ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbastl24b08
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1gb|AC091119.2| Canis familiaris clone RP81-142A6, complete sequence 50 0.003
2gb|AC126174.9| Homo sapiens 12 BAC RP11-504F21 (Roswell Park Can... 48 0.012
3emb|AL603766.4| Human DNA sequence from clone RP11-365H23 on chr... 48 0.012
4gb|AC105014.5| Homo sapiens chromosome 15, clone RP11-466P9, com... 48 0.012
5gb|AC134913.6| Mus musculus BAC clone RP23-195M6 from chromosome... 48 0.012
6gb|AC096628.14| Mus musculus strain C57BL/6J chromosome 13 clone... 48 0.012
7gb|AC133896.7| Mus musculus chromosome 5, clone RP24-529E15, com... 46 0.046
8emb|AL591397.3| Human DNA sequence from clone RP11-240M16 on chr... 46 0.046
9emb|AL161658.21| Human DNA sequence from clone RP11-470C13 on ch... 46 0.046
10gb|AC161813.2| Mus musculus chromosome 5, clone RP23-264M9, comp... 46 0.046
11gb|AC103874.2| Homo sapiens chromosome 15, clone RP11-907B8, com... 46 0.046
12emb|AL606925.16| Mouse DNA sequence from clone RP23-12J1 on chro... 46 0.046
13gb|AC165078.2| Mus musculus BAC clone RP24-287O1 from chromosome... 44 0.18
14gb|AC115746.10| Mus musculus chromosome 15, clone RP23-3J8, comp... 44 0.18
15ref|XM_914623.2| PREDICTED: Mus musculus RIKEN cDNA C230098I05 g... 44 0.18
16gb|AC067941.7| Homo sapiens BAC clone RP11-815K3 from 7, complet... 44 0.18
17ref|XM_983707.1| PREDICTED: Mus musculus RIKEN cDNA C230098I05 g... 44 0.18
18ref|XM_194378.6| PREDICTED: Mus musculus RIKEN cDNA C230098I05 g... 44 0.18
19gb|AC146479.2| Pan troglodytes BAC clone CH251-424F5 from Y, com... 44 0.18
20emb|CR936360.14| Human DNA sequence from clone RP13-440N7 on chr... 44 0.18
21gb|AC089999.20| Homo sapiens 12 BAC RP11-545P7 (Roswell Park Can... 44 0.18
22gb|AC125050.6| Mus musculus BAC clone RP23-372I18 from chromosom... 44 0.18
23gb|AC121993.2| Mus musculus BAC clone RP24-301F19 from 3, comple... 44 0.18
24gb|AC146478.2| Pan troglodytes BAC clone CH251-409D17 from Y, co... 44 0.18
25gb|AC101490.8| Mus musculus chromosome 3, clone RP23-188O2, comp... 44 0.18
26emb|AL445199.37| Human DNA sequence from clone RP13-439H18 on ch... 44 0.18
27emb|BX908382.8| Human DNA sequence from clone WI2-87105E3 on chr... 44 0.18
28emb|AL445532.8| Human DNA sequence from clone RP11-263K15 on chr... 44 0.18
29gb|AC079199.9| Homo sapiens chromosome 17, clone RP11-94L15, com... 44 0.18
30gb|AC040933.12| Homo sapiens chromosome 17, clone CTD-2019C10, c... 44 0.18
31emb|AL136528.11| Human DNA sequence from clone RP5-1092A11 on ch... 44 0.18
32emb|AL080251.23|HSDJ93P18 Human DNA sequence from clone RP1-93P1... 44 0.18
33emb|AL035588.21|HS696P19 Human DNA sequence from clone RP4-696P1... 44 0.18
34gb|AC148836.6| Pan troglodytes BAC clone CH251-2C8 from chromoso... 44 0.18
35gb|AC171134.2| Helobdella robusta clone CH306-1A5, complete sequ... 44 0.18
36emb|BX511261.12| Zebrafish DNA sequence from clone DKEYP-59G7 in... 44 0.18
37emb|CR626867.6| Human DNA sequence from clone XX-HCC1954_8J23, c... 44 0.18
38emb|CR626880.9| Human DNA sequence from clone XX-HCC1954_11K06, ... 44 0.18
39gb|AC078903.11| Homo sapiens chromosome 17, clone RP11-1084K4, c... 44 0.18
40emb|BX663524.6| Zebrafish DNA sequence from clone DKEY-97K15, co... 44 0.18
41dbj|BS000632.2| Pan troglodytes chromosome Y clone: PTB-399O20, ... 44 0.18
