Clone Name | rbastl24b08 |
---|---|
Clone Library Name | barley_pub |
>gb|AC091119.2| Canis familiaris clone RP81-142A6, complete sequence Length = 150149 Score = 50.1 bits (25), Expect = 0.003 Identities = 31/33 (93%) Strand = Plus / Plus Query: 178 atccatccatccatccaccaacatctagctacc 210 ||||||||||||||||||| ||||||| ||||| Sbjct: 53827 atccatccatccatccacccacatctacctacc 53859
>gb|AC126174.9| Homo sapiens 12 BAC RP11-504F21 (Roswell Park Cancer Institute Human BAC Library) complete sequence Length = 88686 Score = 48.1 bits (24), Expect = 0.012 Identities = 27/28 (96%) Strand = Plus / Plus Query: 56 cattcatccactcgttcattcattcaac 83 ||||||||||||| |||||||||||||| Sbjct: 38444 cattcatccactcattcattcattcaac 38471
>emb|AL603766.4| Human DNA sequence from clone RP11-365H23 on chromosome 6 Contains a small nuclear ribonucleoprotein polypeptide B'' (SNRPB2) pseudogene, complete sequence Length = 80539 Score = 48.1 bits (24), Expect = 0.012 Identities = 27/28 (96%) Strand = Plus / Plus Query: 50 atgatccattcatccactcgttcattca 77 |||||||||||||||| ||||||||||| Sbjct: 44734 atgatccattcatccattcgttcattca 44761
>gb|AC105014.5| Homo sapiens chromosome 15, clone RP11-466P9, complete sequence Length = 189047 Score = 48.1 bits (24), Expect = 0.012 Identities = 27/28 (96%) Strand = Plus / Minus Query: 55 ccattcatccactcgttcattcattcaa 82 |||| ||||||||||||||||||||||| Sbjct: 74581 ccatccatccactcgttcattcattcaa 74554
>gb|AC134913.6| Mus musculus BAC clone RP23-195M6 from chromosome 13, complete sequence Length = 223130 Score = 48.1 bits (24), Expect = 0.012 Identities = 27/28 (96%) Strand = Plus / Minus Query: 53 atccattcatccactcgttcattcattc 80 |||||||||||||||| ||||||||||| Sbjct: 175309 atccattcatccactcattcattcattc 175282
>gb|AC096628.14| Mus musculus strain C57BL/6J chromosome 13 clone rp23-81n4, complete sequence Length = 194818 Score = 48.1 bits (24), Expect = 0.012 Identities = 27/28 (96%) Strand = Plus / Minus Query: 53 atccattcatccactcgttcattcattc 80 |||||||||||||||| ||||||||||| Sbjct: 1237 atccattcatccactcattcattcattc 1210
>gb|AC133896.7| Mus musculus chromosome 5, clone RP24-529E15, complete sequence Length = 187415 Score = 46.1 bits (23), Expect = 0.046 Identities = 26/27 (96%) Strand = Plus / Plus Query: 55 ccattcatccactcgttcattcattca 81 ||||||| ||||||||||||||||||| Sbjct: 125525 ccattcagccactcgttcattcattca 125551
>emb|AL591397.3| Human DNA sequence from clone RP11-240M16 on chromosome 6 Contains the 3' end of a novel gene and a laminin receptor 1 (67kD ribosomal protein SA) (LAMR1) pseudogene, complete sequence Length = 82646 Score = 46.1 bits (23), Expect = 0.046 Identities = 29/31 (93%) Strand = Plus / Plus Query: 56 cattcatccactcgttcattcattcaactgt 86 ||||||| |||||||||||||| |||||||| Sbjct: 2244 cattcattcactcgttcattcaatcaactgt 2274
>emb|AL161658.21| Human DNA sequence from clone RP11-470C13 on chromosome 20 Contains the 3' end of the gene for KIAA1272 protein (similar to rat tulip proteins 1 and 2), the INSM1 gene for insulinoma-associated protein 1, the 3' end of the C20orf26 gene and a CpG island, complete sequence Length = 67356 Score = 46.1 bits (23), Expect = 0.046 Identities = 26/27 (96%) Strand = Plus / Minus Query: 178 atccatccatccatccaccaacatcta 204 ||||||||||||||||||| ||||||| Sbjct: 4162 atccatccatccatccacccacatcta 4136
>gb|AC161813.2| Mus musculus chromosome 5, clone RP23-264M9, complete sequence Length = 154852 Score = 46.1 bits (23), Expect = 0.046 Identities = 26/27 (96%) Strand = Plus / Minus Query: 55 ccattcatccactcgttcattcattca 81 ||||||| ||||||||||||||||||| Sbjct: 129748 ccattcagccactcgttcattcattca 129722
>gb|AC103874.2| Homo sapiens chromosome 15, clone RP11-907B8, complete sequence Length = 158897 Score = 46.1 bits (23), Expect = 0.046 Identities = 26/27 (96%) Strand = Plus / Minus Query: 178 atccatccatccatccaccaacatcta 204 ||||||||||||||||| ||||||||| Sbjct: 87759 atccatccatccatccatcaacatcta 87733
>emb|AL606925.16| Mouse DNA sequence from clone RP23-12J1 on chromosome 4, complete sequence Length = 239244 Score = 46.1 bits (23), Expect = 0.046 Identities = 23/23 (100%) Strand = Plus / Minus Query: 177 gatccatccatccatccaccaac 199 ||||||||||||||||||||||| Sbjct: 173780 gatccatccatccatccaccaac 173758
>gb|AC165078.2| Mus musculus BAC clone RP24-287O1 from chromosome 12, complete sequence Length = 172492 Score = 44.1 bits (22), Expect = 0.18 Identities = 25/26 (96%) Strand = Plus / Plus Query: 56 cattcatccactcgttcattcattca 81 ||||||| |||||||||||||||||| Sbjct: 86765 cattcattcactcgttcattcattca 86790
>gb|AC115746.10| Mus musculus chromosome 15, clone RP23-3J8, complete sequence Length = 214765 Score = 44.1 bits (22), Expect = 0.18 Identities = 22/22 (100%) Strand = Plus / Plus Query: 178 atccatccatccatccaccaac 199 |||||||||||||||||||||| Sbjct: 27295 atccatccatccatccaccaac 27316
>ref|XM_914623.2| PREDICTED: Mus musculus RIKEN cDNA C230098I05 gene (C230098I05Rik), mRNA Length = 3942 Score = 44.1 bits (22), Expect = 0.18 Identities = 22/22 (100%) Strand = Plus / Plus Query: 178 atccatccatccatccaccaac 199 |||||||||||||||||||||| Sbjct: 2449 atccatccatccatccaccaac 2470
>gb|AC067941.7| Homo sapiens BAC clone RP11-815K3 from 7, complete sequence Length = 215994 Score = 44.1 bits (22), Expect = 0.18 Identities = 22/22 (100%) Strand = Plus / Plus Query: 178 atccatccatccatccaccaac 199 |||||||||||||||||||||| Sbjct: 11618 atccatccatccatccaccaac 11639
>ref|XM_983707.1| PREDICTED: Mus musculus RIKEN cDNA C230098I05 gene (C230098I05Rik), mRNA Length = 3926 Score = 44.1 bits (22), Expect = 0.18 Identities = 22/22 (100%) Strand = Plus / Plus Query: 178 atccatccatccatccaccaac 199 |||||||||||||||||||||| Sbjct: 2433 atccatccatccatccaccaac 2454
>ref|XM_194378.6| PREDICTED: Mus musculus RIKEN cDNA C230098I05 gene (C230098I05Rik), mRNA Length = 3926 Score = 44.1 bits (22), Expect = 0.18 Identities = 22/22 (100%) Strand = Plus / Plus Query: 178 atccatccatccatccaccaac 199 |||||||||||||||||||||| Sbjct: 2433 atccatccatccatccaccaac 2454
>gb|AC146479.2| Pan troglodytes BAC clone CH251-424F5 from Y, complete sequence Length = 163250 Score = 44.1 bits (22), Expect = 0.18 Identities = 22/22 (100%) Strand = Plus / Plus Query: 178 atccatccatccatccaccaac 199 |||||||||||||||||||||| Sbjct: 138981 atccatccatccatccaccaac 139002
>emb|CR936360.14| Human DNA sequence from clone RP13-440N7 on chromosome X, complete sequence Length = 154563 Score = 44.1 bits (22), Expect = 0.18 Identities = 22/22 (100%) Strand = Plus / Minus Query: 178 atccatccatccatccaccaac 199 |||||||||||||||||||||| Sbjct: 116329 atccatccatccatccaccaac 116308
>gb|AC089999.20| Homo sapiens 12 BAC RP11-545P7 (Roswell Park Cancer Institute Human BAC Library) complete sequence Length = 199522 Score = 44.1 bits (22), Expect = 0.18 Identities = 25/26 (96%) Strand = Plus / Plus Query: 56 cattcatccactcgttcattcattca 81 ||||||| |||||||||||||||||| Sbjct: 145694 cattcattcactcgttcattcattca 145719
>gb|AC125050.6| Mus musculus BAC clone RP23-372I18 from chromosome 7, complete sequence Length = 199810 Score = 44.1 bits (22), Expect = 0.18 Identities = 22/22 (100%) Strand = Plus / Plus Query: 178 atccatccatccatccaccaac 199 |||||||||||||||||||||| Sbjct: 36335 atccatccatccatccaccaac 36356
>gb|AC121993.2| Mus musculus BAC clone RP24-301F19 from 3, complete sequence Length = 163385 Score = 44.1 bits (22), Expect = 0.18 Identities = 25/26 (96%) Strand = Plus / Minus Query: 56 cattcatccactcgttcattcattca 81 ||||||| |||||||||||||||||| Sbjct: 121492 cattcattcactcgttcattcattca 121467
>gb|AC146478.2| Pan troglodytes BAC clone CH251-409D17 from Y, complete sequence Length = 149556 Score = 44.1 bits (22), Expect = 0.18 Identities = 22/22 (100%) Strand = Plus / Plus Query: 178 atccatccatccatccaccaac 199 |||||||||||||||||||||| Sbjct: 39483 atccatccatccatccaccaac 39504
>gb|AC101490.8| Mus musculus chromosome 3, clone RP23-188O2, complete sequence Length = 247848 Score = 44.1 bits (22), Expect = 0.18 Identities = 25/26 (96%) Strand = Plus / Plus Query: 178 atccatccatccatccaccaacatct 203 ||||||||||||||||| |||||||| Sbjct: 83214 atccatccatccatccagcaacatct 83239
>emb|AL445199.37| Human DNA sequence from clone RP13-439H18 on chromosome 10 Contains the GPR123 gene for G protein-coupled receptor 123, a novel gene (containing KIAA1768, FLJ00378 and FLJ00252), gene FLJ25027, the UTF1 gene for undifferentiated embryonic cell transcription factor 1, the 5' end of the VENTX2 gene for VENT-like homeobox2, a novel gene, a 60S ribosomal protein L5 (RPL5) pseudogene and twenty five CpG islands, complete sequence Length = 212199 Score = 44.1 bits (22), Expect = 0.18 Identities = 22/22 (100%) Strand = Plus / Minus Query: 178 atccatccatccatccaccaac 199 |||||||||||||||||||||| Sbjct: 35705 atccatccatccatccaccaac 35684 Score = 44.1 bits (22), Expect = 0.18 Identities = 22/22 (100%) Strand = Plus / Minus Query: 178 atccatccatccatccaccaac 199 |||||||||||||||||||||| Sbjct: 35565 atccatccatccatccaccaac 35544 Score = 44.1 bits (22), Expect = 0.18 Identities = 22/22 (100%) Strand = Plus / Minus Query: 178 atccatccatccatccaccaac 199 |||||||||||||||||||||| Sbjct: 35433 atccatccatccatccaccaac 35412
>emb|BX908382.8| Human DNA sequence from clone WI2-87105E3 on chromosome X Contains the 5' end of the CRLF2 gene for cytokine receptor-like factor 2, complete sequence Length = 33657 Score = 44.1 bits (22), Expect = 0.18 Identities = 22/22 (100%) Strand = Plus / Minus Query: 178 atccatccatccatccaccaac 199 |||||||||||||||||||||| Sbjct: 31461 atccatccatccatccaccaac 31440
>emb|AL445532.8| Human DNA sequence from clone RP11-263K15 on chromosome 9 Contains the 3' end of the NTRK2 gene for Neurotrophic tyrosine kinase, receptor, type 2 (TRKB), complete sequence Length = 171629 Score = 44.1 bits (22), Expect = 0.18 Identities = 25/26 (96%) Strand = Plus / Minus Query: 56 cattcatccactcgttcattcattca 81 ||||||||||| |||||||||||||| Sbjct: 94690 cattcatccacccgttcattcattca 94665
>gb|AC079199.9| Homo sapiens chromosome 17, clone RP11-94L15, complete sequence Length = 161815 Score = 44.1 bits (22), Expect = 0.18 Identities = 25/26 (96%) Strand = Plus / Plus Query: 56 cattcatccactcgttcattcattca 81 ||||||||||||| |||||||||||| Sbjct: 48558 cattcatccactcattcattcattca 48583
>gb|AC040933.12| Homo sapiens chromosome 17, clone CTD-2019C10, complete sequence Length = 168585 Score = 44.1 bits (22), Expect = 0.18 Identities = 25/26 (96%) Strand = Plus / Plus Query: 56 cattcatccactcgttcattcattca 81 ||||||||||||| |||||||||||| Sbjct: 85886 cattcatccactcattcattcattca 85911
>emb|AL136528.11| Human DNA sequence from clone RP5-1092A11 on chromosome 1p36.2-36.33 Contains the 5' end of the gene for a novel protein (FLJ32825), a novel gene (KIAA0495), two novel genes, the TP73 gene for tumor protein p73, the 5' end of the WDR8 gene for WD repeat domain 8 and five CpG islands, complete sequence Length = 138941 Score = 44.1 bits (22), Expect = 0.18 Identities = 22/22 (100%) Strand = Plus / Plus Query: 178 atccatccatccatccaccaac 199 |||||||||||||||||||||| Sbjct: 42356 atccatccatccatccaccaac 42377
