ||||||||| ||||||||||||| Sbjct: 26613 atccattccattccattccattc 26591 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Minus Query: 14 atccattcctttccattccattc 36 ||||||||| ||||||||||||| Sbjct: 21718 atccattccattccattccattc 21696 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Minus Query: 14 atccattcctttccattccattc 36 ||||||||| ||||||||||||| Sbjct: 20429 atccattccattccattccattc 20407 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Minus Query: 14 atccattcctttccattccattc 36 ||||||||| ||||||||||||| Sbjct: 19034 atccattccattccattccattc 19012 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Minus Query: 15 tccattcctttccattcca 33 ||||||||||||||||||| Sbjct: 18081 tccattcctttccattcca 18063 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Minus Query: 15 tccattcctttccattccattca 37 |||||||| |||||||||||||| Sbjct: 15415 tccattccattccattccattca 15393 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Minus Query: 15 tccattcctttccattccattca 37 |||||||| |||||||||||||| Sbjct: 14795 tccattccattccattccattca 14773 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Minus Query: 15 tccattcctttccattccattca 37 |||||||| |||||||||||||| Sbjct: 14770 tccattccattccattccattca 14748
>gb|AY845708.1|AY845707S2 Homo sapiens clone 20 satellite III mRNA sequence Length = 785 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Minus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 588 tccattcctttccattccattc 567 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Minus Query: 14 atccattcctttccattccattc 36 ||||||||| ||||||||||||| Sbjct: 629 atccattccattccattccattc 607
>gb|AY845705.1| Homo sapiens clone 18 satellite III mRNA sequence Length = 741 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Minus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 138 tccattcctttccattccattc 117 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Minus Query: 15 tccattcctttccattcca 33 ||||||||||||||||||| Sbjct: 662 tccattcctttccattcca 644
>gb|AY845704.1| Homo sapiens clone 17 satellite III mRNA sequence Length = 696 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Minus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 257 tccattcctttccattccattc 236 Score = 42.1 bits (21), Expect = 0.20 Identities = 21/21 (100%) Strand = Plus / Minus Query: 15 tccattcctttccattccatt 35 ||||||||||||||||||||| Sbjct: 637 tccattcctttccattccatt 617 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Minus Query: 18 attcctttccattccattc 36 ||||||||||||||||||| Sbjct: 484 attcctttccattccattc 466 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Minus Query: 14 atccattcctttccattccattc 36 ||||||||| ||||||||||||| Sbjct: 228 atccattccattccattccattc 206
>gb|AY845701.1| Homo sapiens clone 14 satellite III mRNA sequence Length = 491 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Minus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 358 tccattcctttccattccattc 337
>gb|AY845700.1| Homo sapiens clone 13 satellite III mRNA sequence Length = 497 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Minus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 287 tccattcctttccattccattc 266 Score = 42.1 bits (21), Expect = 0.20 Identities = 21/21 (100%) Strand = Plus / Minus Query: 15 tccattcctttccattccatt 35 ||||||||||||||||||||| Sbjct: 182 tccattcctttccattccatt 162
>gb|AY845698.1| Homo sapiens clone 11 satellite III mRNA sequence Length = 432 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Minus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 153 tccattcctttccattccattc 132 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Minus Query: 15 tccattcctttccattcca 33 ||||||||||||||||||| Sbjct: 354 tccattcctttccattcca 336
>gb|AY845697.1| Homo sapiens clone 10 satellite III mRNA sequence Length = 440 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Minus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 257 tccattcctttccattccattc 236 Score = 42.1 bits (21), Expect = 0.20 Identities = 21/21 (100%) Strand = Plus / Minus Query: 15 tccattcctttccattccatt 35 ||||||||||||||||||||| Sbjct: 382 tccattcctttccattccatt 362 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Minus Query: 14 atccattcctttccattccattc 36 ||||||||| ||||||||||||| Sbjct: 228 atccattccattccattccattc 206