42gb|AC087491.5| Homo sapiens chromosome 17, clone RP11-62N23, com... 44 0.18
43emb|BX548247.6| Zebrafish DNA sequence from clone DKEY-177G18 in... 44 0.18
44gb|DP000054.1| Pan troglodytes chromosome Y, partial sequence 44 0.18
45gb|AC109580.14| Danio rerio strain AB clone busm1-183j13, comple... 44 0.18
46emb|BX323839.13| Zebrafish DNA sequence from clone CH211-217K17 ... 44 0.18
47emb|BX247866.12| Zebrafish DNA sequence from clone DKEY-216J12 i... 44 0.18
48emb|BX649370.5| Zebrafish DNA sequence from clone DKEY-97I11 in ... 44 0.18
49emb|BX248082.11| Zebrafish DNA sequence from clone CH211-237B12 ... 44 0.18
50dbj|AK090234.1| Mus musculus 16 days neonate male diencephalon c... 44 0.18
51emb|AL929518.16| Zebrafish DNA sequence from clone CH211-163F10 ... 44 0.18
52emb|AL929396.18| Zebrafish DNA sequence from clone CH211-93G23 i... 44 0.18
53gb|AC138028.1| Homo sapiens chromosome 16 clone RP5-1142A6, comp... 44 0.18
54gb|AC061992.11| Homo sapiens chromosome 17, clone RP11-806H10, c... 44 0.18
55gb|AY208911.1| Homo sapiens v-erb-b2 erythroblastic leukemia vir... 44 0.18
56gb|AC122129.9| Homo sapiens chromosome 17, clone RP1-253P7, comp... 44 0.18
57dbj|AB096613.1| Homo sapiens DNA, 20kb-MKN7 rearranged sequence 44 0.18
58dbj|AP000977.4| Homo sapiens genomic DNA, chromosome 11q, clone:... 44 0.18
59emb|AL354000.7|HS253P07 Homo from PAC RP1-253P07 and PAC RP1-28... 44 0.18
60gb|AC003663.1|AC003663 Homo sapiens chromosome 17, clone HCIT87G... 44 0.18
61gb|AC136147.4| Mus musculus BAC clone RP23-18B3 from 8, complete... 44 0.18
62gb|AC150648.2| Mus musculus BAC clone RP23-235N5 from 7, complet... 44 0.18
63gb|AC127288.4| Mus musculus BAC clone RP23-358J11 from 8, comple... 44 0.18
64emb|AL954313.6| Zebrafish DNA sequence from clone CH211-257J20 i... 44 0.18
65gb|AC161433.5| Mus musculus chromosome 8, clone RP23-50F12, comp... 44 0.18
66emb|AL672259.9| Mouse DNA sequence from clone RP23-169M4 on chro... 44 0.18
67emb|AL831790.3| Mouse DNA sequence from clone RP23-334I5 on chro... 44 0.18
68dbj|AP003159.1| Homo sapiens genomic DNA, chromosome 1p36 clone:... 44 0.18
69gb|AC153851.27| Mus musculus 6 BAC RP23-61N4 (Roswell Park Cance... 42 0.72
70gb|AY559433.1| Thielaviopsis basicola clone NG3/NG4 ISSR sequence 42 0.72
71gb|AY169492.1| Oryza latifolia isolate 100914 clone 2 alcohol de... 42 0.72
72gb|AE000663.1|MMAE000663 Mus musculus TCR beta locus from bases ... 42 0.72
73gb|U93895.1|MNU93895 Megaptera novaeangliae clone GAAT400 micros... 42 0.72
74gb|AC134553.5| Mus musculus BAC clone RP24-280H19 from chromosom... 42 0.72
75gb|AC114342.12| Mus musculus chromosome 5, clone RP24-143H14, co... 42 0.72
76gb|AC161514.4| Mus musculus chromosome 7, clone RP23-378L12, com... 42 0.72
77gb|AC010976.6| Homo sapiens BAC clone RP11-286H15 from 2, comple... 42 0.72
78gb|AC133648.3| Mus musculus BAC clone RP23-291B1 from chromosome... 42 0.72
79gb|AY498860.1| Homo sapiens tumor necrosis factor receptor super... 42 0.72
80emb|BX927112.16| Zebrafish DNA sequence from clone DKEY-109M11 i... 42 0.72
81emb|BX936415.10| Zebrafish DNA sequence from clone CH211-242N18 ... 42 0.72
82emb|CR354562.12| Zebrafish DNA sequence from clone DKEY-25B23 in... 42 0.72
83gb|AC122058.4| Mus musculus BAC clone RP24-468G7 from chromosome... 42 0.72
84gb|AC025778.8| Homo sapiens chromosome 16 clone CTD-2504F3, comp... 42 0.72
85gb|AC112998.15| Mus musculus chromosome 3, clone RP23-147E7, com... 42 0.72