>emb|AL080251.23|HSDJ93P18 Human DNA sequence from clone RP1-93P18 on chromosome 1p35.2-36.23 Contains the 5' end of the ALDH4A1 gene for aldehyde dehydrogenase 4 family, member A1, a novel gene and a CpG island, complete sequence Length = 103216 Score = 44.1 bits (22), Expect = 0.18 Identities = 34/38 (89%) Strand = Plus / Plus Query: 55 ccattcatccactcgttcattcattcaactgttttcac 92 |||||||| || || ||||||||||||| ||||||||| Sbjct: 73422 ccattcattcattcattcattcattcaaatgttttcac 73459
>emb|AL035588.21|HS696P19 Human DNA sequence from clone RP4-696P19 on chromosome 6p12.3-21.2 Contains the 3' end of the TFEB gene for transcription factor EB (TCFEB), a nucleophosmin (nucleolar phosphoprotein B23, numatrin) (NPM1) pseudogene, the MDFI gene for MyoD family inhibitor, the 5' end of a novel gene and two CpG islands, complete sequence Length = 110665 Score = 44.1 bits (22), Expect = 0.18 Identities = 22/22 (100%) Strand = Plus / Plus Query: 178 atccatccatccatccaccaac 199 |||||||||||||||||||||| Sbjct: 22170 atccatccatccatccaccaac 22191
>gb|AC148836.6| Pan troglodytes BAC clone CH251-2C8 from chromosome 7, complete sequence Length = 219717 Score = 44.1 bits (22), Expect = 0.18 Identities = 22/22 (100%) Strand = Plus / Minus Query: 178 atccatccatccatccaccaac 199 |||||||||||||||||||||| Sbjct: 39674 atccatccatccatccaccaac 39653
>gb|AC171134.2| Helobdella robusta clone CH306-1A5, complete sequence Length = 95814 Score = 44.1 bits (22), Expect = 0.18 Identities = 25/26 (96%) Strand = Plus / Minus Query: 56 cattcatccactcgttcattcattca 81 ||||||||||||| |||||||||||| Sbjct: 92082 cattcatccactcattcattcattca 92057
>emb|BX511261.12| Zebrafish DNA sequence from clone DKEYP-59G7 in linkage group 1, complete sequence Length = 185266 Score = 44.1 bits (22), Expect = 0.18 Identities = 22/22 (100%) Strand = Plus / Minus Query: 177 gatccatccatccatccaccaa 198 |||||||||||||||||||||| Sbjct: 153133 gatccatccatccatccaccaa 153112 Score = 42.1 bits (21), Expect = 0.72 Identities = 21/21 (100%) Strand = Plus / Minus Query: 178 atccatccatccatccaccaa 198 ||||||||||||||||||||| Sbjct: 152956 atccatccatccatccaccaa 152936 Score = 42.1 bits (21), Expect = 0.72 Identities = 21/21 (100%) Strand = Plus / Minus Query: 178 atccatccatccatccaccaa 198 ||||||||||||||||||||| Sbjct: 152776 atccatccatccatccaccaa 152756 Score = 42.1 bits (21), Expect = 0.72 Identities = 21/21 (100%) Strand = Plus / Minus Query: 178 atccatccatccatccaccaa 198 ||||||||||||||||||||| Sbjct: 152608 atccatccatccatccaccaa 152588 Score = 42.1 bits (21), Expect = 0.72 Identities = 21/21 (100%) Strand = Plus / Minus Query: 178 atccatccatccatccaccaa 198 ||||||||||||||||||||| Sbjct: 152444 atccatccatccatccaccaa 152424 Score = 42.1 bits (21), Expect = 0.72 Identities = 21/21 (100%) Strand = Plus / Minus Query: 178 atccatccatccatccaccaa 198 ||||||||||||||||||||| Sbjct: 152028 atccatccatccatccaccaa 152008
>emb|CR626867.6| Human DNA sequence from clone XX-HCC1954_8J23, complete sequence Length = 89963 Score = 44.1 bits (22), Expect = 0.18 Identities = 25/26 (96%) Strand = Plus / Plus Query: 56 cattcatccactcgttcattcattca 81 ||||||||||||| |||||||||||| Sbjct: 46817 cattcatccactcattcattcattca 46842
>emb|CR626880.9| Human DNA sequence from clone XX-HCC1954_11K06, complete sequence Length = 151284 Score = 44.1 bits (22), Expect = 0.18 Identities = 25/26 (96%) Strand = Plus / Plus Query: 56 cattcatccactcgttcattcattca 81 ||||||||||||| |||||||||||| Sbjct: 74945 cattcatccactcattcattcattca 74970
>gb|AC078903.11| Homo sapiens chromosome 17, clone RP11-1084K4, complete sequence Length = 95359 Score = 44.1 bits (22), Expect = 0.18 Identities = 25/26 (96%) Strand = Plus / Plus Query: 56 cattcatccactcgttcattcattca 81 ||||||| |||||||||||||||||| Sbjct: 9602 cattcattcactcgttcattcattca 9627
>emb|BX663524.6| Zebrafish DNA sequence from clone DKEY-97K15, complete sequence Length = 196030 Score = 44.1 bits (22), Expect = 0.18 Identities = 22/22 (100%) Strand = Plus / Minus Query: 178 atccatccatccatccaccaac 199 |||||||||||||||||||||| Sbjct: 12695 atccatccatccatccaccaac 12674
>dbj|BS000632.2| Pan troglodytes chromosome Y clone: PTB-399O20, complete sequence Length = 199770 Score = 44.1 bits (22), Expect = 0.18 Identities = 22/22 (100%) Strand = Plus / Plus Query: 178 atccatccatccatccaccaac 199 |||||||||||||||||||||| Sbjct: 64182 atccatccatccatccaccaac 64203
>gb|AC087491.5| Homo sapiens chromosome 17, clone RP11-62N23, complete sequence Length = 157216 Score = 44.1 bits (22), Expect = 0.18 Identities = 25/26 (96%) Strand = Plus / Plus Query: 56 cattcatccactcgttcattcattca 81 ||||||||||||| |||||||||||| Sbjct: 134711 cattcatccactcattcattcattca 134736
>emb|BX548247.6| Zebrafish DNA sequence from clone DKEY-177G18 in linkage group 23, complete sequence Length = 180406 Score = 44.1 bits (22), Expect = 0.18 Identities = 22/22 (100%) Strand = Plus / Minus Query: 178 atccatccatccatccaccaac 199 |||||||||||||||||||||| Sbjct: 108017 atccatccatccatccaccaac 107996
>gb|DP000054.1| Pan troglodytes chromosome Y, partial sequence Length = 23952694 Score = 44.1 bits (22), Expect = 0.18 Identities = 22/22 (100%) Strand = Plus / Minus Query: 178 atccatccatccatccaccaac 199 |||||||||||||||||||||| Sbjct: 17658236 atccatccatccatccaccaac 17658215
>gb|AC109580.14| Danio rerio strain AB clone busm1-183j13, complete sequence Length = 94348 Score = 44.1 bits (22), Expect = 0.18 Identities = 22/22 (100%) Strand = Plus / Plus Query: 178 atccatccatccatccaccaac 199 |||||||||||||||||||||| Sbjct: 82413 atccatccatccatccaccaac 82434
>emb|BX323839.13| Zebrafish DNA sequence from clone CH211-217K17 in linkage group 1, complete sequence Length = 155358 Score = 44.1 bits (22), Expect = 0.18 Identities = 22/22 (100%) Strand = Plus / Plus Query: 178 atccatccatccatccaccaac 199 |||||||||||||||||||||| Sbjct: 118465 atccatccatccatccaccaac 118486
>emb|BX247866.12| Zebrafish DNA sequence from clone DKEY-216J12 in linkage group 1, complete sequence Length = 197473 Score = 44.1 bits (22), Expect = 0.18 Identities = 22/22 (100%) Strand = Plus / Minus Query: 177 gatccatccatccatccaccaa 198 |||||||||||||||||||||| Sbjct: 156910 gatccatccatccatccaccaa 156889
>emb|BX649370.5| Zebrafish DNA sequence from clone DKEY-97I11 in linkage group 24, complete sequence Length = 167578 Score = 44.1 bits (22), Expect = 0.18 Identities = 25/26 (96%) Strand = Plus / Minus Query: 56 cattcatccactcgttcattcattca 81 ||||||| |||||||||||||||||| Sbjct: 153794 cattcattcactcgttcattcattca 153769
>emb|BX248082.11| Zebrafish DNA sequence from clone CH211-237B12 in linkage group 16, complete sequence Length = 152455 Score = 44.1 bits (22), Expect = 0.18 Identities = 25/26 (96%) Strand = Plus / Minus Query: 56 cattcatccactcgttcattcattca 81 ||||||| |||||||||||||||||| Sbjct: 145590 cattcattcactcgttcattcattca 145565
>dbj|AK090234.1| Mus musculus 16 days neonate male diencephalon cDNA, RIKEN full-length enriched library, clone:G630023A01 product:unclassifiable, full insert sequence Length = 1920 Score = 44.1 bits (22), Expect = 0.18 Identities = 22/22 (100%) Strand = Plus / Plus Query: 178 atccatccatccatccaccaac 199 |||||||||||||||||||||| Sbjct: 429 atccatccatccatccaccaac 450
>emb|AL929518.16| Zebrafish DNA sequence from clone CH211-163F10 in linkage group 2, complete sequence Length = 162473 Score = 44.1 bits (22), Expect = 0.18 Identities = 22/22 (100%) Strand = Plus / Plus Query: 178 atccatccatccatccaccaac 199 |||||||||||||||||||||| Sbjct: 144328 atccatccatccatccaccaac 144349 Score = 44.1 bits (22), Expect = 0.18 Identities = 22/22 (100%) Strand = Plus / Plus Query: 178 atccatccatccatccaccaac 199 |||||||||||||||||||||| Sbjct: 144300 atccatccatccatccaccaac 144321
>emb|AL929396.18| Zebrafish DNA sequence from clone CH211-93G23 in linkage group 1, complete sequence Length = 169067 Score = 44.1 bits (22), Expect = 0.18 Identities = 22/22 (100%) Strand = Plus / Minus Query: 178 atccatccatccatccaccaac 199 |||||||||||||||||||||| Sbjct: 45185 atccatccatccatccaccaac 45164
>gb|AC138028.1| Homo sapiens chromosome 16 clone RP5-1142A6, complete sequence Length = 127698 Score = 44.1 bits (22), Expect = 0.18 Identities = 28/30 (93%) Strand = Plus / Minus Query: 53 atccattcatccactcgttcattcattcaa 82 ||||||||||||| || ||||||||||||| Sbjct: 25793 atccattcatccattcattcattcattcaa 25764
>gb|AC061992.11| Homo sapiens chromosome 17, clone RP11-806H10, complete sequence Length = 100190 Score = 44.1 bits (22), Expect = 0.18 Identities = 25/26 (96%) Strand = Plus / Minus Query: 56 cattcatccactcgttcattcattca 81 ||||||| |||||||||||||||||| Sbjct: 14813 cattcattcactcgttcattcattca 14788
>gb|AY208911.1| Homo sapiens v-erb-b2 erythroblastic leukemia viral oncogene homolog 2, neuro/glioblastoma derived oncogene homolog (avian) (ERBB2) gene, complete cds Length = 30837 Score = 44.1 bits (22), Expect = 0.18 Identities = 25/26 (96%) Strand = Plus / Plus Query: 56 cattcatccactcgttcattcattca 81 ||||||||||||| |||||||||||| Sbjct: 5222 cattcatccactcattcattcattca 5247
>gb|AC122129.9| Homo sapiens chromosome 17, clone RP1-253P7, complete sequence Length = 159868 Score = 44.1 bits (22), Expect = 0.18 Identities = 25/26 (96%) Strand = Plus / Minus Query: 56 cattcatccactcgttcattcattca 81 ||||||| |||||||||||||||||| Sbjct: 195 cattcattcactcgttcattcattca 170
>dbj|AB096613.1| Homo sapiens DNA, 20kb-MKN7 rearranged sequence Length = 20271 Score = 44.1 bits (22), Expect = 0.18 Identities = 25/26 (96%) Strand = Plus / Plus Query: 56 cattcatccactcgttcattcattca 81 ||||||||||||| |||||||||||| Sbjct: 18512 cattcatccactcattcattcattca 18537
>dbj|AP000977.4| Homo sapiens genomic DNA, chromosome 11q, clone:RP11-730K11, complete sequence Length = 187080 Score = 44.1 bits (22), Expect = 0.18 Identities = 25/26 (96%) Strand = Plus / Minus Query: 56 cattcatccactcgttcattcattca 81 |||||||||| ||||||||||||||| Sbjct: 94044 cattcatccattcgttcattcattca 94019
>emb|AL354000.7|HS253P07 Homo from PAC RP1-253P07 and PAC RP1-281I13 (complete covert by PAC RP1-253P07), complete sequence Length = 159876 Score = 44.1 bits (22), Expect = 0.18 Identities = 25/26 (96%) Strand = Plus / Plus Query: 56 cattcatccactcgttcattcattca 81 ||||||| |||||||||||||||||| Sbjct: 159681 cattcattcactcgttcattcattca 159706
>gb|AC003663.1|AC003663 Homo sapiens chromosome 17, clone HCIT87G17, complete sequence Length = 132070 Score = 44.1 bits (22), Expect = 0.18 Identities = 22/22 (100%) Strand = Plus / Minus Query: 178 atccatccatccatccaccaac 199 |||||||||||||||||||||| Sbjct: 28064 atccatccatccatccaccaac 28043
>gb|AC136147.4| Mus musculus BAC clone RP23-18B3 from 8, complete sequence Length = 210916 Score = 44.1 bits (22), Expect = 0.18 Identities = 25/26 (96%) Strand = Plus / Plus Query: 56 cattcatccactcgttcattcattca 81 ||||||| |||||||||||||||||| Sbjct: 42892 cattcattcactcgttcattcattca 42917
>gb|AC150648.2| Mus musculus BAC clone RP23-235N5 from 7, complete sequence Length = 190414 Score = 44.1 bits (22), Expect = 0.18 Identities = 22/22 (100%) Strand = Plus / Plus Query: 178 atccatccatccatccaccaac 199 |||||||||||||||||||||| Sbjct: 122158 atccatccatccatccaccaac 122179
>gb|AC127288.4| Mus musculus BAC clone RP23-358J11 from 8, complete sequence Length = 210710 Score = 44.1 bits (22), Expect = 0.18 Identities = 22/22 (100%) Strand = Plus / Minus Query: 178 atccatccatccatccaccaac 199 |||||||||||||||||||||| Sbjct: 55047 atccatccatccatccaccaac 55026