>emb|AL671532.13| Human DNA sequence from clone RP11-512A4 on chromosome 22, complete sequence Length = 211173 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Minus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 200511 tccattcctttccattccattc 200490 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Minus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 194188 tccattcctttccattccattc 194167 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Minus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 191422 tccattcctttccattccattc 191401 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Minus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 190097 tccattcctttccattccattc 190076 Score = 42.1 bits (21), Expect = 0.20 Identities = 21/21 (100%) Strand = Plus / Minus Query: 16 ccattcctttccattccattc 36 ||||||||||||||||||||| Sbjct: 199303 ccattcctttccattccattc 199283 Score = 42.1 bits (21), Expect = 0.20 Identities = 21/21 (100%) Strand = Plus / Minus Query: 15 tccattcctttccattccatt 35 ||||||||||||||||||||| Sbjct: 196018 tccattcctttccattccatt 195998 Score = 40.1 bits (20), Expect = 0.78 Identities = 20/20 (100%) Strand = Plus / Minus Query: 17 cattcctttccattccattc 36 |||||||||||||||||||| Sbjct: 198563 cattcctttccattccattc 198544 Score = 40.1 bits (20), Expect = 0.78 Identities = 23/24 (95%) Strand = Plus / Minus Query: 15 tccattcctttccattccattcaa 38 |||||||| ||||||||||||||| Sbjct: 198540 tccattccattccattccattcaa 198517 Score = 40.1 bits (20), Expect = 0.78 Identities = 20/20 (100%) Strand = Plus / Minus Query: 17 cattcctttccattccattc 36 |||||||||||||||||||| Sbjct: 194991 cattcctttccattccattc 194972 Score = 40.1 bits (20), Expect = 0.78 Identities = 23/24 (95%) Strand = Plus / Minus Query: 15 tccattcctttccattccattcaa 38 |||||||| ||||||||||||||| Sbjct: 194908 tccattccgttccattccattcaa 194885 Score = 40.1 bits (20), Expect = 0.78 Identities = 20/20 (100%) Strand = Plus / Minus Query: 17 cattcctttccattccattc 36 |||||||||||||||||||| Sbjct: 194621 cattcctttccattccattc 194602 Score = 40.1 bits (20), Expect = 0.78 Identities = 23/24 (95%) Strand = Plus / Minus Query: 15 tccattcctttccattccattcaa 38 |||||||||||||||| ||||||| Sbjct: 193572 tccattcctttccattacattcaa 193549 Score = 40.1 bits (20), Expect = 0.78 Identities = 23/24 (95%) Strand = Plus / Minus Query: 15 tccattcctttccattccattcaa 38 |||||||| ||||||||||||||| Sbjct: 193317 tccattccattccattccattcaa 193294 Score = 40.1 bits (20), Expect = 0.78 Identities = 23/24 (95%) Strand = Plus / Minus Query: 15 tccattcctttccattccattcaa 38 |||||||| ||||||||||||||| Sbjct: 189349 tccattccattccattccattcaa 189326 Score = 40.1 bits (20), Expect = 0.78 Identities = 23/24 (95%) Strand = Plus / Minus Query: 15 tccattcctttccattccattcaa 38 |||||||| ||||||||||||||| Sbjct: 189264 tccattccattccattccattcaa 189241 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Minus Query: 18 attcctttccattccattc 36 ||||||||||||||||||| Sbjct: 200528 attcctttccattccattc 200510 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Minus Query: 15 tccattcctttccattcca 33 ||||||||||||||||||| Sbjct: 198590 tccattcctttccattcca 198572 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Minus Query: 18 attcctttccattccattc 36 ||||||||||||||||||| Sbjct: 198123 attcctttccattccattc 198105 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Minus Query: 18 attcctttccattccattc 36 ||||||||||||||||||| Sbjct: 197938 attcctttccattccattc 197920 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Minus Query: 15 tccattcctttccattcca 33 ||||||||||||||||||| Sbjct: 196753 tccattcctttccattcca 196735 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Minus Query: 15 tccattcctttccattcca 33 ||||||||||||||||||| Sbjct: 196473 tccattcctttccattcca 196455 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Minus Query: 15 tccattcctttccattccattca 37 |||||||| |||||||||||||| Sbjct: 195708 tccattccattccattccattca 195686 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Minus Query: 15 tccattcctttccattccattca 37 |||||||| |||||||||||||| Sbjct: 193732 tccattccgttccattccattca 193710 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Minus Query: 18 attcctttccattccattc 36 ||||||||||||||||||| Sbjct: 193324 attcctttccattccattc 193306 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Minus Query: 15 tccattcctttccattcca 33 ||||||||||||||||||| Sbjct: 192452 tccattcctttccattcca 192434 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Minus Query: 17 cattcctttccattccattcaaa 39 |||||| |||||||||||||||| Sbjct: 192156 cattccattccattccattcaaa 192134
>gb|AC148935.6| Pan troglodytes BAC clone CH251-485J2 from chromosome 7, complete sequence Length = 215177 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Plus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 35580 tccattcctttccattccattc 35601 Score = 40.1 bits (20), Expect = 0.78 Identities = 23/24 (95%) Strand = Plus / Plus Query: 15 tccattcctttccattccattcaa 38 |||||||| ||||||||||||||| Sbjct: 23900 tccattccgttccattccattcaa 23923 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Plus Query: 15 tccattcctttccattcca 33 ||||||||||||||||||| Sbjct: 28402 tccattcctttccattcca 28420 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Plus Query: 16 ccattcctttccattccattcaa 38 ||||||| ||||||||||||||| Sbjct: 24100 ccattccattccattccattcaa 24122