86gb|AC127567.4| Mus musculus BAC clone RP24-191P12 from chromosom... 42 0.72
87gb|AC121930.3| Mus musculus BAC clone RP24-205C1 from chromosome... 42 0.72
88gb|AC125229.3| Mus musculus BAC clone RP23-45P1 from 5, complete... 42 0.72
89emb|CR376783.22| Zebrafish DNA sequence from clone DKEY-41N20 in... 42 0.72
90emb|CR723510.1|CNS0GL7G Tetraodon nigroviridis full-length cDNA 42 0.72
91ref|XM_855601.1| PREDICTED: Canis familiaris similar to aquapori... 42 0.72
92gb|AC108430.11| Mus musculus chromosome 14, clone RP23-166L19, c... 42 0.72
93gb|AC004906.3| Homo sapiens PAC clone RP5-852O24 from 7, complet... 42 0.72
94emb|CR925794.8| Zebrafish DNA sequence from clone CH211-202A23 i... 42 0.72
95emb|CR762417.10| Zebrafish DNA sequence from clone DKEY-229E7 in... 42 0.72
96emb|Z85994.1|HS32I10 Human DNA sequence from clone RP1-32I10 on ... 42 0.72
97emb|AL929500.4| Human DNA sequence from clone CITF22-57B10 on ch... 42 0.72
98emb|AL591386.19| Human DNA sequence from clone RP11-349K21 on ch... 42 0.72
99emb|AL512424.14| Human DNA sequence from clone RP11-453E2 on chr... 42 0.72
100emb|AL499625.4| Human DNA sequence from clone LA20-66F10 on chro... 42 0.72
101emb|AL357835.11| Human DNA sequence from clone RP11-426M1 on chr... 42 0.72
102emb|AL121829.30|HSJ697K14 Human DNA sequence from clone RP4-697K... 42 0.72
103emb|AL121756.14|HSDJ726C3 Human DNA sequence from clone RP4-726C... 42 0.72
104emb|AL031984.13|HS173D1 Human DNA sequence from clone RP1-173D1 ... 42 0.72
105gb|AC163089.3| Mus musculus chromosome 5, clone RP23-346P15, com... 42 0.72
106emb|AL008721.1|HS390C10 Human DNA sequence from clone CTA-390C10... 42 0.72
107emb|X15400.1|DMGLASS Drosophila glass gene encoding a zinc finge... 42 0.72
108emb|AL591174.13| Mouse DNA sequence from clone RP23-271B20 on ch... 42 0.72
109emb|CR759869.14| Zebrafish DNA sequence from clone DKEY-238F11 i... 42 0.72
110emb|CR405705.11| Zebrafish DNA sequence from clone DKEY-64E13 in... 42 0.72
111emb|CR925715.4| Zebrafish DNA sequence from clone CH211-212C11 i... 42 0.72
112emb|AL645842.15| Mouse DNA sequence from clone RP23-20A9 on chro... 42 0.72
113emb|CR847843.7| Zebrafish DNA sequence from clone RP71-50C18 in ... 42 0.72
114emb|AL954256.1| Pan troglodytes chromosome 22 clone PTB-129I16 m... 42 0.72
115gb|AC090739.13| Homo sapiens chromosome 8, clone RP11-503E24, co... 42 0.72
116gb|AC022239.16| Homo sapiens chromosome 8, clone RP11-148O21, co... 42 0.72
117emb|BX511168.4| Zebrafish DNA sequence from clone DKEY-22F5 in l... 42 0.72
118emb|AL928995.19| Zebrafish DNA sequence from clone CH211-215M21 ... 42 0.72
119emb|AL672072.18| Zebrafish DNA sequence from clone BUSM1-55H21 C... 42 0.72
120emb|BX323071.16| Zebrafish DNA sequence from clone DKEYP-51F12, ... 42 0.72
121emb|BX649302.22| Zebrafish DNA sequence from clone CH211-248I6 i... 42 0.72
122emb|CR361558.6| Zebrafish DNA sequence from clone DKEY-22K11 in ... 42 0.72
123emb|BX469911.9| Zebrafish DNA sequence from clone DKEY-13K9 in l... 42 0.72
124emb|BX470135.8| Zebrafish DNA sequence from clone RP71-15H20 in ... 42 0.72
125gb|AE014177.1| Mus musculus piebald deletion region section 5 of... 42 0.72
126gb|AC020912.6| Homo sapiens chromosome 19 clone CTD-2583G20, com... 42 0.72
127gb|AC008735.9| Homo sapiens chromosome 19 clone CTD-2537I9, comp... 42 0.72