>emb|AL954313.6| Zebrafish DNA sequence from clone CH211-257J20 in linkage group 11, complete sequence Length = 156381 Score = 44.1 bits (22), Expect = 0.18 Identities = 22/22 (100%) Strand = Plus / Minus Query: 178 atccatccatccatccaccaac 199 |||||||||||||||||||||| Sbjct: 84666 atccatccatccatccaccaac 84645 Score = 44.1 bits (22), Expect = 0.18 Identities = 22/22 (100%) Strand = Plus / Minus Query: 178 atccatccatccatccaccaac 199 |||||||||||||||||||||| Sbjct: 84626 atccatccatccatccaccaac 84605 Score = 44.1 bits (22), Expect = 0.18 Identities = 22/22 (100%) Strand = Plus / Minus Query: 178 atccatccatccatccaccaac 199 |||||||||||||||||||||| Sbjct: 84245 atccatccatccatccaccaac 84224
>gb|AC161433.5| Mus musculus chromosome 8, clone RP23-50F12, complete sequence Length = 253440 Score = 44.1 bits (22), Expect = 0.18 Identities = 22/22 (100%) Strand = Plus / Plus Query: 178 atccatccatccatccaccaac 199 |||||||||||||||||||||| Sbjct: 190637 atccatccatccatccaccaac 190658
>emb|AL672259.9| Mouse DNA sequence from clone RP23-169M4 on chromosome 2, complete sequence Length = 179832 Score = 44.1 bits (22), Expect = 0.18 Identities = 22/22 (100%) Strand = Plus / Plus Query: 178 atccatccatccatccaccaac 199 |||||||||||||||||||||| Sbjct: 96402 atccatccatccatccaccaac 96423
>emb|AL831790.3| Mouse DNA sequence from clone RP23-334I5 on chromosome 4, complete sequence Length = 206074 Score = 44.1 bits (22), Expect = 0.18 Identities = 25/26 (96%) Strand = Plus / Minus Query: 56 cattcatccactcgttcattcattca 81 |||||||||||| ||||||||||||| Sbjct: 133466 cattcatccactagttcattcattca 133441 Score = 44.1 bits (22), Expect = 0.18 Identities = 25/26 (96%) Strand = Plus / Minus Query: 56 cattcatccactcgttcattcattca 81 ||||||||||||| |||||||||||| Sbjct: 133260 cattcatccactcattcattcattca 133235 Score = 44.1 bits (22), Expect = 0.18 Identities = 25/26 (96%) Strand = Plus / Minus Query: 56 cattcatccactcgttcattcattca 81 ||||||||||||| |||||||||||| Sbjct: 133236 cattcatccactcattcattcattca 133211
>dbj|AP003159.1| Homo sapiens genomic DNA, chromosome 1p36 clone:1024F16, complete sequence Length = 113733 Score = 44.1 bits (22), Expect = 0.18 Identities = 34/38 (89%) Strand = Plus / Plus Query: 55 ccattcatccactcgttcattcattcaactgttttcac 92 |||||||| || || ||||||||||||| ||||||||| Sbjct: 74544 ccattcattcattcattcattcattcaaatgttttcac 74581
>gb|AC153851.27| Mus musculus 6 BAC RP23-61N4 (Roswell Park Cancer Institute (C57BL/6J Female) Mouse BAC Library) complete sequence Length = 217854 Score = 42.1 bits (21), Expect = 0.72 Identities = 21/21 (100%) Strand = Plus / Minus Query: 146 ctacatataacatacagagtc 166 ||||||||||||||||||||| Sbjct: 52645 ctacatataacatacagagtc 52625 Score = 42.1 bits (21), Expect = 0.72 Identities = 21/21 (100%) Strand = Plus / Plus Query: 146 ctacatataacatacagagtc 166 ||||||||||||||||||||| Sbjct: 30498 ctacatataacatacagagtc 30518
>gb|AY559433.1| Thielaviopsis basicola clone NG3/NG4 ISSR sequence Length = 439 Score = 42.1 bits (21), Expect = 0.72 Identities = 21/21 (100%) Strand = Plus / Plus Query: 178 atccatccatccatccaccaa 198 ||||||||||||||||||||| Sbjct: 130 atccatccatccatccaccaa 150
>gb|AY169492.1| Oryza latifolia isolate 100914 clone 2 alcohol dehydrogenase II (adh2) gene, exons 3 through 7 and partial cds Length = 1648 Score = 42.1 bits (21), Expect = 0.72 Identities = 21/21 (100%) Strand = Plus / Minus Query: 177 gatccatccatccatccacca 197 ||||||||||||||||||||| Sbjct: 54 gatccatccatccatccacca 34
>gb|AE000663.1|MMAE000663 Mus musculus TCR beta locus from bases 1 to 250611 (section 1 of 3) of the complete sequence Length = 250611 Score = 42.1 bits (21), Expect = 0.72 Identities = 21/21 (100%) Strand = Plus / Minus Query: 146 ctacatataacatacagagtc 166 ||||||||||||||||||||| Sbjct: 115437 ctacatataacatacagagtc 115417 Score = 42.1 bits (21), Expect = 0.72 Identities = 21/21 (100%) Strand = Plus / Plus Query: 146 ctacatataacatacagagtc 166 ||||||||||||||||||||| Sbjct: 93292 ctacatataacatacagagtc 93312
>gb|U93895.1|MNU93895 Megaptera novaeangliae clone GAAT400 microsatellite sequence Length = 251 Score = 42.1 bits (21), Expect = 0.72 Identities = 27/29 (93%) Strand = Plus / Plus Query: 53 atccattcatccactcgttcattcattca 81 ||||||||||||| || |||||||||||| Sbjct: 109 atccattcatccattcattcattcattca 137
>gb|AC134553.5| Mus musculus BAC clone RP24-280H19 from chromosome 12, complete sequence Length = 168895 Score = 42.1 bits (21), Expect = 0.72 Identities = 27/29 (93%) Strand = Plus / Plus Query: 53 atccattcatccactcgttcattcattca 81 ||||||||||| |||| |||||||||||| Sbjct: 13715 atccattcatctactcattcattcattca 13743
>gb|AC114342.12| Mus musculus chromosome 5, clone RP24-143H14, complete sequence Length = 171509 Score = 42.1 bits (21), Expect = 0.72 Identities = 24/25 (96%) Strand = Plus / Plus Query: 57 attcatccactcgttcattcattca 81 |||||||||||| |||||||||||| Sbjct: 61974 attcatccactcattcattcattca 61998
>gb|AC161514.4| Mus musculus chromosome 7, clone RP23-378L12, complete sequence Length = 190426 Score = 42.1 bits (21), Expect = 0.72 Identities = 21/21 (100%) Strand = Plus / Minus Query: 178 atccatccatccatccaccaa 198 ||||||||||||||||||||| Sbjct: 5838 atccatccatccatccaccaa 5818
>gb|AC010976.6| Homo sapiens BAC clone RP11-286H15 from 2, complete sequence Length = 204142 Score = 42.1 bits (21), Expect = 0.72 Identities = 21/21 (100%) Strand = Plus / Plus Query: 178 atccatccatccatccaccaa 198 ||||||||||||||||||||| Sbjct: 97618 atccatccatccatccaccaa 97638
>gb|AC133648.3| Mus musculus BAC clone RP23-291B1 from chromosome 7, complete sequence Length = 207234 Score = 42.1 bits (21), Expect = 0.72 Identities = 27/29 (93%) Strand = Plus / Plus Query: 53 atccattcatccactcgttcattcattca 81 ||||||||||||| || |||||||||||| Sbjct: 154798 atccattcatccattcattcattcattca 154826
>gb|AY498860.1| Homo sapiens tumor necrosis factor receptor superfamily, member 8 (TNFRSF8) gene, complete cds Length = 84102 Score = 42.1 bits (21), Expect = 0.72 Identities = 21/21 (100%) Strand = Plus / Plus Query: 178 atccatccatccatccaccaa 198 ||||||||||||||||||||| Sbjct: 748 atccatccatccatccaccaa 768
>emb|BX927112.16| Zebrafish DNA sequence from clone DKEY-109M11 in linkage group 1, complete sequence Length = 131888 Score = 42.1 bits (21), Expect = 0.72 Identities = 21/21 (100%) Strand = Plus / Plus Query: 178 atccatccatccatccaccaa 198 ||||||||||||||||||||| Sbjct: 102816 atccatccatccatccaccaa 102836
>emb|BX936415.10| Zebrafish DNA sequence from clone CH211-242N18 in linkage group 6, complete sequence Length = 176089 Score = 42.1 bits (21), Expect = 0.72 Identities = 21/21 (100%) Strand = Plus / Minus Query: 179 tccatccatccatccaccaac 199 ||||||||||||||||||||| Sbjct: 106702 tccatccatccatccaccaac 106682
>emb|CR354562.12| Zebrafish DNA sequence from clone DKEY-25B23 in linkage group 23, complete sequence Length = 201764 Score = 42.1 bits (21), Expect = 0.72 Identities = 21/21 (100%) Strand = Plus / Plus Query: 178 atccatccatccatccaccaa 198 ||||||||||||||||||||| Sbjct: 70164 atccatccatccatccaccaa 70184 Score = 40.1 bits (20), Expect = 2.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 178 atccatccatccatccacca 197 |||||||||||||||||||| Sbjct: 92495 atccatccatccatccacca 92476
>gb|AC122058.4| Mus musculus BAC clone RP24-468G7 from chromosome 14, complete sequence Length = 143331 Score = 42.1 bits (21), Expect = 0.72 Identities = 21/21 (100%) Strand = Plus / Plus Query: 178 atccatccatccatccaccaa 198 ||||||||||||||||||||| Sbjct: 110960 atccatccatccatccaccaa 110980
>gb|AC025778.8| Homo sapiens chromosome 16 clone CTD-2504F3, complete sequence Length = 208417 Score = 42.1 bits (21), Expect = 0.72 Identities = 21/21 (100%) Strand = Plus / Plus Query: 178 atccatccatccatccaccaa 198 ||||||||||||||||||||| Sbjct: 186867 atccatccatccatccaccaa 186887
>gb|AC112998.15| Mus musculus chromosome 3, clone RP23-147E7, complete sequence Length = 203273 Score = 42.1 bits (21), Expect = 0.72 Identities = 24/25 (96%) Strand = Plus / Minus Query: 57 attcatccactcgttcattcattca 81 |||||||||||| |||||||||||| Sbjct: 38868 attcatccactcattcattcattca 38844
>gb|AC127567.4| Mus musculus BAC clone RP24-191P12 from chromosome 6, complete sequence Length = 185620 Score = 42.1 bits (21), Expect = 0.72 Identities = 21/21 (100%) Strand = Plus / Plus Query: 178 atccatccatccatccaccaa 198 ||||||||||||||||||||| Sbjct: 27891 atccatccatccatccaccaa 27911
>gb|AC121930.3| Mus musculus BAC clone RP24-205C1 from chromosome 15, complete sequence Length = 148390 Score = 42.1 bits (21), Expect = 0.72 Identities = 21/21 (100%) Strand = Plus / Plus Query: 178 atccatccatccatccaccaa 198 ||||||||||||||||||||| Sbjct: 119013 atccatccatccatccaccaa 119033
>gb|AC125229.3| Mus musculus BAC clone RP23-45P1 from 5, complete sequence Length = 167771 Score = 42.1 bits (21), Expect = 0.72 Identities = 21/21 (100%) Strand = Plus / Minus Query: 178 atccatccatccatccaccaa 198 ||||||||||||||||||||| Sbjct: 122547 atccatccatccatccaccaa 122527
>emb|CR376783.22| Zebrafish DNA sequence from clone DKEY-41N20 in linkage group 13, complete sequence Length = 205064 Score = 42.1 bits (21), Expect = 0.72 Identities = 21/21 (100%) Strand = Plus / Minus Query: 178 atccatccatccatccaccaa 198 ||||||||||||||||||||| Sbjct: 11602 atccatccatccatccaccaa 11582 Score = 42.1 bits (21), Expect = 0.72 Identities = 21/21 (100%) Strand = Plus / Minus Query: 178 atccatccatccatccaccaa 198 ||||||||||||||||||||| Sbjct: 11103 atccatccatccatccaccaa 11083
>emb|CR723510.1|CNS0GL7G Tetraodon nigroviridis full-length cDNA Length = 1150 Score = 42.1 bits (21), Expect = 0.72 Identities = 27/29 (93%) Strand = Plus / Minus Query: 53 atccattcatccactcgttcattcattca 81 |||| |||||||| ||||||||||||||| Sbjct: 953 atccgttcatccattcgttcattcattca 925
>ref|XM_855601.1| PREDICTED: Canis familiaris similar to aquaporin 8, transcript variant 2 (LOC608036), mRNA Length = 1254 Score = 42.1 bits (21), Expect = 0.72 Identities = 24/25 (96%) Strand = Plus / Plus Query: 56 cattcatccactcgttcattcattc 80 ||||||| ||||||||||||||||| Sbjct: 251 cattcattcactcgttcattcattc 275
>gb|AC108430.11| Mus musculus chromosome 14, clone RP23-166L19, complete sequence Length = 204251 Score = 42.1 bits (21), Expect = 0.72 Identities = 21/21 (100%) Strand = Plus / Plus Query: 178 atccatccatccatccaccaa 198 ||||||||||||||||||||| Sbjct: 191474 atccatccatccatccaccaa 191494
>gb|AC004906.3| Homo sapiens PAC clone RP5-852O24 from 7, complete sequence Length = 97749 Score = 42.1 bits (21), Expect = 0.72 Identities = 21/21 (100%) Strand = Plus / Minus Query: 178 atccatccatccatccaccaa 198 ||||||||||||||||||||| Sbjct: 46123 atccatccatccatccaccaa 46103
>emb|CR925794.8| Zebrafish DNA sequence from clone CH211-202A23 in linkage group 13, complete sequence Length = 132763 Score = 42.1 bits (21), Expect = 0.72 Identities = 21/21 (100%) Strand = Plus / Plus Query: 178 atccatccatccatccaccaa 198 ||||||||||||||||||||| Sbjct: 26534 atccatccatccatccaccaa 26554
>emb|CR762417.10| Zebrafish DNA sequence from clone DKEY-229E7 in linkage group 5, complete sequence Length = 78646 Score = 42.1 bits (21), Expect = 0.72 Identities = 21/21 (100%) Strand = Plus / Plus Query: 178 atccatccatccatccaccaa 198 ||||||||||||||||||||| Sbjct: 76044 atccatccatccatccaccaa 76064