>gb|S90110.1|S90110 {satellite III subfamily pTRS-63} [human, Genomic, 1404 nt] Length = 1404 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Minus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 898 tccattcctttccattccattc 877 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Minus Query: 14 atccattcctttccattccattc 36 ||||||||| ||||||||||||| Sbjct: 379 atccattccattccattccattc 357
>emb|X82942.1|HSSATL3 H.sapiens satellite 3 DNA Length = 794 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Plus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 680 tccattcctttccattccattc 701
>emb|Y00139.1|HSSAT3R Human satellite III degenerate pentameric repeat Length = 332 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Minus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 68 tccattcctttccattccattc 47 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Minus Query: 14 atccattcctttccattccattc 36 ||||||||| ||||||||||||| Sbjct: 39 atccattccattccattccattc 17
>emb|X06228.1|HSDYZ1 Human Y-chromosome specific repetitive DNA family (DYZ1) sequence Length = 3564 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Plus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 1905 tccattcctttccattccattc 1926 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Plus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 1239 tccattcctttccattccattc 1260 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Plus Query: 18 attcctttccattccattc 36 ||||||||||||||||||| Sbjct: 2274 attcctttccattccattc 2292
>emb|AJ343365.1|HSA343365 Homo sapiens genomic sequence surrounding NotI site, clone NR5-KJ17RS Length = 835 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Plus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 44 tccattcctttccattccattc 65
>emb|AJ343361.1|HSA343361 Homo sapiens genomic sequence surrounding NotI site, clone NR5-KF11RS Length = 802 Score = 44.1 bits (22), Expect = 0.050 Identities = 22/22 (100%) Strand = Plus / Plus Query: 15 tccattcctttccattccattc 36 |||||||||||||||||||||| Sbjct: 44 tccattcctttccattccattc 65
>gb|AC147140.4| Pan troglodytes BAC clone CH251-329N7 from Y, complete sequence Length = 149061 Score = 42.1 bits (21), Expect = 0.20 Identities = 21/21 (100%) Strand = Plus / Minus Query: 15 tccattcctttccattccatt 35 ||||||||||||||||||||| Sbjct: 958 tccattcctttccattccatt 938 Score = 40.1 bits (20), Expect = 0.78 Identities = 23/24 (95%) Strand = Plus / Minus Query: 15 tccattcctttccattccattcaa 38 |||||||| ||||||||||||||| Sbjct: 1835 tccattccattccattccattcaa 1812
>gb|AC175749.2| Pan troglodytes BAC clone CH251-1124N9 from chromosome y, complete sequence Length = 176979 Score = 42.1 bits (21), Expect = 0.20 Identities = 21/21 (100%) Strand = Plus / Minus Query: 15 tccattcctttccattccatt 35 ||||||||||||||||||||| Sbjct: 5804 tccattcctttccattccatt 5784 Score = 42.1 bits (21), Expect = 0.20 Identities = 21/21 (100%) Strand = Plus / Minus Query: 15 tccattcctttccattccatt 35 ||||||||||||||||||||| Sbjct: 4515 tccattcctttccattccatt 4495 Score = 40.1 bits (20), Expect = 0.78 Identities = 20/20 (100%) Strand = Plus / Minus Query: 15 tccattcctttccattccat 34 |||||||||||||||||||| Sbjct: 5082 tccattcctttccattccat 5063 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Plus Query: 18 attcctttccattccattc 36 ||||||||||||||||||| Sbjct: 23958 attcctttccattccattc 23976 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Plus Query: 17 cattcctttccattccatt 35 ||||||||||||||||||| Sbjct: 23882 cattcctttccattccatt 23900 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Plus Query: 15 tccattcctttccattcca 33 ||||||||||||||||||| Sbjct: 23064 tccattcctttccattcca 23082 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Plus Query: 18 attcctttccattccattc 36 ||||||||||||||||||| Sbjct: 8338 attcctttccattccattc 8356
>gb|AC129779.2| Homo sapiens BAC clone RP11-1360O11 from UL, complete sequence Length = 28549 Score = 42.1 bits (21), Expect = 0.20 Identities = 21/21 (100%) Strand = Plus / Plus Query: 18 attcctttccattccattcaa 38 ||||||||||||||||||||| Sbjct: 6541 attcctttccattccattcaa 6561
>ref|XM_936737.1| PREDICTED: Homo sapiens hypothetical protein LOC647680 (LOC647680), mRNA Length = 117 Score = 42.1 bits (21), Expect = 0.20 Identities = 21/21 (100%) Strand = Plus / Minus Query: 15 tccattcctttccattccatt 35 ||||||||||||||||||||| Sbjct: 40 tccattcctttccattccatt 20