128gb|AC008742.9| Homo sapiens chromosome 19 clone CTD-2553C6, comp... 42 0.72
129emb|BX571718.9| Zebrafish DNA sequence from clone DKEYP-111A10 i... 42 0.72
130gb|AC010063.7| Drosophila melanogaster 3L BAC RP98-16A3 (Roswell... 42 0.72
131emb|BX908742.7| Zebrafish DNA sequence from clone DKEY-246G23 in... 42 0.72
132emb|BX510305.5| Zebrafish DNA sequence from clone CH211-107P11 i... 42 0.72
133gb|AC079955.9| Homo sapiens chromosome 10 clone RP11-134O16, com... 42 0.72
134gb|AC023566.11| Homo sapiens chromosome 8, clone RP11-660D5, com... 42 0.72
135gb|AC069082.9| Homo sapiens chromosome 15, clone RP11-716C8, com... 42 0.72
136gb|AC099494.3| Homo sapiens chromosome 16 clone RP11-1102P22, co... 42 0.72
137gb|AC090119.1|AC090119 Takifugu rubripes clone 242D16, complete ... 42 0.72
138gb|AC011797.8| Homo sapiens, clone RP11-17L5, complete sequence 42 0.72
139gb|AC016832.8| Homo sapiens, clone RP11-132E3, complete sequence 42 0.72
140emb|BX276178.15| Zebrafish DNA sequence from clone CH211-245G9, ... 42 0.72
141emb|BX571973.15| Zebrafish DNA sequence from clone DKEY-254A11 i... 42 0.72
142gb|AC008514.8| Homo sapiens chromosome 5 clone CTC-455F18, compl... 42 0.72
143gb|AC051619.7|AC051619 Homo sapiens chromosome 15 clone CTD-2651... 42 0.72
144gb|AC158806.4| Mus musculus 10 BAC RP24-89F13 (Roswell Park Canc... 42 0.72
145gb|AC139676.3| Homo sapiens chromosome 8, clone RP13-648O9, comp... 42 0.72
146gb|AC119271.11| Mus musculus chromosome 7, clone RP24-373F15, co... 42 0.72
147dbj|AB121692.1| Mus musculus peptidylarginine deiminase gene clu... 42 0.72
148gb|AC093642.5| Homo sapiens BAC clone RP11-341N2 from 2, complet... 42 0.72
149gb|AC113186.6| Homo sapiens chromosome 8, clone RP11-941L11, com... 42 0.72
150gb|AC068418.5| Homo sapiens chromosome 17, clone RP11-728E14, co... 42 0.72
151gb|AC116910.11| Homo sapiens chromosome 17, clone CTD-2573C9, co... 42 0.72
152gb|AC068483.6| Homo sapiens BAC clone RP11-31G7 from 2, complete... 42 0.72
153gb|AC007406.1| Homo sapiens 12 BAC RPCI11-283I3 (Roswell Park Ca... 42 0.72
154emb|BX248117.9| Zebrafish DNA sequence from clone CH211-226D5, c... 42 0.72
155gb|AC124057.12| Homo sapiens chromosome 11, clone RP5-915F1, com... 42 0.72
156gb|AC127521.11| Homo sapiens chromosome 17, clone RP13-580F15, c... 42 0.72
157gb|AC010442.7| Homo sapiens chromosome 5 clone CTD-2228K2, compl... 42 0.72
158gb|AC119253.7| Mus musculus chromosome 15, clone RP24-279A15, co... 42 0.72
159gb|AC167565.1| Mus musculus BAC clone RP24-84D8 from chromosome ... 42 0.72
160emb|AL935034.18| Zebrafish DNA sequence from clone CH211-160A3 i... 42 0.72
161gb|AC152169.2| Mus musculus BAC clone RP23-79L13 from chromosome... 42 0.72
162emb|BX247882.6| Zebrafish DNA sequence from clone CH211-224P3 in... 42 0.72
163emb|AL929074.5| Zebrafish DNA sequence from clone CH211-101B14, ... 42 0.72
164gb|AF148621.1|AF148621 Oryza latifolia alcohol dehydrogenase II ... 42 0.72
165gb|AF112229.1|HSCD30P2 Homo sapiens CD30 protein (CD30) gene, pr... 42 0.72
166emb|AJ311494.1|HSA311494 Homo sapiens polymorphic CD30 promoter ... 42 0.72
167emb|AJ311493.1|HSA311493 Homo sapiens polymorphic CD30 promoter ... 42 0.72
168emb|AJ311492.1|HSA311492 Homo sapiens polymorphic CD30 promoter ... 42 0.72
169emb|AJ311491.1|HSA311491 Homo sapiens polymorphic CD30 promoter ... 42 0.72
170emb|AJ311490.1|HSA311490 Homo sapiens polymorphic CD30 promoter ... 42 0.72