>emb|Z85994.1|HS32I10 Human DNA sequence from clone RP1-32I10 on chromosome 22, complete sequence Length = 93312 Score = 42.1 bits (21), Expect = 0.72 Identities = 21/21 (100%) Strand = Plus / Minus Query: 178 atccatccatccatccaccaa 198 ||||||||||||||||||||| Sbjct: 689 atccatccatccatccaccaa 669
>emb|AL929500.4| Human DNA sequence from clone CITF22-57B10 on chromosome 22, complete sequence Length = 8930 Score = 42.1 bits (21), Expect = 0.72 Identities = 21/21 (100%) Strand = Plus / Minus Query: 178 atccatccatccatccaccaa 198 ||||||||||||||||||||| Sbjct: 7619 atccatccatccatccaccaa 7599
>emb|AL591386.19| Human DNA sequence from clone RP11-349K21 on chromosome 9, complete sequence Length = 69657 Score = 42.1 bits (21), Expect = 0.72 Identities = 24/25 (96%) Strand = Plus / Plus Query: 178 atccatccatccatccaccaacatc 202 |||||||||||||||||||| |||| Sbjct: 44798 atccatccatccatccaccaccatc 44822 Score = 42.1 bits (21), Expect = 0.72 Identities = 24/25 (96%) Strand = Plus / Plus Query: 178 atccatccatccatccaccaacatc 202 |||||||||||||||||||| |||| Sbjct: 44776 atccatccatccatccaccaccatc 44800 Score = 42.1 bits (21), Expect = 0.72 Identities = 24/25 (96%) Strand = Plus / Plus Query: 178 atccatccatccatccaccaacatc 202 |||||||||||||||||||| |||| Sbjct: 44522 atccatccatccatccaccaccatc 44546 Score = 42.1 bits (21), Expect = 0.72 Identities = 24/25 (96%) Strand = Plus / Plus Query: 178 atccatccatccatccaccaacatc 202 |||||||||||||||||||| |||| Sbjct: 44500 atccatccatccatccaccaccatc 44524 Score = 42.1 bits (21), Expect = 0.72 Identities = 24/25 (96%) Strand = Plus / Plus Query: 178 atccatccatccatccaccaacatc 202 |||||||||||||||||||| |||| Sbjct: 44330 atccatccatccatccaccaccatc 44354 Score = 42.1 bits (21), Expect = 0.72 Identities = 24/25 (96%) Strand = Plus / Plus Query: 178 atccatccatccatccaccaacatc 202 |||||||||||||||||||| |||| Sbjct: 44308 atccatccatccatccaccaccatc 44332 Score = 42.1 bits (21), Expect = 0.72 Identities = 24/25 (96%) Strand = Plus / Plus Query: 178 atccatccatccatccaccaacatc 202 |||||||||||||||||||| |||| Sbjct: 44263 atccatccatccatccaccaccatc 44287 Score = 40.1 bits (20), Expect = 2.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 178 atccatccatccatccacca 197 |||||||||||||||||||| Sbjct: 44582 atccatccatccatccacca 44601 Score = 40.1 bits (20), Expect = 2.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 178 atccatccatccatccacca 197 |||||||||||||||||||| Sbjct: 44188 atccatccatccatccacca 44207 Score = 40.1 bits (20), Expect = 2.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 178 atccatccatccatccacca 197 |||||||||||||||||||| Sbjct: 44154 atccatccatccatccacca 44173 Score = 40.1 bits (20), Expect = 2.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 178 atccatccatccatccacca 197 |||||||||||||||||||| Sbjct: 44132 atccatccatccatccacca 44151 Score = 40.1 bits (20), Expect = 2.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 178 atccatccatccatccacca 197 |||||||||||||||||||| Sbjct: 44110 atccatccatccatccacca 44129 Score = 40.1 bits (20), Expect = 2.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 178 atccatccatccatccacca 197 |||||||||||||||||||| Sbjct: 43983 atccatccatccatccacca 44002 Score = 40.1 bits (20), Expect = 2.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 178 atccatccatccatccacca 197 |||||||||||||||||||| Sbjct: 43621 atccatccatccatccacca 43640
>emb|AL512424.14| Human DNA sequence from clone RP11-453E2 on chromosome 10 Contains the 5' end of the SLIT1 gene for slit homolog 1 (Drosophila), a novel gene and a CpG island, complete sequence Length = 172510 Score = 42.1 bits (21), Expect = 0.72 Identities = 24/25 (96%) Strand = Plus / Minus Query: 57 attcatccactcgttcattcattca 81 ||||||||||| ||||||||||||| Sbjct: 10432 attcatccacttgttcattcattca 10408
>emb|AL499625.4| Human DNA sequence from clone LA20-66F10 on chromosome 20 Contains part of the BPI gene for bactericidal/permeability-increasing protein and part of a novel gene, complete sequence Length = 12916 Score = 42.1 bits (21), Expect = 0.72 Identities = 21/21 (100%) Strand = Plus / Minus Query: 178 atccatccatccatccaccaa 198 ||||||||||||||||||||| Sbjct: 3095 atccatccatccatccaccaa 3075
>emb|AL357835.11| Human DNA sequence from clone RP11-426M1 on chromosome 1 Contains the TNFRSF8 gene for tumor necrosis factor receptor superfamily member 8, a ribosomal protein L23a (RPL23A) pseudogene, the 5' end of the TNFRSF1B gene for tumor necrosis factor receptor superfamily member 1B and three CpG islands, complete sequence Length = 151498 Score = 42.1 bits (21), Expect = 0.72 Identities = 21/21 (100%) Strand = Plus / Plus Query: 178 atccatccatccatccaccaa 198 ||||||||||||||||||||| Sbjct: 16370 atccatccatccatccaccaa 16390
>emb|AL121829.30|HSJ697K14 Human DNA sequence from clone RP4-697K14 on chromosome 20 Contains the C20orf148 gene for a novel tyrosine kinase, the PTK6 gene for protein tyrosine kinase 6, a novel gene, the EEF1A2 gene for eukaryotic translation elongation factor 1 alpha 2, the 5' end of the KCNQ2 gene for potassium voltage-gated channel (KQT-like subfamily member 2), the gene for peroxisomal proliferator-activated receptor A interacting complex 285 (PRIC285)(FLJ00244, KIAA1769), the C20orf149 gene, the gene for novel protein MGC5356 (MGC5356), the gene for a novel protein (LOC200213), a novel gene and thirteen CpG islands, complete sequence Length = 113196 Score = 42.1 bits (21), Expect = 0.72 Identities = 21/21 (100%) Strand = Plus / Minus Query: 178 atccatccatccatccaccaa 198 ||||||||||||||||||||| Sbjct: 20788 atccatccatccatccaccaa 20768
>emb|AL121756.14|HSDJ726C3 Human DNA sequence from clone RP4-726C3 on chromosome 20 Contains the C20orf185 gene for the possible ortholog of potential ligand_binding protein RYA3 (Rat), the C20orf186 gene for the possible ortholog of potential ligand_binding protein RY2G5 (Rat), the 5' end of the SPAG4L gene for sperm associated antigen 4-like, a novel gene, a FAM16AX (family with sequence similarity 16, member A, X-linked) pseudogene, the BPIL3 gene for bactericidal/permeability-increasing protein-like 3 and a CpG island, complete sequence Length = 129502 Score = 42.1 bits (21), Expect = 0.72 Identities = 21/21 (100%) Strand = Plus / Plus Query: 178 atccatccatccatccaccaa 198 ||||||||||||||||||||| Sbjct: 105528 atccatccatccatccaccaa 105548
>emb|AL031984.13|HS173D1 Human DNA sequence from clone RP1-173D1 on chromosome 1p36.21-36.33 Contains the 5' UTR of the gene for a novel protein (FLJ34970, FLJ20321) and a CpG island, complete sequence Length = 117338 Score = 42.1 bits (21), Expect = 0.72 Identities = 27/29 (93%) Strand = Plus / Plus Query: 53 atccattcatccactcgttcattcattca 81 ||||| |||| |||||||||||||||||| Sbjct: 90240 atccactcattcactcgttcattcattca 90268
>gb|AC163089.3| Mus musculus chromosome 5, clone RP23-346P15, complete sequence Length = 197826 Score = 42.1 bits (21), Expect = 0.72 Identities = 24/25 (96%) Strand = Plus / Plus Query: 57 attcatccactcgttcattcattca 81 |||||||||||| |||||||||||| Sbjct: 143609 attcatccactcattcattcattca 143633
>emb|AL008721.1|HS390C10 Human DNA sequence from clone CTA-390C10 on chromosome 22q11.21-12.1, complete sequence Length = 114231 Score = 42.1 bits (21), Expect = 0.72 Identities = 21/21 (100%) Strand = Plus / Plus Query: 178 atccatccatccatccaccaa 198 ||||||||||||||||||||| Sbjct: 71799 atccatccatccatccaccaa 71819
>emb|X15400.1|DMGLASS Drosophila glass gene encoding a zinc finger protein Length = 9954 Score = 42.1 bits (21), Expect = 0.72 Identities = 21/21 (100%) Strand = Plus / Minus Query: 177 gatccatccatccatccacca 197 ||||||||||||||||||||| Sbjct: 3853 gatccatccatccatccacca 3833
>emb|AL591174.13| Mouse DNA sequence from clone RP23-271B20 on chromosome 11, complete sequence Length = 205379 Score = 42.1 bits (21), Expect = 0.72 Identities = 21/21 (100%) Strand = Plus / Plus Query: 178 atccatccatccatccaccaa 198 ||||||||||||||||||||| Sbjct: 99954 atccatccatccatccaccaa 99974
>emb|CR759869.14| Zebrafish DNA sequence from clone DKEY-238F11 in linkage group 13, complete sequence Length = 284763 Score = 42.1 bits (21), Expect = 0.72 Identities = 21/21 (100%) Strand = Plus / Minus Query: 178 atccatccatccatccaccaa 198 ||||||||||||||||||||| Sbjct: 239386 atccatccatccatccaccaa 239366
>emb|CR405705.11| Zebrafish DNA sequence from clone DKEY-64E13 in linkage group 17, complete sequence Length = 155058 Score = 42.1 bits (21), Expect = 0.72 Identities = 27/29 (93%) Strand = Plus / Minus Query: 53 atccattcatccactcgttcattcattca 81 ||||||||||| | ||||||||||||||| Sbjct: 65671 atccattcatctattcgttcattcattca 65643
>emb|CR925715.4| Zebrafish DNA sequence from clone CH211-212C11 in linkage group 14, complete sequence Length = 132743 Score = 42.1 bits (21), Expect = 0.72 Identities = 21/21 (100%) Strand = Plus / Plus Query: 178 atccatccatccatccaccaa 198 ||||||||||||||||||||| Sbjct: 26534 atccatccatccatccaccaa 26554
>emb|AL645842.15| Mouse DNA sequence from clone RP23-20A9 on chromosome 11 Contains two novel genes and the 3' end of the Accn1 gene for neuronal amiloride-sensitive cation channel 1 (degenerin), complete sequence Length = 114190 Score = 42.1 bits (21), Expect = 0.72 Identities = 21/21 (100%) Strand = Plus / Minus Query: 176 ggatccatccatccatccacc 196 ||||||||||||||||||||| Sbjct: 95821 ggatccatccatccatccacc 95801
>emb|CR847843.7| Zebrafish DNA sequence from clone RP71-50C18 in linkage group 14, complete sequence Length = 162935 Score = 42.1 bits (21), Expect = 0.72 Identities = 27/29 (93%) Strand = Plus / Plus Query: 53 atccattcatccactcgttcattcattca 81 ||||||||||||| || |||||||||||| Sbjct: 120910 atccattcatccattcattcattcattca 120938
>emb|AL954256.1| Pan troglodytes chromosome 22 clone PTB-129I16 map 22q22.3, complete sequence Length = 180777 Score = 42.1 bits (21), Expect = 0.72 Identities = 21/21 (100%) Strand = Plus / Plus Query: 178 atccatccatccatccaccaa 198 ||||||||||||||||||||| Sbjct: 106887 atccatccatccatccaccaa 106907
>gb|AC090739.13| Homo sapiens chromosome 8, clone RP11-503E24, complete sequence Length = 189048 Score = 42.1 bits (21), Expect = 0.72 Identities = 24/25 (96%) Strand = Plus / Plus Query: 57 attcatccactcgttcattcattca 81 |||||||||||| |||||||||||| Sbjct: 46512 attcatccactcattcattcattca 46536
>gb|AC022239.16| Homo sapiens chromosome 8, clone RP11-148O21, complete sequence Length = 191630 Score = 42.1 bits (21), Expect = 0.72 Identities = 21/21 (100%) Strand = Plus / Minus Query: 176 ggatccatccatccatccacc 196 ||||||||||||||||||||| Sbjct: 94369 ggatccatccatccatccacc 94349
>emb|BX511168.4| Zebrafish DNA sequence from clone DKEY-22F5 in linkage group 21, complete sequence Length = 263757 Score = 42.1 bits (21), Expect = 0.72 Identities = 21/21 (100%) Strand = Plus / Minus Query: 178 atccatccatccatccaccaa 198 ||||||||||||||||||||| Sbjct: 55458 atccatccatccatccaccaa 55438
>emb|AL928995.19| Zebrafish DNA sequence from clone CH211-215M21 in linkage group 20 Contains the gene for a novel protein similar to human tubulin tyrosine ligase-like family, member 2 (TTLL2), seven genes for novel proteins similar to vertebrate pim oncogene family, two genes for transposase, seven novel genes, the 5' end of a novel gene and a CpG island, complete sequence Length = 202735 Score = 42.1 bits (21), Expect = 0.72 Identities = 21/21 (100%) Strand = Plus / Minus Query: 177 gatccatccatccatccacca 197 ||||||||||||||||||||| Sbjct: 180441 gatccatccatccatccacca 180421