>gb|AY833661.1| Homo sapiens chromosome 21 short arm satellite III 1-7.3a sequence Length = 2577 Score = 42.1 bits (21), Expect = 0.20 Identities = 21/21 (100%) Strand = Plus / Minus Query: 15 tccattcctttccattccatt 35 ||||||||||||||||||||| Sbjct: 1935 tccattcctttccattccatt 1915 Score = 42.1 bits (21), Expect = 0.20 Identities = 21/21 (100%) Strand = Plus / Minus Query: 16 ccattcctttccattccattc 36 ||||||||||||||||||||| Sbjct: 1859 ccattcctttccattccattc 1839 Score = 40.1 bits (20), Expect = 0.78 Identities = 23/24 (95%) Strand = Plus / Minus Query: 15 tccattcctttccattccattcaa 38 |||||||| ||||||||||||||| Sbjct: 2409 tccattccattccattccattcaa 2386 Score = 40.1 bits (20), Expect = 0.78 Identities = 23/24 (95%) Strand = Plus / Minus Query: 15 tccattcctttccattccattcaa 38 |||||||| ||||||||||||||| Sbjct: 2015 tccattccattccattccattcaa 1992 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Minus Query: 16 ccattcctttccattccattcaa 38 ||||||| ||||||||||||||| Sbjct: 2567 ccattccattccattccattcaa 2545 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Minus Query: 18 attcctttccattccattc 36 ||||||||||||||||||| Sbjct: 49 attcctttccattccattc 31
>gb|AC010122.7|AC010122 Drosophila melanogaster, chromosome 3R, region 89A-89A, BAC clone BACR06B08, complete sequence Length = 151447 Score = 42.1 bits (21), Expect = 0.20 Identities = 24/25 (96%) Strand = Plus / Minus Query: 15 tccattcctttccattccattcaaa 39 |||||||| |||||||||||||||| Sbjct: 4724 tccattccattccattccattcaaa 4700
>gb|AY845696.1| Homo sapiens clone 9 satellite III mRNA sequence Length = 355 Score = 42.1 bits (21), Expect = 0.20 Identities = 21/21 (100%) Strand = Plus / Minus Query: 15 tccattcctttccattccatt 35 ||||||||||||||||||||| Sbjct: 251 tccattcctttccattccatt 231 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Minus Query: 18 attcctttccattccattc 36 ||||||||||||||||||| Sbjct: 121 attcctttccattccattc 103 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Minus Query: 14 atccattcctttccattccattc 36 ||||||||| ||||||||||||| Sbjct: 95 atccattccattccattccattc 73
>gb|AY845695.1| Homo sapiens clone 8 satellite III mRNA sequence Length = 301 Score = 42.1 bits (21), Expect = 0.20 Identities = 21/21 (100%) Strand = Plus / Minus Query: 15 tccattcctttccattccatt 35 ||||||||||||||||||||| Sbjct: 132 tccattcctttccattccatt 112
>gb|AY845694.1| Homo sapiens clone 7 satellite III mRNA sequence Length = 285 Score = 42.1 bits (21), Expect = 0.20 Identities = 21/21 (100%) Strand = Plus / Minus Query: 15 tccattcctttccattccatt 35 ||||||||||||||||||||| Sbjct: 178 tccattcctttccattccatt 158
>gb|AY845692.1| Homo sapiens clone 5 satellite III mRNA sequence Length = 218 Score = 42.1 bits (21), Expect = 0.20 Identities = 21/21 (100%) Strand = Plus / Minus Query: 15 tccattcctttccattccatt 35 ||||||||||||||||||||| Sbjct: 33 tccattcctttccattccatt 13
>emb|Z57944.1|HS21G8R H.sapiens CpG island DNA genomic Mse1 fragment, clone 21g8, reverse read cpg21g8.rt1b Length = 324 Score = 42.1 bits (21), Expect = 0.20 Identities = 21/21 (100%) Strand = Plus / Plus Query: 15 tccattcctttccattccatt 35 ||||||||||||||||||||| Sbjct: 78 tccattcctttccattccatt 98 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Plus Query: 20 tcctttccattccattcaa 38 ||||||||||||||||||| Sbjct: 207 tcctttccattccattcaa 225 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Plus Query: 18 attcctttccattccattc 36 ||||||||||||||||||| Sbjct: 1 attcctttccattccattc 19
>gb|AC006414.6|AC006414 Drosophila melanogaster, chromosome 3R, region 89A1-89A5, BAC clone BACR48G17, complete sequence Length = 179122 Score = 42.1 bits (21), Expect = 0.20 Identities = 24/25 (96%) Strand = Plus / Minus Query: 15 tccattcctttccattccattcaaa 39 |||||||| |||||||||||||||| Sbjct: 115737 tccattccattccattccattcaaa 115713
>gb|AF147380.1|AF147380 Homo sapiens full length insert cDNA clone YB67A06 Length = 655 Score = 42.1 bits (21), Expect = 0.20 Identities = 21/21 (100%) Strand = Plus / Minus Query: 15 tccattcctttccattccatt 35 ||||||||||||||||||||| Sbjct: 554 tccattcctttccattccatt 534 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Minus Query: 15 tccattcctttccattcca 33 ||||||||||||||||||| Sbjct: 159 tccattcctttccattcca 141
>gb|AE003710.2| Drosophila melanogaster chromosome 3R, section 48 of 118 of the complete sequence Length = 224071 Score = 42.1 bits (21), Expect = 0.20 Identities = 24/25 (96%) Strand = Plus / Minus Query: 15 tccattcctttccattccattcaaa 39 |||||||| |||||||||||||||| Sbjct: 104967 tccattccattccattccattcaaa 104943
>emb|Z79305.1|HSPA2H12 H.sapiens flow-sorted chromosome 6 TaqI fragment, SC6pA2H12 Length = 223 Score = 42.1 bits (21), Expect = 0.20 Identities = 21/21 (100%) Strand = Plus / Minus Query: 15 tccattcctttccattccatt 35 ||||||||||||||||||||| Sbjct: 180 tccattcctttccattccatt 160