171emb|AJ311489.1|HSA311489 Homo sapiens polymorphic CD30 promoter ... 42 0.72
172emb|AJ311488.1|HSA311488 Homo sapiens polymorphic CD30 promoter ... 42 0.72
173emb|AJ311487.1|HSA311487 Homo sapiens polymorphic CD30 promoter ... 42 0.72
174emb|CR626902.14| Zebrafish DNA sequence from clone CH211-1F22 in... 42 0.72
175emb|AJ308522.1|HSA308522 Homo sapiens partial CD30 gene, promote... 42 0.72
176emb|AJ308521.1|HSA308521 Homo sapiens partial CD30 gene, promote... 42 0.72
177emb|AJ272029.1|HSA272029 Homo sapiens partial CD30 gene for cyto... 42 0.72
178emb|AL163302.2|HS21C102 Homo sapiens chromosome 21 segment HS21C102 42 0.72
179gb|AC151910.4| Mus musculus BAC clone RP23-67A17 from 14, comple... 42 0.72
180emb|CR759910.13| Zebrafish DNA sequence from clone DKEYP-79C4 in... 42 0.72
181emb|CR628326.8| Zebrafish DNA sequence from clone CH211-247N12 i... 42 0.72
182gb|AC154412.3| Mus musculus BAC clone RP24-225G4 from 14, comple... 42 0.72
183emb|BX927293.15| Zebrafish DNA sequence from clone DKEY-95H12 in... 42 0.72
184emb|CR381614.10| Zebrafish DNA sequence from clone DKEY-72G4 in ... 42 0.72
185emb|BX649423.7| Zebrafish DNA sequence from clone DKEY-18O7 in l... 42 0.72
186emb|AL672171.8| Zebrafish DNA sequence from clone BUSM1-270G24 i... 42 0.72
187gb|AC007228.1|AC007228 Homo sapiens chromosome 19, BAC 37295 (CI... 42 0.72
188gb|AE003473.3| Drosophila melanogaster chromosome 3L, section 7 ... 42 0.72
189emb|CR354589.19| Zebrafish DNA sequence from clone CH211-93L13 i... 42 0.72
190dbj|AP001786.4| Homo sapiens genomic DNA, chromosome 11q, clone:... 42 0.72
191gb|AC119183.8| Mus musculus chromosome 15, clone RP24-172H2, com... 42 0.72
192emb|AL837509.11| Mouse DNA sequence from clone RP23-44L6 on chro... 42 0.72
193gb|AC003693.1|AC003693 Human Chromosome 11p15.5 PAC clone pDJ915... 42 0.72
194dbj|AP002849.2| Homo sapiens genomic DNA, chromosome 8q23, clone... 42 0.72
195emb|AL691450.15| Mouse DNA sequence from clone RP23-20F9 on chro... 42 0.72
196emb|BX322557.1|HS112E20 Homo sapiens chromosome 21 from PAC RP1-... 42 0.72
197gb|AC140449.3| Mus musculus BAC clone RP24-116C1 from 9, complet... 42 0.72
198gb|AC140110.2| Mus musculus BAC clone RP23-29H6 from 6, complete... 42 0.72
199gb|AC147230.3| Mus musculus BAC clone RP23-239N12 from 15, compl... 42 0.72
200gb|AC145303.4| Mus musculus BAC clone RP23-411P20 from 14, compl... 42 0.72
201emb|CT025537.7| Mouse DNA sequence from clone RP23-454O17 on chr... 42 0.72
202gb|AC113144.11| Homo sapiens chromosome 17, clone RP11-45G12, co... 42 0.72
203dbj|AP003071.3| Homo sapiens genomic DNA, chromosome 11 clone:RP... 42 0.72
204emb|AL772189.7| Zebrafish DNA sequence from clone CH211-135B6 in... 42 0.72
205emb|AL807805.7| Mouse DNA sequence from clone RP23-48K5 on chrom... 42 0.72
206emb|AJ289159.1|HSA289159 Homo sapiens CD30 gene for cytokine rec... 42 0.72
207emb|AL359681.5|CNS05TEZ Human chromosome 14 DNA sequence BAC C-2... 42 0.72
208gb|AC161768.25| Mus musculus 6 BAC RP23-37C14 (Roswell Park Canc... 42 0.72
209gb|AC151981.3| Mus musculus BAC clone RP24-66K3 from chromosome ... 42 0.72
210emb|AJ409012.1|HSA409012 Homo sapiens CD30 gene, promoter region... 42 0.72
211emb|AJ409011.1|HSA409011 Homo sapiens CD30 gene, promoter region... 42 0.72
212gb|AC151754.1| Ornithorhynchus anatinus chromosome UNK clone OAB... 40 2.8