>emb|AL672072.18| Zebrafish DNA sequence from clone BUSM1-55H21 Contains a CpG island, complete sequence Length = 100697 Score = 42.1 bits (21), Expect = 0.72 Identities = 27/29 (93%) Strand = Plus / Minus Query: 53 atccattcatccactcgttcattcattca 81 ||||||||||| | ||||||||||||||| Sbjct: 34008 atccattcatctattcgttcattcattca 33980
>emb|BX323071.16| Zebrafish DNA sequence from clone DKEYP-51F12, complete sequence Length = 208116 Score = 42.1 bits (21), Expect = 0.72 Identities = 21/21 (100%) Strand = Plus / Plus Query: 178 atccatccatccatccaccaa 198 ||||||||||||||||||||| Sbjct: 172733 atccatccatccatccaccaa 172753
>emb|BX649302.22| Zebrafish DNA sequence from clone CH211-248I6 in linkage group 12, complete sequence Length = 154089 Score = 42.1 bits (21), Expect = 0.72 Identities = 21/21 (100%) Strand = Plus / Plus Query: 178 atccatccatccatccaccaa 198 ||||||||||||||||||||| Sbjct: 119410 atccatccatccatccaccaa 119430
>emb|CR361558.6| Zebrafish DNA sequence from clone DKEY-22K11 in linkage group 13, complete sequence Length = 204631 Score = 42.1 bits (21), Expect = 0.72 Identities = 21/21 (100%) Strand = Plus / Minus Query: 178 atccatccatccatccaccaa 198 ||||||||||||||||||||| Sbjct: 116664 atccatccatccatccaccaa 116644
>emb|BX469911.9| Zebrafish DNA sequence from clone DKEY-13K9 in linkage group 5, complete sequence Length = 226730 Score = 42.1 bits (21), Expect = 0.72 Identities = 24/25 (96%) Strand = Plus / Minus Query: 180 ccatccatccatccaccaacatcta 204 ||||||||||||||||| ||||||| Sbjct: 148587 ccatccatccatccacccacatcta 148563
>emb|BX470135.8| Zebrafish DNA sequence from clone RP71-15H20 in linkage group 8, complete sequence Length = 147292 Score = 42.1 bits (21), Expect = 0.72 Identities = 27/29 (93%) Strand = Plus / Minus Query: 53 atccattcatccactcgttcattcattca 81 ||||||||||||| |||||| |||||||| Sbjct: 19510 atccattcatccattcgttcgttcattca 19482
>gb|AE014177.1| Mus musculus piebald deletion region section 5 of 11 of the complete sequence Length = 400029 Score = 42.1 bits (21), Expect = 0.72 Identities = 21/21 (100%) Strand = Plus / Plus Query: 178 atccatccatccatccaccaa 198 ||||||||||||||||||||| Sbjct: 346121 atccatccatccatccaccaa 346141
>gb|AC020912.6| Homo sapiens chromosome 19 clone CTD-2583G20, complete sequence Length = 163225 Score = 42.1 bits (21), Expect = 0.72 Identities = 21/21 (100%) Strand = Plus / Minus Query: 178 atccatccatccatccaccaa 198 ||||||||||||||||||||| Sbjct: 68875 atccatccatccatccaccaa 68855
>gb|AC008735.9| Homo sapiens chromosome 19 clone CTD-2537I9, complete sequence Length = 223879 Score = 42.1 bits (21), Expect = 0.72 Identities = 21/21 (100%) Strand = Plus / Minus Query: 178 atccatccatccatccaccaa 198 ||||||||||||||||||||| Sbjct: 133794 atccatccatccatccaccaa 133774
>gb|AC008742.9| Homo sapiens chromosome 19 clone CTD-2553C6, complete sequence Length = 194624 Score = 42.1 bits (21), Expect = 0.72 Identities = 27/29 (93%) Strand = Plus / Plus Query: 53 atccattcatccactcgttcattcattca 81 |||||||||| ||||||||||| |||||| Sbjct: 139735 atccattcattcactcgttcatccattca 139763
>emb|BX571718.9| Zebrafish DNA sequence from clone DKEYP-111A10 in linkage group 14, complete sequence Length = 168697 Score = 42.1 bits (21), Expect = 0.72 Identities = 21/21 (100%) Strand = Plus / Minus Query: 178 atccatccatccatccaccaa 198 ||||||||||||||||||||| Sbjct: 78843 atccatccatccatccaccaa 78823
>gb|AC010063.7| Drosophila melanogaster 3L BAC RP98-16A3 (Roswell Park Cancer Institute Drosophila BAC Library) complete sequence Length = 194006 Score = 42.1 bits (21), Expect = 0.72 Identities = 24/25 (96%) Strand = Plus / Plus Query: 56 cattcatccactcgttcattcattc 80 |||||||||| |||||||||||||| Sbjct: 92395 cattcatccattcgttcattcattc 92419
>emb|BX908742.7| Zebrafish DNA sequence from clone DKEY-246G23 in linkage group 18, complete sequence Length = 232903 Score = 42.1 bits (21), Expect = 0.72 Identities = 27/29 (93%) Strand = Plus / Minus Query: 53 atccattcatccactcgttcattcattca 81 |||||||||||||| | |||||||||||| Sbjct: 11381 atccattcatccacacattcattcattca 11353
>emb|BX510305.5| Zebrafish DNA sequence from clone CH211-107P11 in linkage group 23, complete sequence Length = 156938 Score = 42.1 bits (21), Expect = 0.72 Identities = 27/29 (93%) Strand = Plus / Plus Query: 53 atccattcatccactcgttcattcattca 81 ||||||||||||| || |||||||||||| Sbjct: 153579 atccattcatccattcattcattcattca 153607
>gb|AC079955.9| Homo sapiens chromosome 10 clone RP11-134O16, complete sequence Length = 192042 Score = 42.1 bits (21), Expect = 0.72 Identities = 21/21 (100%) Strand = Plus / Plus Query: 178 atccatccatccatccaccaa 198 ||||||||||||||||||||| Sbjct: 69872 atccatccatccatccaccaa 69892
>gb|AC023566.11| Homo sapiens chromosome 8, clone RP11-660D5, complete sequence Length = 184543 Score = 42.1 bits (21), Expect = 0.72 Identities = 27/29 (93%) Strand = Plus / Minus Query: 53 atccattcatccactcgttcattcattca 81 |||||||||| ||||| |||||||||||| Sbjct: 14269 atccattcattcactcattcattcattca 14241
>gb|AC069082.9| Homo sapiens chromosome 15, clone RP11-716C8, complete sequence Length = 163533 Score = 42.1 bits (21), Expect = 0.72 Identities = 27/29 (93%) Strand = Plus / Plus Query: 60 catccactcgttcattcattcaactgttt 88 ||||||||| |||||||||||| |||||| Sbjct: 156122 catccactcattcattcattcatctgttt 156150
>gb|AC099494.3| Homo sapiens chromosome 16 clone RP11-1102P22, complete sequence Length = 143557 Score = 42.1 bits (21), Expect = 0.72 Identities = 21/21 (100%) Strand = Plus / Minus Query: 179 tccatccatccatccaccaac 199 ||||||||||||||||||||| Sbjct: 76599 tccatccatccatccaccaac 76579
>gb|AC090119.1|AC090119 Takifugu rubripes clone 242D16, complete sequence Length = 107344 Score = 42.1 bits (21), Expect = 0.72 Identities = 21/21 (100%) Strand = Plus / Plus Query: 178 atccatccatccatccaccaa 198 ||||||||||||||||||||| Sbjct: 5659 atccatccatccatccaccaa 5679
>gb|AC011797.8| Homo sapiens, clone RP11-17L5, complete sequence Length = 158389 Score = 42.1 bits (21), Expect = 0.72 Identities = 27/29 (93%) Strand = Plus / Plus Query: 60 catccactcgttcattcattcaactgttt 88 ||||||||| |||||||||||| |||||| Sbjct: 56791 catccactcattcattcattcatctgttt 56819
>gb|AC016832.8| Homo sapiens, clone RP11-132E3, complete sequence Length = 184558 Score = 42.1 bits (21), Expect = 0.72 Identities = 24/25 (96%) Strand = Plus / Minus Query: 58 ttcatccactcgttcattcattcaa 82 ||||||||||| ||||||||||||| Sbjct: 94741 ttcatccactcattcattcattcaa 94717
>emb|BX276178.15| Zebrafish DNA sequence from clone CH211-245G9, complete sequence Length = 150884 Score = 42.1 bits (21), Expect = 0.72 Identities = 27/29 (93%) Strand = Plus / Minus Query: 53 atccattcatccactcgttcattcattca 81 ||||||||||||| || |||||||||||| Sbjct: 90778 atccattcatccattcattcattcattca 90750
>emb|BX571973.15| Zebrafish DNA sequence from clone DKEY-254A11 in linkage group 22, complete sequence Length = 214325 Score = 42.1 bits (21), Expect = 0.72 Identities = 21/21 (100%) Strand = Plus / Minus Query: 178 atccatccatccatccaccaa 198 ||||||||||||||||||||| Sbjct: 44608 atccatccatccatccaccaa 44588
>gb|AC008514.8| Homo sapiens chromosome 5 clone CTC-455F18, complete sequence Length = 172525 Score = 42.1 bits (21), Expect = 0.72 Identities = 21/21 (100%) Strand = Plus / Plus Query: 178 atccatccatccatccaccaa 198 ||||||||||||||||||||| Sbjct: 167437 atccatccatccatccaccaa 167457
>gb|AC051619.7|AC051619 Homo sapiens chromosome 15 clone CTD-2651B20 map 15q21.1, complete sequence Length = 213999 Score = 42.1 bits (21), Expect = 0.72 Identities = 27/29 (93%) Strand = Plus / Plus Query: 53 atccattcatccactcgttcattcattca 81 |||||| ||||||||| |||||||||||| Sbjct: 76809 atccatccatccactcattcattcattca 76837
>gb|AC158806.4| Mus musculus 10 BAC RP24-89F13 (Roswell Park Cancer Institute (C57BL/6J Male) Mouse BAC Library) complete sequence Length = 227508 Score = 42.1 bits (21), Expect = 0.72 Identities = 27/29 (93%) Strand = Plus / Minus Query: 53 atccattcatccactcgttcattcattca 81 |||||| ||||||||| |||||||||||| Sbjct: 73696 atccatccatccactcattcattcattca 73668
>gb|AC139676.3| Homo sapiens chromosome 8, clone RP13-648O9, complete sequence Length = 166153 Score = 42.1 bits (21), Expect = 0.72 Identities = 27/29 (93%) Strand = Plus / Plus Query: 53 atccattcatccactcgttcattcattca 81 |||||| |||||| ||||||||||||||| Sbjct: 97527 atccatccatccattcgttcattcattca 97555
>gb|AC119271.11| Mus musculus chromosome 7, clone RP24-373F15, complete sequence Length = 178814 Score = 42.1 bits (21), Expect = 0.72 Identities = 21/21 (100%) Strand = Plus / Minus Query: 178 atccatccatccatccaccaa 198 ||||||||||||||||||||| Sbjct: 31509 atccatccatccatccaccaa 31489
>dbj|AB121692.1| Mus musculus peptidylarginine deiminase gene cluster (Padi2, Padi1, Padi23, Padi4, Padi6), complete cds Length = 240498 Score = 42.1 bits (21), Expect = 0.72 Identities = 27/29 (93%) Strand = Plus / Plus Query: 53 atccattcatccactcgttcattcattca 81 |||||||||| ||||| |||||||||||| Sbjct: 44486 atccattcattcactcattcattcattca 44514
>gb|AC093642.5| Homo sapiens BAC clone RP11-341N2 from 2, complete sequence Length = 158203 Score = 42.1 bits (21), Expect = 0.72 Identities = 24/25 (96%) Strand = Plus / Plus Query: 178 atccatccatccatccaccaacatc 202 |||||||||||||||||||| |||| Sbjct: 29212 atccatccatccatccaccaccatc 29236 Score = 40.1 bits (20), Expect = 2.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 178 atccatccatccatccacca 197 |||||||||||||||||||| Sbjct: 29276 atccatccatccatccacca 29295 Score = 40.1 bits (20), Expect = 2.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 178 atccatccatccatccacca 197 |||||||||||||||||||| Sbjct: 29245 atccatccatccatccacca 29264 Score = 40.1 bits (20), Expect = 2.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 178 atccatccatccatccacca 197 |||||||||||||||||||| Sbjct: 29168 atccatccatccatccacca 29187 Score = 40.1 bits (20), Expect = 2.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 178 atccatccatccatccacca 197 |||||||||||||||||||| Sbjct: 29066 atccatccatccatccacca 29085 Score = 40.1 bits (20), Expect = 2.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 178 atccatccatccatccacca 197 |||||||||||||||||||| Sbjct: 29039 atccatccatccatccacca 29058 Score = 40.1 bits (20), Expect = 2.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 178 atccatccatccatccacca 197 |||||||||||||||||||| Sbjct: 29009 atccatccatccatccacca 29028 Score = 40.1 bits (20), Expect = 2.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 178 atccatccatccatccacca 197 |||||||||||||||||||| Sbjct: 28853 atccatccatccatccacca 28872 Score = 40.1 bits (20), Expect = 2.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 178 atccatccatccatccacca 197 |||||||||||||||||||| Sbjct: 28626 atccatccatccatccacca 28645 Score = 40.1 bits (20), Expect = 2.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 178 atccatccatccatccacca 197 |||||||||||||||||||| Sbjct: 28519 atccatccatccatccacca 28538 Score = 40.1 bits (20), Expect = 2.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 178 atccatccatccatccacca 197 |||||||||||||||||||| Sbjct: 28459 atccatccatccatccacca 28478 Score = 40.1 bits (20), Expect = 2.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 178 atccatccatccatccacca 197 |||||||||||||||||||| Sbjct: 28316 atccatccatccatccacca 28335