>emb|X59320.1|HSIGCHI1 H.sapiens immunoglobulin kappa locus repetitive DNA (cos207/p207-1) Length = 216 Score = 42.1 bits (21), Expect = 0.20 Identities = 21/21 (100%) Strand = Plus / Minus Query: 15 tccattcctttccattccatt 35 ||||||||||||||||||||| Sbjct: 105 tccattcctttccattccatt 85
>emb|AL591742.7| Human DNA sequence from clone RP4-590F24 on chromosome 1 Contains the 3' end of the gene for HNOEL-iso protein (HNOEL-iso) and a ribosomal protein L13a (RPL13A) pseudogene, complete sequence Length = 86049 Score = 40.1 bits (20), Expect = 0.78 Identities = 20/20 (100%) Strand = Plus / Minus Query: 24 ttccattccattcaaaggaa 43 |||||||||||||||||||| Sbjct: 57296 ttccattccattcaaaggaa 57277
>gb|AC127387.3| Homo sapiens BAC clone RP11-28J3 from UL, complete sequence Length = 47702 Score = 40.1 bits (20), Expect = 0.78 Identities = 20/20 (100%) Strand = Plus / Plus Query: 18 attcctttccattccattca 37 |||||||||||||||||||| Sbjct: 5863 attcctttccattccattca 5882
>emb|CR381653.11| Human DNA sequence from clone bP-21264C1 on chromosome 21, complete sequence Length = 131056 Score = 40.1 bits (20), Expect = 0.78 Identities = 23/24 (95%) Strand = Plus / Minus Query: 15 tccattcctttccattccattcaa 38 |||||||| ||||||||||||||| Sbjct: 199 tccattccattccattccattcaa 176 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Minus Query: 14 atccattcctttccattccattc 36 ||||||||| ||||||||||||| Sbjct: 805 atccattccattccattccattc 783
>gb|AC126783.33| Medicago truncatula clone mth2-15k17, complete sequence Length = 117437 Score = 40.1 bits (20), Expect = 0.78 Identities = 20/20 (100%) Strand = Plus / Plus Query: 23 tttccattccattcaaagga 42 |||||||||||||||||||| Sbjct: 60046 tttccattccattcaaagga 60065
>gb|AF298074.1|AF298074 Homo sapiens clone pE-1 microsatellite III sequence Length = 1748 Score = 40.1 bits (20), Expect = 0.78 Identities = 23/24 (95%) Strand = Plus / Minus Query: 15 tccattcctttccattccattcaa 38 |||||||| ||||||||||||||| Sbjct: 970 tccattccattccattccattcaa 947 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Minus Query: 14 atccattcctttccattccattc 36 ||||||||| ||||||||||||| Sbjct: 991 atccattccattccattccattc 969 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Minus Query: 14 atccattcctttccattccattc 36 ||||||||| ||||||||||||| Sbjct: 432 atccattccattccattccattc 410
>gb|AC015998.8|AC015998 Homo sapiens, clone RP11-15J14, complete sequence Length = 156873 Score = 40.1 bits (20), Expect = 0.78 Identities = 23/24 (95%) Strand = Plus / Minus Query: 13 gatccattcctttccattccattc 36 |||||||||| ||||||||||||| Sbjct: 132189 gatccattccattccattccattc 132166
>emb|AL954308.12| Zebrafish DNA sequence from clone DKEY-13J15 in linkage group 4, complete sequence Length = 223608 Score = 40.1 bits (20), Expect = 0.78 Identities = 23/24 (95%) Strand = Plus / Minus Query: 15 tccattcctttccattccattcaa 38 |||||||| ||||||||||||||| Sbjct: 39999 tccattccattccattccattcaa 39976
>gb|AC138393.2| Homo sapiens chromosome 1 clone RP11-504P24, complete sequence Length = 184644 Score = 40.1 bits (20), Expect = 0.78 Identities = 23/24 (95%) Strand = Plus / Minus Query: 15 tccattcctttccattccattcaa 38 |||||||| ||||||||||||||| Sbjct: 119119 tccattccattccattccattcaa 119096 Score = 40.1 bits (20), Expect = 0.78 Identities = 23/24 (95%) Strand = Plus / Minus Query: 15 tccattcctttccattccattcaa 38 ||||||| |||||||||||||||| Sbjct: 118247 tccattcttttccattccattcaa 118224 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Minus Query: 15 tccattcctttccattccattca 37 |||||||| |||||||||||||| Sbjct: 114512 tccattccattccattccattca 114490
>gb|AC062016.5| Homo sapiens BAC clone RP11-59P4 from 2, complete sequence Length = 187799 Score = 40.1 bits (20), Expect = 0.78 Identities = 20/20 (100%) Strand = Plus / Minus Query: 51 agccagggattactggctgc 70 |||||||||||||||||||| Sbjct: 127693 agccagggattactggctgc 127674
>gb|AY845707.1|AY845707S1 Homo sapiens clone 20 satellite III mRNA sequence Length = 666 Score = 40.1 bits (20), Expect = 0.78 Identities = 20/20 (100%) Strand = Plus / Minus Query: 17 cattcctttccattccattc 36 |||||||||||||||||||| Sbjct: 86 cattcctttccattccattc 67 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Minus Query: 15 tccattcctttccattccattca 37 |||||||| |||||||||||||| Sbjct: 274 tccattccattccattccattca 252
>gb|AY845703.1| Homo sapiens clone 16 satellite III mRNA sequence Length = 574 Score = 40.1 bits (20), Expect = 0.78 Identities = 23/24 (95%) Strand = Plus / Minus Query: 15 tccattcctttccattccattcaa 38 |||||||| ||||||||||||||| Sbjct: 143 tccattccattccattccattcaa 120 Score = 40.1 bits (20), Expect = 0.78 Identities = 23/24 (95%) Strand = Plus / Minus Query: 15 tccattcctttccattccattcaa 38 |||||||| ||||||||||||||| Sbjct: 48 tccattccattccattccattcaa 25