213gb|AC167973.4| Mus musculus BAC clone RP23-453B4 from chromosome... 40 2.8
214gb|DQ223119.1| Alasmidonta heterodon microsatellite AheB121 sequ... 40 2.8
215ref|NM_189851.1| Oryza sativa (japonica cultivar-group), mRNA 40 2.8
216gb|AC147651.4| Homo sapiens BAC clone RP13-689E11 from 7, comple... 40 2.8
217gb|AC104882.30| Mus musculus chromosome 8, clone RP23-401L9, com... 40 2.8
218gb|AF377947.3| Oryza sativa (japonica cultivar-group) chromosome... 40 2.8
219gb|AC123993.10| Mus musculus chromosome 3, clone RP24-357L20, co... 40 2.8
220gb|CP000069.1| Trypanosoma brucei chromosome 6, complete sequence 40 2.8
221gb|AC074258.6| Trypanosoma brucei chromosome 6 clone RPCI93-2N9,... 40 2.8
222gb|AC124985.16| Mus musculus chromosome 8, clone RP24-230O22, co... 40 2.8
223gb|AC149676.2| Bos taurus BAC CH240-43C16 (Children's Hospital ... 40 2.8
224gb|AC118676.6| Mus musculus chromosome 7, clone RP24-178N18, com... 40 2.8
225gb|AC150881.4| Bos taurus BAC CH240-354J15 (Children's Hospital... 40 2.8
226gb|AY676260.1| Acropora palmata strain ApPRs2 clone f6 18S ribos... 40 2.8
227gb|AC118318.7| Rattus norvegicus 7 BAC CH230-15G17 (Children's H... 40 2.8
228gb|AC012376.12| Drosophila melanogaster clone BACR48C12, complet... 40 2.8
229gb|AC116393.10| Mus musculus chromosome 15, clone RP23-94I16, co... 40 2.8
230gb|AC166334.8| Mus musculus chromosome 7, clone RP23-470P9, comp... 40 2.8
231gb|AC116705.11| Mus musculus chromosome 5, clone RP23-26P10, com... 40 2.8
232gb|AC137594.2| Oryza sativa (japonica cultivar-group) chromosome... 40 2.8
233gb|AC104709.2| Oryza sativa (japonica cultivar-group) chromosome... 40 2.8
234gb|AC068459.9| Mus musculus chromosome 12, clone RP23-158M23, co... 40 2.8
235gb|AC129576.11| Mus musculus chromosome 10, clone RP24-343D9, co... 40 2.8
236gb|AC147320.2| Pan troglodytes BAC clone RP43-44E12 from 7, comp... 40 2.8
237gb|AC147502.2| Mus musculus BAC clone RP23-111N9 from chromosome... 40 2.8
238gb|AC147026.2| Mus musculus BAC clone RP23-249A22 from chromosom... 40 2.8
239gb|AC122302.4| Mus musculus BAC clone RP23-276E10 from chromosom... 40 2.8
240gb|AC145307.3| Mus musculus BAC clone RP24-400C6 from chromosome... 40 2.8
241gb|AC157552.10| Mus musculus chromosome 7, clone RP23-89C10, com... 40 2.8
242gb|AC121264.8| Mus musculus chromosome 9, clone RP24-233F22, com... 40 2.8
243gb|AC113201.15| Mus musculus chromosome 6, clone RP23-271G7, com... 40 2.8
244gb|AC161217.7| Mus musculus chromosome 8, clone RP23-80D9, compl... 40 2.8
245gb|AC158608.10| Mus musculus 10 BAC RP24-405N1 (Roswell Park Can... 40 2.8
246gb|AC166939.2| Mus musculus BAC clone RP23-72K19 from chromosome... 40 2.8
247gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3 40 2.8
248gb|AC164086.3| Mus musculus BAC clone RP23-25E6 from chromosome ... 40 2.8
249gb|AC164155.2| Mus musculus BAC clone RP24-548I6 from chromosome... 40 2.8
250gb|AC153919.8| Mus musculus 10 BAC RP23-91E23 (Roswell Park Canc... 40 2.8
251gb|AC127334.3| Mus musculus BAC clone RP23-137P16 from chromosom... 40 2.8
252gb|AC122541.3| Mus musculus BAC clone RP24-567D4 from chromosome... 40 2.8
253gb|AC115743.10| Mus musculus chromosome 5, clone RP23-477P24, co... 40 2.8
254gb|AC117118.4| Rattus norvegicus 1 BAC CH230-161O8 (Children's H... 40 2.8
255gb|AC126250.4| Mus musculus BAC clone RP23-452K12 from chromosom... 40 2.8