>gb|AC113186.6| Homo sapiens chromosome 8, clone RP11-941L11, complete sequence Length = 151000 Score = 42.1 bits (21), Expect = 0.72 Identities = 27/29 (93%) Strand = Plus / Minus Query: 53 atccattcatccactcgttcattcattca 81 |||||||||| ||||| |||||||||||| Sbjct: 73804 atccattcattcactcattcattcattca 73776
>gb|AC068418.5| Homo sapiens chromosome 17, clone RP11-728E14, complete sequence Length = 202992 Score = 42.1 bits (21), Expect = 0.72 Identities = 27/29 (93%) Strand = Plus / Minus Query: 53 atccattcatccactcgttcattcattca 81 |||||| ||||||||| |||||||||||| Sbjct: 87575 atccatccatccactcattcattcattca 87547
>gb|AC116910.11| Homo sapiens chromosome 17, clone CTD-2573C9, complete sequence Length = 149156 Score = 42.1 bits (21), Expect = 0.72 Identities = 21/21 (100%) Strand = Plus / Plus Query: 178 atccatccatccatccaccaa 198 ||||||||||||||||||||| Sbjct: 144179 atccatccatccatccaccaa 144199 Score = 42.1 bits (21), Expect = 0.72 Identities = 21/21 (100%) Strand = Plus / Plus Query: 178 atccatccatccatccaccaa 198 ||||||||||||||||||||| Sbjct: 144007 atccatccatccatccaccaa 144027
>gb|AC068483.6| Homo sapiens BAC clone RP11-31G7 from 2, complete sequence Length = 157285 Score = 42.1 bits (21), Expect = 0.72 Identities = 21/21 (100%) Strand = Plus / Plus Query: 178 atccatccatccatccaccaa 198 ||||||||||||||||||||| Sbjct: 39238 atccatccatccatccaccaa 39258
>gb|AC007406.1| Homo sapiens 12 BAC RPCI11-283I3 (Roswell Park Cancer Institute Human BAC Library) complete sequence Length = 177402 Score = 42.1 bits (21), Expect = 0.72 Identities = 21/21 (100%) Strand = Plus / Minus Query: 54 tccattcatccactcgttcat 74 ||||||||||||||||||||| Sbjct: 44359 tccattcatccactcgttcat 44339
>emb|BX248117.9| Zebrafish DNA sequence from clone CH211-226D5, complete sequence Length = 181542 Score = 42.1 bits (21), Expect = 0.72 Identities = 27/29 (93%) Strand = Plus / Plus Query: 53 atccattcatccactcgttcattcattca 81 ||||||||||||| |||||||||| |||| Sbjct: 13315 atccattcatccattcgttcattcgttca 13343
>gb|AC124057.12| Homo sapiens chromosome 11, clone RP5-915F1, complete sequence Length = 155082 Score = 42.1 bits (21), Expect = 0.72 Identities = 21/21 (100%) Strand = Plus / Minus Query: 178 atccatccatccatccaccaa 198 ||||||||||||||||||||| Sbjct: 104392 atccatccatccatccaccaa 104372
>gb|AC127521.11| Homo sapiens chromosome 17, clone RP13-580F15, complete sequence Length = 31450 Score = 42.1 bits (21), Expect = 0.72 Identities = 21/21 (100%) Strand = Plus / Minus Query: 178 atccatccatccatccaccaa 198 ||||||||||||||||||||| Sbjct: 31340 atccatccatccatccaccaa 31320
>gb|AC010442.7| Homo sapiens chromosome 5 clone CTD-2228K2, complete sequence Length = 153197 Score = 42.1 bits (21), Expect = 0.72 Identities = 21/21 (100%) Strand = Plus / Plus Query: 178 atccatccatccatccaccaa 198 ||||||||||||||||||||| Sbjct: 75323 atccatccatccatccaccaa 75343
>gb|AC119253.7| Mus musculus chromosome 15, clone RP24-279A15, complete sequence Length = 163503 Score = 42.1 bits (21), Expect = 0.72 Identities = 21/21 (100%) Strand = Plus / Minus Query: 178 atccatccatccatccaccaa 198 ||||||||||||||||||||| Sbjct: 141132 atccatccatccatccaccaa 141112
>gb|AC167565.1| Mus musculus BAC clone RP24-84D8 from chromosome 14, complete sequence Length = 199101 Score = 42.1 bits (21), Expect = 0.72 Identities = 24/25 (96%) Strand = Plus / Plus Query: 178 atccatccatccatccaccaacatc 202 |||||||||||||||||||| |||| Sbjct: 180778 atccatccatccatccaccaccatc 180802
>emb|AL935034.18| Zebrafish DNA sequence from clone CH211-160A3 in linkage group 12, complete sequence Length = 171213 Score = 42.1 bits (21), Expect = 0.72 Identities = 21/21 (100%) Strand = Plus / Minus Query: 178 atccatccatccatccaccaa 198 ||||||||||||||||||||| Sbjct: 90537 atccatccatccatccaccaa 90517 Score = 40.1 bits (20), Expect = 2.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 178 atccatccatccatccacca 197 |||||||||||||||||||| Sbjct: 139913 atccatccatccatccacca 139932
>gb|AC152169.2| Mus musculus BAC clone RP23-79L13 from chromosome 14, complete sequence Length = 236748 Score = 42.1 bits (21), Expect = 0.72 Identities = 27/29 (93%) Strand = Plus / Plus Query: 53 atccattcatccactcgttcattcattca 81 |||||| ||||||||| |||||||||||| Sbjct: 32850 atccatccatccactcattcattcattca 32878
>emb|BX247882.6| Zebrafish DNA sequence from clone CH211-224P3 in linkage group 14, complete sequence Length = 196155 Score = 42.1 bits (21), Expect = 0.72 Identities = 21/21 (100%) Strand = Plus / Minus Query: 178 atccatccatccatccaccaa 198 ||||||||||||||||||||| Sbjct: 163996 atccatccatccatccaccaa 163976
>emb|AL929074.5| Zebrafish DNA sequence from clone CH211-101B14, complete sequence Length = 165705 Score = 42.1 bits (21), Expect = 0.72 Identities = 27/29 (93%) Strand = Plus / Minus Query: 53 atccattcatccactcgttcattcattca 81 ||||||||||||| || |||||||||||| Sbjct: 159968 atccattcatccattcattcattcattca 159940
>gb|AF148621.1|AF148621 Oryza latifolia alcohol dehydrogenase II (Adh2) gene, exons 3 through 7, partial cds Length = 1702 Score = 42.1 bits (21), Expect = 0.72 Identities = 21/21 (100%) Strand = Plus / Minus Query: 177 gatccatccatccatccacca 197 ||||||||||||||||||||| Sbjct: 58 gatccatccatccatccacca 38
>gb|AF112229.1|HSCD30P2 Homo sapiens CD30 protein (CD30) gene, promoter, exon 1, and partial cds Length = 936 Score = 42.1 bits (21), Expect = 0.72 Identities = 21/21 (100%) Strand = Plus / Plus Query: 178 atccatccatccatccaccaa 198 ||||||||||||||||||||| Sbjct: 204 atccatccatccatccaccaa 224
>emb|AJ311494.1|HSA311494 Homo sapiens polymorphic CD30 promoter from the human Hodgkin's lymphoma-derived cell line L540 Length = 1612 Score = 42.1 bits (21), Expect = 0.72 Identities = 21/21 (100%) Strand = Plus / Plus Query: 178 atccatccatccatccaccaa 198 ||||||||||||||||||||| Sbjct: 1005 atccatccatccatccaccaa 1025
>emb|AJ311493.1|HSA311493 Homo sapiens polymorphic CD30 promoter from the human Hodgkin's lymphoma-derived cell line L591 Length = 1608 Score = 42.1 bits (21), Expect = 0.72 Identities = 21/21 (100%) Strand = Plus / Plus Query: 178 atccatccatccatccaccaa 198 ||||||||||||||||||||| Sbjct: 1001 atccatccatccatccaccaa 1021
>emb|AJ311492.1|HSA311492 Homo sapiens polymorphic CD30 promoter of the anaplastic large cell lymphoma cell line SU-DHL1 Length = 1605 Score = 42.1 bits (21), Expect = 0.72 Identities = 21/21 (100%) Strand = Plus / Plus Query: 178 atccatccatccatccaccaa 198 ||||||||||||||||||||| Sbjct: 998 atccatccatccatccaccaa 1018
>emb|AJ311491.1|HSA311491 Homo sapiens polymorphic CD30 promoter of the anaplastic large cell lymphoma cell line DEL Length = 1596 Score = 42.1 bits (21), Expect = 0.72 Identities = 21/21 (100%) Strand = Plus / Plus Query: 178 atccatccatccatccaccaa 198 ||||||||||||||||||||| Sbjct: 989 atccatccatccatccaccaa 1009
>emb|AJ311490.1|HSA311490 Homo sapiens polymorphic CD30 promoter from the human Hodgkin's lymphoma-derived cell line L428 Length = 1596 Score = 42.1 bits (21), Expect = 0.72 Identities = 21/21 (100%) Strand = Plus / Plus Query: 178 atccatccatccatccaccaa 198 ||||||||||||||||||||| Sbjct: 989 atccatccatccatccaccaa 1009
>emb|AJ311489.1|HSA311489 Homo sapiens polymorphic CD30 promoter from tonsillar tissue Length = 1329 Score = 42.1 bits (21), Expect = 0.72 Identities = 21/21 (100%) Strand = Plus / Plus Query: 178 atccatccatccatccaccaa 198 ||||||||||||||||||||| Sbjct: 722 atccatccatccatccaccaa 742
>emb|AJ311488.1|HSA311488 Homo sapiens polymorphic CD30 promoter from Hodgkin's lymphoma-derived cell line L1236 Length = 1177 Score = 42.1 bits (21), Expect = 0.72 Identities = 21/21 (100%) Strand = Plus / Plus Query: 178 atccatccatccatccaccaa 198 ||||||||||||||||||||| Sbjct: 570 atccatccatccatccaccaa 590
>emb|AJ311487.1|HSA311487 Homo sapiens polymorphic CD30 promoter from pancreatic tissue Length = 1173 Score = 42.1 bits (21), Expect = 0.72 Identities = 21/21 (100%) Strand = Plus / Plus Query: 178 atccatccatccatccaccaa 198 ||||||||||||||||||||| Sbjct: 566 atccatccatccatccaccaa 586
>emb|CR626902.14| Zebrafish DNA sequence from clone CH211-1F22 in linkage group 1, complete sequence Length = 130900 Score = 42.1 bits (21), Expect = 0.72 Identities = 27/29 (93%) Strand = Plus / Minus Query: 53 atccattcatccactcgttcattcattca 81 |||||||||| ||||| |||||||||||| Sbjct: 129665 atccattcattcactcattcattcattca 129637 Score = 40.1 bits (20), Expect = 2.8 Identities = 26/28 (92%) Strand = Plus / Minus Query: 53 atccattcatccactcgttcattcattc 80 |||||||||| ||||| ||||||||||| Sbjct: 129785 atccattcattcactcattcattcattc 129758
>emb|AJ308522.1|HSA308522 Homo sapiens partial CD30 gene, promoter region, isolate placenta No.1 Length = 1054 Score = 42.1 bits (21), Expect = 0.72 Identities = 21/21 (100%) Strand = Plus / Plus Query: 178 atccatccatccatccaccaa 198 ||||||||||||||||||||| Sbjct: 447 atccatccatccatccaccaa 467
>emb|AJ308521.1|HSA308521 Homo sapiens partial CD30 gene, promoter region, cell line Ho Length = 1050 Score = 42.1 bits (21), Expect = 0.72 Identities = 21/21 (100%) Strand = Plus / Plus Query: 178 atccatccatccatccaccaa 198 ||||||||||||||||||||| Sbjct: 443 atccatccatccatccaccaa 463
>emb|AJ272029.1|HSA272029 Homo sapiens partial CD30 gene for cytokine receptor CD30 and promoter region Length = 6518 Score = 42.1 bits (21), Expect = 0.72 Identities = 21/21 (100%) Strand = Plus / Plus Query: 178 atccatccatccatccaccaa 198 ||||||||||||||||||||| Sbjct: 2523 atccatccatccatccaccaa 2543
>emb|AL163302.2|HS21C102 Homo sapiens chromosome 21 segment HS21C102 Length = 340000 Score = 42.1 bits (21), Expect = 0.72 Identities = 21/21 (100%) Strand = Plus / Plus Query: 178 atccatccatccatccaccaa 198 ||||||||||||||||||||| Sbjct: 10653 atccatccatccatccaccaa 10673
>gb|AC151910.4| Mus musculus BAC clone RP23-67A17 from 14, complete sequence Length = 207254 Score = 42.1 bits (21), Expect = 0.72 Identities = 21/21 (100%) Strand = Plus / Plus Query: 178 atccatccatccatccaccaa 198 ||||||||||||||||||||| Sbjct: 46386 atccatccatccatccaccaa 46406
>emb|CR759910.13| Zebrafish DNA sequence from clone DKEYP-79C4 in linkage group 19, complete sequence Length = 217814 Score = 42.1 bits (21), Expect = 0.72 Identities = 21/21 (100%) Strand = Plus / Minus Query: 178 atccatccatccatccaccaa 198 ||||||||||||||||||||| Sbjct: 67993 atccatccatccatccaccaa 67973
>emb|CR628326.8| Zebrafish DNA sequence from clone CH211-247N12 in linkage group 19, complete sequence Length = 146234 Score = 42.1 bits (21), Expect = 0.72 Identities = 27/29 (93%) Strand = Plus / Minus Query: 53 atccattcatccactcgttcattcattca 81 ||||||||||||| || |||||||||||| Sbjct: 40994 atccattcatccattcattcattcattca 40966
>gb|AC154412.3| Mus musculus BAC clone RP24-225G4 from 14, complete sequence Length = 182048 Score = 42.1 bits (21), Expect = 0.72 Identities = 24/25 (96%) Strand = Plus / Plus Query: 178 atccatccatccatccaccaacatc 202 |||||||||||||||||||| |||| Sbjct: 34472 atccatccatccatccaccaccatc 34496