>gb|AY845699.1| Homo sapiens clone 12 satellite III mRNA sequence Length = 478 Score = 40.1 bits (20), Expect = 0.78 Identities = 23/24 (95%) Strand = Plus / Minus Query: 15 tccattcctttccattccattcaa 38 |||||||| ||||||||||||||| Sbjct: 317 tccattccattccattccattcaa 294
>emb|AL583842.40| Human DNA sequence from clone RP11-417J8 on chromosome 1, complete sequence Length = 195588 Score = 40.1 bits (20), Expect = 0.78 Identities = 23/24 (95%) Strand = Plus / Minus Query: 15 tccattcctttccattccattcaa 38 ||||||| |||||||||||||||| Sbjct: 3282 tccattcttttccattccattcaa 3259 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Minus Query: 14 atccattcctttccattccattc 36 ||||||||| ||||||||||||| Sbjct: 5372 atccattccattccattccattc 5350 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Minus Query: 14 atccattcctttccattccattc 36 ||||||||| ||||||||||||| Sbjct: 959 atccattccattccattccattc 937
>gb|S49998.1|S49998 {R-DNA, alphoid repetitive sequence, satellite III DNA} [human, placenta, clone pH2b, Genomic, 278 nt] Length = 278 Score = 40.1 bits (20), Expect = 0.78 Identities = 23/24 (95%) Strand = Plus / Plus Query: 15 tccattcctttccattccattcaa 38 |||||||| ||||||||||||||| Sbjct: 10 tccattccattccattccattcaa 33 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Plus Query: 15 tccattcctttccattccattca 37 |||||||| |||||||||||||| Sbjct: 100 tccattccattccattccattca 122
>dbj|AP003465.2| Homo sapiens genomic DNA, chromosome 8q23, clone:KB1043D8 Length = 230879 Score = 40.1 bits (20), Expect = 0.78 Identities = 23/24 (95%) Strand = Plus / Minus Query: 13 gatccattcctttccattccattc 36 |||||||||| ||||||||||||| Sbjct: 57472 gatccattccattccattccattc 57449
>gb|AF035810.1| Homo sapiens clone cos 9.27.3/1.2 satellite 3 repetitive DNA Length = 1098 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Plus Query: 14 atccattcctttccattccattc 36 ||||||||| ||||||||||||| Sbjct: 964 atccattccattccattccattc 986
>gb|AC147649.2| Homo sapiens BAC clone RP11-188B11 from UL, complete sequence Length = 150742 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Plus Query: 18 attcctttccattccattc 36 ||||||||||||||||||| Sbjct: 150574 attcctttccattccattc 150592
>gb|AC146377.5| Pan troglodytes BAC clone RP43-79B6 from 7, complete sequence Length = 195459 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Plus Query: 14 atccattcctttccattcc 32 ||||||||||||||||||| Sbjct: 80874 atccattcctttccattcc 80892
>gb|AC156947.7| Mus musculus 10 BAC RP24-374M24 (Roswell Park Cancer Institute (C57BL/6J Male) Mouse BAC Library) complete sequence Length = 177171 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Minus Query: 18 attcctttccattccattc 36 ||||||||||||||||||| Sbjct: 31002 attcctttccattccattc 30984
>gb|AC002067.2| Homo sapiens BAC clone CTB-126M9 from 7, complete sequence Length = 162912 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Plus Query: 14 atccattcctttccattcc 32 ||||||||||||||||||| Sbjct: 54303 atccattcctttccattcc 54321
>gb|DQ483451.1| Gymnogyps californianus clone 10D microsatellite sequence Length = 710 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Plus Query: 15 tccattcctttccattccattca 37 |||||||| |||||||||||||| Sbjct: 264 tccattccattccattccattca 286
>gb|AC129092.13| Medicago truncatula clone mth2-17n16, complete sequence Length = 104281 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Minus Query: 13 gatccattcctttccattccatt 35 |||||||| |||||||||||||| Sbjct: 54427 gatccatttctttccattccatt 54405
>emb|AL450384.34| Human DNA sequence from clone RP11-383B4 on chromosome 10 Contains the 3' end of the CACNB2 gene for calcium channel voltage-dependent beta 2 subunit, the 5' end of a novel gene, a novel gene and the 3' end of a novel gene (LOC221078) (FLJ23743), complete sequence Length = 124571 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Plus Query: 17 cattcctttccattccatt 35 ||||||||||||||||||| Sbjct: 58663 cattcctttccattccatt 58681 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Minus Query: 14 atccattcctttccattccattc 36 ||||||||| ||||||||||||| Sbjct: 44172 atccattccattccattccattc 44150
>emb|AL392044.7| Human DNA sequence from clone RP11-195E11 on chromosome 9 Contains the 5' end of a novel gene (MGC21981), three novel genes and a CpG island, complete sequence Length = 167206 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Minus Query: 15 tccattcctttccattcca 33 ||||||||||||||||||| Sbjct: 16482 tccattcctttccattcca 16464
>emb|AL008710.1|HS292H14 Human DNA sequence from clone RP1-292H14 on chromosome Xp21, complete sequence Length = 97129 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Minus Query: 15 tccattcctttccattccattca 37 |||||||| |||||||||||||| Sbjct: 86885 tccattccattccattccattca 86863