256gb|AC135670.3| Mus musculus BAC clone RP23-370D21 from chromosom... 40 2.8
257gb|AC092556.8| Oryza sativa chromosome 3 BAC OSJNBa0047E24 genom... 40 2.8
258gb|AC134832.5| Mus musculus BAC clone RP24-561D12 from chromosom... 40 2.8
259gb|AC144672.2| Mus musculus BAC clone RP23-287L2 from chromosome... 40 2.8
260emb|BX677675.9| Zebrafish DNA sequence from clone DKEYP-90G12 in... 40 2.8
261emb|BX511141.27| Zebrafish DNA sequence from clone DKEYP-10C6 in... 40 2.8
262emb|AL954219.1| Pan troglodytes chromosome 22 clone PTB-302M06 m... 40 2.8
263emb|CR626875.10| Zebrafish DNA sequence from clone DKEY-31J4 in ... 40 2.8
264emb|CR956635.11| Pig DNA sequence from clone CH242-184L20 on chr... 40 2.8
265emb|CR788319.8| Zebrafish DNA sequence from clone DKEY-245H10 in... 40 2.8
266emb|BX927327.14| Zebrafish DNA sequence from clone CH211-11C15 i... 40 2.8
267emb|CR855305.12| Zebrafish DNA sequence from clone DKEY-98F17 in... 40 2.8
268gb|AC110524.11| Mus musculus chromosome 9, clone RP23-403L22, co... 40 2.8
269gb|AC110234.11| Mus musculus chromosome 5, clone RP23-76J15, com... 40 2.8
270gb|AC132621.5| Mus musculus BAC clone RP23-102G6 from chromosome... 40 2.8
271gb|AC127356.4| Mus musculus BAC clone RP23-100B5 from chromosome... 40 2.8
272gb|AC002550.1|HUAC002550 Human Chromosome 16 BAC clone CIT987SK-... 40 2.8
273gb|AC002394.1|HUAC002394 Human Chromosome 16 BAC clone CIT987SK-... 40 2.8
274gb|AC126672.3| Mus musculus BAC clone RP24-473A18 from chromosom... 40 2.8
275gb|AC103810.5| Homo sapiens chromosome 17, clone RP11-927P21, co... 40 2.8
276gb|AC124438.4| Mus musculus BAC clone RP24-260K9 from chromosome... 40 2.8
277gb|AC127235.3| Mus musculus BAC clone RP24-570A23 from chromosom... 40 2.8
278emb|CR854834.11| Zebrafish DNA sequence from clone DKEYP-92B10 i... 40 2.8
279gb|AC123921.3| Mus musculus BAC clone RP24-180J14 from chromosom... 40 2.8
280gb|AC124170.3| Mus musculus BAC clone RP23-155H5 from 8, complet... 40 2.8
281emb|CR555294.10| Zebrafish DNA sequence from clone CH211-169P4 i... 40 2.8
282gb|AC112269.3| Mus musculus BAC clone RP24-115O19 from 2, comple... 40 2.8
283gb|AC112272.4| Mus musculus BAC clone RP24-121N15 from 19, compl... 40 2.8
284gb|AC121578.2| Mus musculus BAC clone RP23-253I14 from 5, comple... 40 2.8
285gb|AC146265.2| Pan troglodytes BAC clone RP43-28O21 from 7, comp... 40 2.8
286gb|AC004614.2| Homo sapiens PAC clone RP5-1168D11 from 7, comple... 40 2.8
287emb|CR693293.2|CNS0FXW9 Tetraodon nigroviridis full-length cDNA 40 2.8
288gb|AC006337.5| Homo sapiens BAC clone RP11-535N23 from 7, comple... 40 2.8
289gb|AC004953.2| Homo sapiens PAC clone RP5-1059M17 from 7, comple... 40 2.8
290gb|AC113287.8| Mus musculus chromosome 3, clone RP23-412L13, com... 40 2.8
291gb|AC145090.1| Pan troglodytes BAC clone RP43-2G11 from 7, compl... 40 2.8
292gb|AC016522.10| Mus musculus chromosome 7, clone RP23-352D23, co... 40 2.8
293emb|CR847799.17| Zebrafish DNA sequence from clone DKEY-117P4 in... 40 2.8
294emb|CR555290.8| Zebrafish DNA sequence from clone DKEYP-10A10 in... 40 2.8
295gb|AC159474.9| Mus musculus 10 BAC RP23-28P17 (Roswell Park Canc... 40 2.8
296gb|AC159466.3| Mus musculus 10 BAC RP23-388A21 (Roswell Park Can... 40 2.8
297gb|AC093304.4| Homo sapiens chromosome 5 clone RP11-69K7, comple... 40 2.8
298emb|CR936470.3| Human DNA sequence from clone XX-C455C658L on ch... 40 2.8