>emb|BX927293.15| Zebrafish DNA sequence from clone DKEY-95H12 in linkage group 18, complete sequence Length = 150229 Score = 42.1 bits (21), Expect = 0.72 Identities = 21/21 (100%) Strand = Plus / Plus Query: 178 atccatccatccatccaccaa 198 ||||||||||||||||||||| Sbjct: 139517 atccatccatccatccaccaa 139537
>emb|CR381614.10| Zebrafish DNA sequence from clone DKEY-72G4 in linkage group 20, complete sequence Length = 153083 Score = 42.1 bits (21), Expect = 0.72 Identities = 24/25 (96%) Strand = Plus / Plus Query: 178 atccatccatccatccaccaacatc 202 |||||||||||||||||||| |||| Sbjct: 7224 atccatccatccatccaccatcatc 7248
>emb|BX649423.7| Zebrafish DNA sequence from clone DKEY-18O7 in linkage group 4, complete sequence Length = 182374 Score = 42.1 bits (21), Expect = 0.72 Identities = 21/21 (100%) Strand = Plus / Plus Query: 178 atccatccatccatccaccaa 198 ||||||||||||||||||||| Sbjct: 116230 atccatccatccatccaccaa 116250 Score = 42.1 bits (21), Expect = 0.72 Identities = 21/21 (100%) Strand = Plus / Plus Query: 178 atccatccatccatccaccaa 198 ||||||||||||||||||||| Sbjct: 115854 atccatccatccatccaccaa 115874 Score = 40.1 bits (20), Expect = 2.8 Identities = 23/24 (95%) Strand = Plus / Plus Query: 178 atccatccatccatccaccaacat 201 ||||||||||||||||||| |||| Sbjct: 28418 atccatccatccatccacctacat 28441
>emb|AL672171.8| Zebrafish DNA sequence from clone BUSM1-270G24 in linkage group 3 Contains a CpG island, complete sequence Length = 114103 Score = 42.1 bits (21), Expect = 0.72 Identities = 27/29 (93%) Strand = Plus / Minus Query: 53 atccattcatccactcgttcattcattca 81 ||||||||||| | ||||||||||||||| Sbjct: 36345 atccattcatctattcgttcattcattca 36317
>gb|AC007228.1|AC007228 Homo sapiens chromosome 19, BAC 37295 (CIT-B-21A4), complete sequence Length = 130067 Score = 42.1 bits (21), Expect = 0.72 Identities = 24/25 (96%) Strand = Plus / Minus Query: 57 attcatccactcgttcattcattca 81 |||||||||||| |||||||||||| Sbjct: 92654 attcatccactcattcattcattca 92630
>gb|AE003473.3| Drosophila melanogaster chromosome 3L, section 7 of 83 of the complete sequence Length = 315108 Score = 42.1 bits (21), Expect = 0.72 Identities = 24/25 (96%) Strand = Plus / Minus Query: 56 cattcatccactcgttcattcattc 80 |||||||||| |||||||||||||| Sbjct: 139500 cattcatccattcgttcattcattc 139476
>emb|CR354589.19| Zebrafish DNA sequence from clone CH211-93L13 in linkage group 17, complete sequence Length = 114273 Score = 42.1 bits (21), Expect = 0.72 Identities = 27/29 (93%) Strand = Plus / Plus Query: 53 atccattcatccactcgttcattcattca 81 ||||||||||||| || |||||||||||| Sbjct: 70865 atccattcatccattcattcattcattca 70893
>dbj|AP001786.4| Homo sapiens genomic DNA, chromosome 11q, clone:RP11-176J24, complete sequences Length = 171744 Score = 42.1 bits (21), Expect = 0.72 Identities = 21/21 (100%) Strand = Plus / Minus Query: 178 atccatccatccatccaccaa 198 ||||||||||||||||||||| Sbjct: 143818 atccatccatccatccaccaa 143798
>gb|AC119183.8| Mus musculus chromosome 15, clone RP24-172H2, complete sequence Length = 144236 Score = 42.1 bits (21), Expect = 0.72 Identities = 21/21 (100%) Strand = Plus / Minus Query: 178 atccatccatccatccaccaa 198 ||||||||||||||||||||| Sbjct: 3444 atccatccatccatccaccaa 3424
>emb|AL837509.11| Mouse DNA sequence from clone RP23-44L6 on chromosome 2, complete sequence Length = 156698 Score = 42.1 bits (21), Expect = 0.72 Identities = 21/21 (100%) Strand = Plus / Plus Query: 178 atccatccatccatccaccaa 198 ||||||||||||||||||||| Sbjct: 74418 atccatccatccatccaccaa 74438
>gb|AC003693.1|AC003693 Human Chromosome 11p15.5 PAC clone pDJ915f1 containing KvLQT1 gene, complete sequence Length = 155074 Score = 42.1 bits (21), Expect = 0.72 Identities = 21/21 (100%) Strand = Plus / Plus Query: 178 atccatccatccatccaccaa 198 ||||||||||||||||||||| Sbjct: 50687 atccatccatccatccaccaa 50707
>dbj|AP002849.2| Homo sapiens genomic DNA, chromosome 8q23, clone: KB1495A5 Length = 205990 Score = 42.1 bits (21), Expect = 0.72 Identities = 24/25 (96%) Strand = Plus / Plus Query: 58 ttcatccactcgttcattcattcaa 82 ||||||||||| ||||||||||||| Sbjct: 123375 ttcatccactcattcattcattcaa 123399
>emb|AL691450.15| Mouse DNA sequence from clone RP23-20F9 on chromosome 2, complete sequence Length = 181372 Score = 42.1 bits (21), Expect = 0.72 Identities = 21/21 (100%) Strand = Plus / Plus Query: 178 atccatccatccatccaccaa 198 ||||||||||||||||||||| Sbjct: 25432 atccatccatccatccaccaa 25452
>emb|BX322557.1|HS112E20 Homo sapiens chromosome 21 from PAC RP1-112E20 map 21q22.3 region D21S171-LA161, complete sequence Length = 124074 Score = 42.1 bits (21), Expect = 0.72 Identities = 21/21 (100%) Strand = Plus / Plus Query: 178 atccatccatccatccaccaa 198 ||||||||||||||||||||| Sbjct: 77870 atccatccatccatccaccaa 77890
>gb|AC140449.3| Mus musculus BAC clone RP24-116C1 from 9, complete sequence Length = 222299 Score = 42.1 bits (21), Expect = 0.72 Identities = 21/21 (100%) Strand = Plus / Plus Query: 178 atccatccatccatccaccaa 198 ||||||||||||||||||||| Sbjct: 174212 atccatccatccatccaccaa 174232 Score = 42.1 bits (21), Expect = 0.72 Identities = 21/21 (100%) Strand = Plus / Plus Query: 178 atccatccatccatccaccaa 198 ||||||||||||||||||||| Sbjct: 174188 atccatccatccatccaccaa 174208
>gb|AC140110.2| Mus musculus BAC clone RP23-29H6 from 6, complete sequence Length = 214089 Score = 42.1 bits (21), Expect = 0.72 Identities = 21/21 (100%) Strand = Plus / Minus Query: 178 atccatccatccatccaccaa 198 ||||||||||||||||||||| Sbjct: 10202 atccatccatccatccaccaa 10182
>gb|AC147230.3| Mus musculus BAC clone RP23-239N12 from 15, complete sequence Length = 255976 Score = 42.1 bits (21), Expect = 0.72 Identities = 21/21 (100%) Strand = Plus / Minus Query: 178 atccatccatccatccaccaa 198 ||||||||||||||||||||| Sbjct: 69152 atccatccatccatccaccaa 69132
>gb|AC145303.4| Mus musculus BAC clone RP23-411P20 from 14, complete sequence Length = 190168 Score = 42.1 bits (21), Expect = 0.72 Identities = 21/21 (100%) Strand = Plus / Minus Query: 178 atccatccatccatccaccaa 198 ||||||||||||||||||||| Sbjct: 31224 atccatccatccatccaccaa 31204
>emb|CT025537.7| Mouse DNA sequence from clone RP23-454O17 on chromosome 14, complete sequence Length = 192695 Score = 42.1 bits (21), Expect = 0.72 Identities = 21/21 (100%) Strand = Plus / Plus Query: 178 atccatccatccatccaccaa 198 ||||||||||||||||||||| Sbjct: 175296 atccatccatccatccaccaa 175316
>gb|AC113144.11| Homo sapiens chromosome 17, clone RP11-45G12, complete sequence Length = 149288 Score = 42.1 bits (21), Expect = 0.72 Identities = 27/29 (93%) Strand = Plus / Plus Query: 53 atccattcatccactcgttcattcattca 81 |||||| ||||||||| |||||||||||| Sbjct: 134120 atccatccatccactcattcattcattca 134148
>dbj|AP003071.3| Homo sapiens genomic DNA, chromosome 11 clone:RP11-554A11, complete sequence Length = 191898 Score = 42.1 bits (21), Expect = 0.72 Identities = 21/21 (100%) Strand = Plus / Plus Query: 178 atccatccatccatccaccaa 198 ||||||||||||||||||||| Sbjct: 31324 atccatccatccatccaccaa 31344 Score = 42.1 bits (21), Expect = 0.72 Identities = 21/21 (100%) Strand = Plus / Plus Query: 178 atccatccatccatccaccaa 198 ||||||||||||||||||||| Sbjct: 31232 atccatccatccatccaccaa 31252 Score = 42.1 bits (21), Expect = 0.72 Identities = 21/21 (100%) Strand = Plus / Plus Query: 178 atccatccatccatccaccaa 198 ||||||||||||||||||||| Sbjct: 31144 atccatccatccatccaccaa 31164
>emb|AL772189.7| Zebrafish DNA sequence from clone CH211-135B6 in linkage group 17, complete sequence Length = 183958 Score = 42.1 bits (21), Expect = 0.72 Identities = 21/21 (100%) Strand = Plus / Plus Query: 68 cgttcattcattcaactgttt 88 ||||||||||||||||||||| Sbjct: 51402 cgttcattcattcaactgttt 51422
>emb|AL807805.7| Mouse DNA sequence from clone RP23-48K5 on chromosome 4, complete sequence Length = 183495 Score = 42.1 bits (21), Expect = 0.72 Identities = 27/29 (93%) Strand = Plus / Minus Query: 53 atccattcatccactcgttcattcattca 81 |||||||||| ||||| |||||||||||| Sbjct: 181251 atccattcattcactcattcattcattca 181223
>emb|AJ289159.1|HSA289159 Homo sapiens CD30 gene for cytokine receptor CD30, exons 1-8 Length = 24538 Score = 42.1 bits (21), Expect = 0.72 Identities = 21/21 (100%) Strand = Plus / Plus Query: 178 atccatccatccatccaccaa 198 ||||||||||||||||||||| Sbjct: 2523 atccatccatccatccaccaa 2543
>emb|AL359681.5|CNS05TEZ Human chromosome 14 DNA sequence BAC C-2348N10 of library CalTech-D from chromosome 14 of Homo sapiens (Human), complete sequence Length = 104782 Score = 42.1 bits (21), Expect = 0.72 Identities = 27/29 (93%) Strand = Plus / Minus Query: 53 atccattcatccactcgttcattcattca 81 |||||||||| ||||| |||||||||||| Sbjct: 49066 atccattcattcactcattcattcattca 49038
>gb|AC161768.25| Mus musculus 6 BAC RP23-37C14 (Roswell Park Cancer Institute (C57BL/6J Female) Mouse BAC Library) complete sequence Length = 196068 Score = 42.1 bits (21), Expect = 0.72 Identities = 21/21 (100%) Strand = Plus / Minus Query: 146 ctacatataacatacagagtc 166 ||||||||||||||||||||| Sbjct: 149494 ctacatataacatacagagtc 149474 Score = 42.1 bits (21), Expect = 0.72 Identities = 21/21 (100%) Strand = Plus / Plus Query: 146 ctacatataacatacagagtc 166 ||||||||||||||||||||| Sbjct: 127347 ctacatataacatacagagtc 127367
>gb|AC151981.3| Mus musculus BAC clone RP24-66K3 from chromosome 12, complete sequence Length = 185710 Score = 42.1 bits (21), Expect = 0.72 Identities = 27/29 (93%) Strand = Plus / Minus Query: 53 atccattcatccactcgttcattcattca 81 ||||||||||| |||| |||||||||||| Sbjct: 68254 atccattcatctactcattcattcattca 68226
>emb|AJ409012.1|HSA409012 Homo sapiens CD30 gene, promoter region, individual no.3 Length = 1345 Score = 42.1 bits (21), Expect = 0.72 Identities = 21/21 (100%) Strand = Plus / Plus Query: 178 atccatccatccatccaccaa 198 ||||||||||||||||||||| Sbjct: 738 atccatccatccatccaccaa 758
>emb|AJ409011.1|HSA409011 Homo sapiens CD30 gene, promoter region, individual no.2 Length = 1165 Score = 42.1 bits (21), Expect = 0.72 Identities = 21/21 (100%) Strand = Plus / Plus Query: 178 atccatccatccatccaccaa 198 ||||||||||||||||||||| Sbjct: 558 atccatccatccatccaccaa 578
>gb|AC151754.1| Ornithorhynchus anatinus chromosome UNK clone OABb-469A1, complete sequence Length = 138437 Score = 40.1 bits (20), Expect = 2.8 Identities = 32/36 (88%) Strand = Plus / Minus Query: 56 cattcatccactcgttcattcattcaactgttttca 91 ||||||| || || ||||||||||||||||| |||| Sbjct: 77360 cattcattcattcattcattcattcaactgtattca 77325
>gb|AC167973.4| Mus musculus BAC clone RP23-453B4 from chromosome 9, complete sequence Length = 182190 Score = 40.1 bits (20), Expect = 2.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 178 atccatccatccatccacca 197 |||||||||||||||||||| Sbjct: 117751 atccatccatccatccacca 117770
>gb|DQ223119.1| Alasmidonta heterodon microsatellite AheB121 sequence Length = 375 Score = 40.1 bits (20), Expect = 2.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 178 atccatccatccatccacca 197 |||||||||||||||||||| Sbjct: 83 atccatccatccatccacca 64
>ref|NM_189851.1| Oryza sativa (japonica cultivar-group), mRNA Length = 228 Score = 40.1 bits (20), Expect = 2.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 177 gatccatccatccatccacc 196 |||||||||||||||||||| Sbjct: 151 gatccatccatccatccacc 132