>gb|AC127701.2| Homo sapiens BAC clone RP11-79F18 from UL, complete sequence Length = 161405 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Minus Query: 18 attcctttccattccattc 36 ||||||||||||||||||| Sbjct: 4669 attcctttccattccattc 4651
>gb|AC008759.9| Homo sapiens chromosome 19 clone CTD-3116E22, complete sequence Length = 206395 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Minus Query: 15 tccattcctttccattccattca 37 |||||||| |||||||||||||| Sbjct: 52631 tccattccattccattccattca 52609
>emb|CR589927.1| Human DNA sequence from clone WI2-620K10 on chromosome 1, complete sequence Length = 36909 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Plus Query: 14 atccattcctttccattccattc 36 ||||||||| ||||||||||||| Sbjct: 36053 atccattccattccattccattc 36075
>ref|XM_942023.1| PREDICTED: Homo sapiens hypothetical protein LOC652535 (LOC652535), mRNA Length = 171 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Minus Query: 18 attcctttccattccattc 36 ||||||||||||||||||| Sbjct: 52 attcctttccattccattc 34
>gb|AF298075.1|AF298075 Homo sapiens clone pR-2 microsatellite III sequence Length = 1556 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Minus Query: 15 tccattcctttccattcca 33 ||||||||||||||||||| Sbjct: 46 tccattcctttccattcca 28
>gb|AC007414.6| Drosophila melanogaster, chromosome 2R, region 46C-46D, BAC clone BACR06J01, complete sequence Length = 172904 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Minus Query: 14 atccattcctttccattccattc 36 ||||||||| ||||||||||||| Sbjct: 78865 atccattccattccattccattc 78843
>gb|AC135776.3| Homo sapiens chromosome 16 clone CTD-2144E22, complete sequence Length = 168546 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Minus Query: 18 attcctttccattccattc 36 ||||||||||||||||||| Sbjct: 160540 attcctttccattccattc 160522 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Minus Query: 18 attcctttccattccattcaaag 40 ||||| ||||||||||||||||| Sbjct: 149246 attccattccattccattcaaag 149224
>gb|AF334559.1|AF334559 Homo sapiens chromosome Y landmark: proximal boundary of heterochromatic region Length = 1001 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Minus Query: 15 tccattcctttccattcca 33 ||||||||||||||||||| Sbjct: 880 tccattcctttccattcca 862
>gb|AC008202.4|AC008202 Drosophila melanogaster, chromosome 3R, region 95C-95D, BAC clone BACR15J11, complete sequence Length = 186159 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Plus Query: 14 atccattcctttccattccattc 36 ||||||||| ||||||||||||| Sbjct: 78356 atccattccattccattccattc 78378
>gb|AC010906.10| Homo sapiens BAC clone RP11-566O4 from 2, complete sequence Length = 208571 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Plus Query: 14 atccattcctttccattccattc 36 ||||||||| ||||||||||||| Sbjct: 137384 atccattccattccattccattc 137406
>gb|AC146179.2| Pan troglodytes BAC clone RP43-36B22 from chromosome 7, complete sequence Length = 159208 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Minus Query: 18 attcctttccattccattc 36 ||||||||||||||||||| Sbjct: 147299 attcctttccattccattc 147281
>gb|AC147060.2| Homo sapiens BAC clone RP11-268B15 from 4, complete sequence Length = 174548 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Plus Query: 15 tccattcctttccattcca 33 ||||||||||||||||||| Sbjct: 10 tccattcctttccattcca 28
>gb|AC145621.2| Homo sapiens BAC clone RP11-365B19 from 4, complete sequence Length = 167934 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Plus Query: 15 tccattcctttccattcca 33 ||||||||||||||||||| Sbjct: 10 tccattcctttccattcca 28
>gb|AC019099.6|AC019099 Homo sapiens BAC clone RP11-428D10 from Y, complete sequence Length = 108533 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Minus Query: 15 tccattcctttccattcca 33 ||||||||||||||||||| Sbjct: 107684 tccattcctttccattcca 107666
>gb|AF165139.6| Homo sapiens chromosome 9 clone RP11-44L18 map unmapped, complete sequence Length = 153942 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Plus Query: 15 tccattcctttccattcca 33 ||||||||||||||||||| Sbjct: 86515 tccattcctttccattcca 86533
>gb|AY845706.1| Homo sapiens clone 19 satellite III mRNA sequence Length = 1206 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Minus Query: 15 tccattcctttccattcca 33 ||||||||||||||||||| Sbjct: 680 tccattcctttccattcca 662 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Minus Query: 14 atccattcctttccattccattc 36 ||||||||| ||||||||||||| Sbjct: 599 atccattccattccattccattc 577 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Minus Query: 14 atccattcctttccattccattc 36 ||||||||| ||||||||||||| Sbjct: 239 atccattccattccattccattc 217
>gb|AY845702.1| Homo sapiens clone 15 satellite III mRNA sequence Length = 537 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Minus Query: 15 tccattcctttccattcca 33 ||||||||||||||||||| Sbjct: 458 tccattcctttccattcca 440
>gb|AY845691.1| Homo sapiens clone 4 satellite III mRNA sequence Length = 167 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Minus Query: 15 tccattcctttccattcca 33 ||||||||||||||||||| Sbjct: 47 tccattcctttccattcca 29
>emb|BX640538.4| Human DNA sequence from clone RP6-238B6 on chromosome 1, complete sequence Length = 165731 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Minus Query: 15 tccattcctttccattcca 33 ||||||||||||||||||| Sbjct: 647 tccattcctttccattcca 629
>gb|AC154781.2| Mus musculus BAC clone RP24-463K5 from 16, complete sequence Length = 173258 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Plus Query: 14 atccattcctttccattccattc 36 ||||||||| ||||||||||||| Sbjct: 171423 atccattccattccattccattc 171445
>gb|AE003745.4| Drosophila melanogaster chromosome 3R, section 83 of 118 of the complete sequence Length = 230236 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Plus Query: 14 atccattcctttccattccattc 36 ||||||||| ||||||||||||| Sbjct: 208244 atccattccattccattccattc 208266
>gb|AE003831.3| Drosophila melanogaster chromosome 2R, section 19 of 73 of the complete sequence Length = 275390 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Minus Query: 14 atccattcctttccattccattc 36 ||||||||| ||||||||||||| Sbjct: 176158 atccattccattccattccattc 176136
>gb|AC172370.2| Gallus gallus BAC clone CH261-119J18 from chromosome ul, complete sequence Length = 260878 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Minus Query: 18 attcctttccattccattc 36 ||||||||||||||||||| Sbjct: 149919 attcctttccattccattc 149901
>gb|M21305.1|HUMASAT3 Human alpha satellite and satellite 3 junction DNA sequence Length = 1741 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Minus Query: 14 atccattcctttccattccattc 36 ||||||||| ||||||||||||| Sbjct: 1273 atccattccattccattccattc 1251 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Minus Query: 14 atccattcctttccattccattc 36 ||||||||| ||||||||||||| Sbjct: 608 atccattccattccattccattc 586
>gb|U31656.1|HSU31656 Human chromosome 5 satellite 3, 3.3 kb and 68 bp repeat junction DNA sequence Length = 1171 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Plus Query: 15 tccattcctttccattcca 33 ||||||||||||||||||| Sbjct: 239 tccattcctttccattcca 257
>emb|Z79469.1|HSPA9C11 H.sapiens flow-sorted chromosome 6 TaqI fragment, SC6pA9C11 Length = 164 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Minus Query: 14 atccattcctttccattccattc 36 ||||||||| ||||||||||||| Sbjct: 57 atccattccattccattccattc 35
>emb|Z79392.1|HSPA6H12 H.sapiens flow-sorted chromosome 6 TaqI fragment, SC6pA6H12 Length = 139 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Minus Query: 15 tccattcctttccattcca 33 ||||||||||||||||||| Sbjct: 21 tccattcctttccattcca 3
>emb|Z11968.1|HSSATKPN1 H.sapiens satellite DNA (pKPN1) Length = 263 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Plus Query: 15 tccattcctttccattccattca 37 |||||||| |||||||||||||| Sbjct: 177 tccattccattccattccattca 199
>emb|X74413.1|HSSAT H.sapiens repetitive sequences on chromosome 10 Length = 538 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Minus Query: 14 atccattcctttccattccattc 36 ||||||||| ||||||||||||| Sbjct: 520 atccattccattccattccattc 498
>emb|X59322.1|HSIGCHIL4 H.sapiens immunoglobulin kappa locus repetitive DNA (cos207/p207-4) Length = 150 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Minus Query: 15 tccattcctttccattccattca 37 |||||||| |||||||||||||| Sbjct: 65 tccattccattccattccattca 43
>gb|M77220.1|HUMRSCMF Human (isolate pHuR94) repetitive sequence at the centromere Length = 194 Score = 38.2 bits (19), Expect = 3.1 Identities = 22/23 (95%) Strand = Plus / Minus Query: 14 atccattcctttccattccattc 36 ||||||||| ||||||||||||| Sbjct: 37 atccattccattccattccattc 15
>gb|J00298.1|HUMPPD9 human satellite iii related dna; clone ppd9 Length = 168 Score = 38.2 bits (19), Expect = 3.1 Identities = 19/19 (100%) Strand = Plus / Plus Query: 15 tccattcctttccattcca 33 ||||||||||||||||||| Sbjct: 131 tccattcctttccattcca 149 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 703,529 Number of Sequences: 3902068 Number of extensions: 703529 Number of successful extensions: 94585 Number of sequences better than 10.0: 142 Number of HSP's better than 10.0 without gapping: 144 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 44924 Number of HSP's gapped (non-prelim): 45521 length of query: 76 length of database: 17,233,045,268 effective HSP length: 21 effective length of query: 55 effective length of database: 17,151,101,840 effective search space: 943310601200 effective search space used: 943310601200 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 19 (38.2 bits)