>gb|AC147651.4| Homo sapiens BAC clone RP13-689E11 from 7, complete sequence Length = 162139 Score = 40.1 bits (20), Expect = 2.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 177 gatccatccatccatccacc 196 |||||||||||||||||||| Sbjct: 11211 gatccatccatccatccacc 11192
>gb|AC104882.30| Mus musculus chromosome 8, clone RP23-401L9, complete sequence Length = 209525 Score = 40.1 bits (20), Expect = 2.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 179 tccatccatccatccaccaa 198 |||||||||||||||||||| Sbjct: 133582 tccatccatccatccaccaa 133563
>gb|AF377947.3| Oryza sativa (japonica cultivar-group) chromosome 3, BAC clone OSJNBa0032E21, complete sequence Length = 137580 Score = 40.1 bits (20), Expect = 2.8 Identities = 23/24 (95%) Strand = Plus / Plus Query: 169 caggcacggatccatccatccatc 192 |||||||| ||||||||||||||| Sbjct: 135221 caggcacgcatccatccatccatc 135244
>gb|AC123993.10| Mus musculus chromosome 3, clone RP24-357L20, complete sequence Length = 187115 Score = 40.1 bits (20), Expect = 2.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 178 atccatccatccatccacca 197 |||||||||||||||||||| Sbjct: 86283 atccatccatccatccacca 86264
>gb|CP000069.1| Trypanosoma brucei chromosome 6, complete sequence Length = 1618915 Score = 40.1 bits (20), Expect = 2.8 Identities = 32/36 (88%) Strand = Plus / Plus Query: 53 atccattcatccactcgttcattcattcaactgttt 88 |||| |||||||| || |||||||||||| |||||| Sbjct: 1025792 atccgttcatccattcattcattcattcacctgttt 1025827
>gb|AC074258.6| Trypanosoma brucei chromosome 6 clone RPCI93-2N9, complete sequence Length = 148326 Score = 40.1 bits (20), Expect = 2.8 Identities = 32/36 (88%) Strand = Plus / Minus Query: 53 atccattcatccactcgttcattcattcaactgttt 88 |||| |||||||| || |||||||||||| |||||| Sbjct: 60561 atccgttcatccattcattcattcattcacctgttt 60526
>gb|AC124985.16| Mus musculus chromosome 8, clone RP24-230O22, complete sequence Length = 171213 Score = 40.1 bits (20), Expect = 2.8 Identities = 29/32 (90%) Strand = Plus / Plus Query: 50 atgatccattcatccactcgttcattcattca 81 ||||| |||||||||| || |||||||||||| Sbjct: 157160 atgattcattcatccattcattcattcattca 157191
>gb|AC149676.2| Bos taurus BAC CH240-43C16 (Children's Hospital Oakland Research Institute Bovine BAC Library (male)) complete sequence Length = 168416 Score = 40.1 bits (20), Expect = 2.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 70 ttcattcattcaactgtttt 89 |||||||||||||||||||| Sbjct: 58377 ttcattcattcaactgtttt 58358
>gb|AC118676.6| Mus musculus chromosome 7, clone RP24-178N18, complete sequence Length = 149930 Score = 40.1 bits (20), Expect = 2.8 Identities = 27/28 (96%), Gaps = 1/28 (3%) Strand = Plus / Minus Query: 178 atccatccatccatcca-ccaacatcta 204 ||||||||||||||||| |||||||||| Sbjct: 97827 atccatccatccatccatccaacatcta 97800
>gb|AC150881.4| Bos taurus BAC CH240-354J15 (Children's Hospital Oakland Research Institute Bovine BAC Library (male)) complete sequence Length = 174996 Score = 40.1 bits (20), Expect = 2.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 70 ttcattcattcaactgtttt 89 |||||||||||||||||||| Sbjct: 146450 ttcattcattcaactgtttt 146431
>gb|AY676260.1| Acropora palmata strain ApPRs2 clone f6 18S ribosomal RNA gene, internal transcribed spacer 1, 5.8S ribosomal RNA gene, internal transcribed spacer 2, and 28S ribosomal RNA gene, complete sequence Length = 705 Score = 40.1 bits (20), Expect = 2.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 174 acggatccatccatccatcc 193 |||||||||||||||||||| Sbjct: 138 acggatccatccatccatcc 157
>gb|AC118318.7| Rattus norvegicus 7 BAC CH230-15G17 (Children's Hospital Oakland Research Institute) complete sequence Length = 128601 Score = 40.1 bits (20), Expect = 2.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 178 atccatccatccatccacca 197 |||||||||||||||||||| Sbjct: 117747 atccatccatccatccacca 117728
>gb|AC012376.12| Drosophila melanogaster clone BACR48C12, complete sequence Length = 183048 Score = 40.1 bits (20), Expect = 2.8 Identities = 23/24 (95%) Strand = Plus / Plus Query: 66 ctcgttcattcattcaactgtttt 89 |||||| ||||||||||||||||| Sbjct: 159074 ctcgtttattcattcaactgtttt 159097
>gb|AC116393.10| Mus musculus chromosome 15, clone RP23-94I16, complete sequence Length = 217156 Score = 40.1 bits (20), Expect = 2.8 Identities = 26/28 (92%) Strand = Plus / Minus Query: 54 tccattcatccactcgttcattcattca 81 ||||||||| |||||| ||||||||||| Sbjct: 142632 tccattcattcactcgctcattcattca 142605
>gb|AC166334.8| Mus musculus chromosome 7, clone RP23-470P9, complete sequence Length = 171861 Score = 40.1 bits (20), Expect = 2.8 Identities = 26/28 (92%) Strand = Plus / Plus Query: 54 tccattcatccactcgttcattcattca 81 ||||||||||||| | |||||||||||| Sbjct: 104748 tccattcatccacccattcattcattca 104775
>gb|AC116705.11| Mus musculus chromosome 5, clone RP23-26P10, complete sequence Length = 213155 Score = 40.1 bits (20), Expect = 2.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 178 atccatccatccatccacca 197 |||||||||||||||||||| Sbjct: 151934 atccatccatccatccacca 151915
>gb|AC137594.2| Oryza sativa (japonica cultivar-group) chromosome 9 BAC clone OSJNBa0065A15, complete sequence Length = 168806 Score = 40.1 bits (20), Expect = 2.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 177 gatccatccatccatccacc 196 |||||||||||||||||||| Sbjct: 66693 gatccatccatccatccacc 66674
>gb|AC104709.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone OJ1214_E03, complete sequence Length = 144601 Score = 40.1 bits (20), Expect = 2.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 177 gatccatccatccatccacc 196 |||||||||||||||||||| Sbjct: 41930 gatccatccatccatccacc 41949
>gb|AC068459.9| Mus musculus chromosome 12, clone RP23-158M23, complete sequence Length = 198494 Score = 40.1 bits (20), Expect = 2.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 178 atccatccatccatccacca 197 |||||||||||||||||||| Sbjct: 146985 atccatccatccatccacca 146966
>gb|AC129576.11| Mus musculus chromosome 10, clone RP24-343D9, complete sequence Length = 136276 Score = 40.1 bits (20), Expect = 2.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 178 atccatccatccatccacca 197 |||||||||||||||||||| Sbjct: 65557 atccatccatccatccacca 65576
>gb|AC147320.2| Pan troglodytes BAC clone RP43-44E12 from 7, complete sequence Length = 141313 Score = 40.1 bits (20), Expect = 2.8 Identities = 29/32 (90%) Strand = Plus / Plus Query: 50 atgatccattcatccactcgttcattcattca 81 ||||| ||||||| ||||| |||||||||||| Sbjct: 1876 atgattcattcattcactctttcattcattca 1907
>gb|AC147502.2| Mus musculus BAC clone RP23-111N9 from chromosome 7, complete sequence Length = 202934 Score = 40.1 bits (20), Expect = 2.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 178 atccatccatccatccacca 197 |||||||||||||||||||| Sbjct: 185345 atccatccatccatccacca 185364
>gb|AC147026.2| Mus musculus BAC clone RP23-249A22 from chromosome 19, complete sequence Length = 190038 Score = 40.1 bits (20), Expect = 2.8 Identities = 26/28 (92%) Strand = Plus / Plus Query: 56 cattcatccactcgttcattcattcaac 83 ||||||| ||||| |||||||||||||| Sbjct: 39126 cattcattcactcattcattcattcaac 39153
>gb|AC122302.4| Mus musculus BAC clone RP23-276E10 from chromosome 12, complete sequence Length = 172985 Score = 40.1 bits (20), Expect = 2.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 178 atccatccatccatccacca 197 |||||||||||||||||||| Sbjct: 164732 atccatccatccatccacca 164751
>gb|AC145307.3| Mus musculus BAC clone RP24-400C6 from chromosome 17, complete sequence Length = 203180 Score = 40.1 bits (20), Expect = 2.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 178 atccatccatccatccacca 197 |||||||||||||||||||| Sbjct: 149654 atccatccatccatccacca 149635
>gb|AC157552.10| Mus musculus chromosome 7, clone RP23-89C10, complete sequence Length = 195587 Score = 40.1 bits (20), Expect = 2.8 Identities = 26/28 (92%) Strand = Plus / Plus Query: 54 tccattcatccactcgttcattcattca 81 ||||||||||||| | |||||||||||| Sbjct: 14189 tccattcatccacccattcattcattca 14216
>gb|AC121264.8| Mus musculus chromosome 9, clone RP24-233F22, complete sequence Length = 194261 Score = 40.1 bits (20), Expect = 2.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 178 atccatccatccatccacca 197 |||||||||||||||||||| Sbjct: 130434 atccatccatccatccacca 130415
>gb|AC113201.15| Mus musculus chromosome 6, clone RP23-271G7, complete sequence Length = 205816 Score = 40.1 bits (20), Expect = 2.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 178 atccatccatccatccacca 197 |||||||||||||||||||| Sbjct: 48455 atccatccatccatccacca 48474
>gb|AC161217.7| Mus musculus chromosome 8, clone RP23-80D9, complete sequence Length = 234127 Score = 40.1 bits (20), Expect = 2.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 178 atccatccatccatccacca 197 |||||||||||||||||||| Sbjct: 80568 atccatccatccatccacca 80549
>gb|AC158608.10| Mus musculus 10 BAC RP24-405N1 (Roswell Park Cancer Institute (C57BL/6J Male) Mouse BAC Library) complete sequence Length = 181588 Score = 40.1 bits (20), Expect = 2.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 178 atccatccatccatccacca 197 |||||||||||||||||||| Sbjct: 20134 atccatccatccatccacca 20115
>gb|AC166939.2| Mus musculus BAC clone RP23-72K19 from chromosome 8, complete sequence Length = 236510 Score = 40.1 bits (20), Expect = 2.8 Identities = 23/24 (95%) Strand = Plus / Minus Query: 178 atccatccatccatccaccaacat 201 ||||||||||||||||||| |||| Sbjct: 61783 atccatccatccatccacccacat 61760
>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3 Length = 36102668 Score = 40.1 bits (20), Expect = 2.8 Identities = 23/24 (95%) Strand = Plus / Minus Query: 169 caggcacggatccatccatccatc 192 |||||||| ||||||||||||||| Sbjct: 30668457 caggcacgcatccatccatccatc 30668434
>gb|AC164086.3| Mus musculus BAC clone RP23-25E6 from chromosome 13, complete sequence Length = 214085 Score = 40.1 bits (20), Expect = 2.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 178 atccatccatccatccacca 197 |||||||||||||||||||| Sbjct: 87082 atccatccatccatccacca 87101
>gb|AC164155.2| Mus musculus BAC clone RP24-548I6 from chromosome 14, complete sequence Length = 215419 Score = 40.1 bits (20), Expect = 2.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 177 gatccatccatccatccacc 196 |||||||||||||||||||| Sbjct: 202621 gatccatccatccatccacc 202640
>gb|AC153919.8| Mus musculus 10 BAC RP23-91E23 (Roswell Park Cancer Institute (C57BL/6J Female) Mouse BAC Library) complete sequence Length = 264561 Score = 40.1 bits (20), Expect = 2.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 178 atccatccatccatccacca 197 |||||||||||||||||||| Sbjct: 176848 atccatccatccatccacca 176829 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 2,947,818 Number of Sequences: 3902068 Number of extensions: 2947818 Number of successful extensions: 596645 Number of sequences better than 10.0: 549 Number of HSP's better than 10.0 without gapping: 549 Number of HSP's successfully gapped in prelim test: 2 Number of HSP's that attempted gapping in prelim test: 570220 Number of HSP's gapped (non-prelim): 24296 length of query: 223 length of database: 17,233,045,268 effective HSP length: 22 effective length of query: 201 effective length of database: 17,147,199,772 effective search space: 3446587154172 effective search space used: 3446587154172 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)