299emb|BX855598.22| Zebrafish DNA sequence from clone DKEY-52J13 in... 40 2.8
300emb|Z93928.1|HS127B14 Human DNA sequence from clone RP1-127B14 o... 40 2.8
301emb|Z92543.1|HS271G9 Human DNA sequence from clone RP1-271G9 on ... 40 2.8
302emb|AL807246.11| Human DNA sequence from clone RP11-461H3 on chr... 40 2.8
303emb|AL731567.6| Human DNA sequence from clone RP11-67C2 on chrom... 40 2.8
304emb|AL672311.26| Human DNA sequence from clone RP13-167H21 on ch... 40 2.8
305emb|AL683870.15| Human DNA sequence from clone RP11-261P4 on chr... 40 2.8
306emb|AL683826.14| Human DNA sequence from clone XXyac-21CG7 on ch... 40 2.8
307emb|AL593848.14| Human DNA sequence from clone RP13-100B2 on chr... 40 2.8
308emb|AL591890.31| Human DNA sequence from clone RP11-54A22 on chr... 40 2.8
309emb|AL596210.20| Human DNA sequence from clone RP11-92O17 on chr... 40 2.8
310emb|AL590551.7| Human DNA sequence from clone RP11-243O10 on chr... 40 2.8
311emb|AL445931.29| Human DNA sequence from clone RP11-374P20 on ch... 40 2.8
312emb|AL392109.8| Human DNA sequence from clone RP13-459H7 on chro... 40 2.8
313emb|AL359925.9| Human DNA sequence from clone RP11-199B17 on chr... 40 2.8
314gb|AC139034.7| Mus musculus chromosome 6, clone RP23-350J11, com... 40 2.8
315emb|AL356282.13| Human DNA sequence from clone RP11-303E19 on ch... 40 2.8
316emb|AL353615.37| Human DNA sequence from clone RP11-555H7 on chr... 40 2.8
317emb|AL353593.33| Human DNA sequence from clone RP5-1139B12 on ch... 40 2.8
318emb|AL354761.17| Human DNA sequence from clone RP11-98L5 on chro... 40 2.8
319gb|AC098563.6| Rattus norvegicus 1 BAC CH230-123A15 (Children's ... 40 2.8
320emb|AL353736.11| Human DNA sequence from clone RP11-412P1 on chr... 40 2.8
321emb|AL158086.32| Human DNA sequence from clone RP4-815O16 on chr... 40 2.8
322emb|AL160155.19| Human DNA sequence from clone RP11-461N23 on ch... 40 2.8
323emb|AL136379.19| Human DNA sequence from clone RP5-881P19 on chr... 40 2.8
324emb|AL117380.28|HSJ749H19 Human DNA sequence from clone RP4-749H... 40 2.8
325emb|AL121910.26|HSDJ827L5 Human DNA sequence from clone RP5-827L... 40 2.8
326emb|AL121929.17|HSBA416N2 Human DNA sequence from clone RP11-416... 40 2.8
327emb|AL121908.16|HSDJ719C8 Human DNA sequence from clone RP4-719C... 40 2.8
328emb|AL121958.6|HSDJ71H19 Human DNA sequence from clone RP1-71H19... 40 2.8
329emb|AL109811.40|HSJ635E18 Human DNA sequence from clone RP4-635E... 40 2.8
330emb|AL050325.20|HSJ824F16 Human DNA sequence from clone RP5-824F... 40 2.8
331emb|AL109944.19|HSJ737A23 Human DNA sequence from clone RP4-737A... 40 2.8
332emb|AL050402.16|HSBA46E17 Human DNA sequence from clone RP11-46E... 40 2.8
333emb|AL096766.12|HSDA59H18 Human DNA sequence from clone RP6-59H1... 40 2.8
334emb|AL049540.11|HSJ890O15 Human DNA sequence from clone RP5-890O... 40 2.8
335emb|AL050324.5|HSJ822J19 Human DNA sequence from clone RP5-822J1... 40 2.8
336gb|AC123769.5| Homo sapiens chromosome 17, clone RP11-1086I4, co... 40 2.8
337emb|AL022576.2|HS20J23 Human DNA sequence from clone RP1-20J23 o... 40 2.8
338emb|AL022316.2|HS126B4 Human DNA sequence from clone CTA-126B4 o... 40 2.8
339emb|AL021392.5|HS439F8 Human DNA sequence from clone RP3-439F8 o... 40 2.8
340emb|AL008636.1|HS722E9 Human DNA sequence from clone CTA-722E9 o... 40 2.8
341emb|CR450789.9| Zebrafish DNA sequence from clone DKEY-7P12 in l... 40 2.8
342gb|AC158975.9| Mus musculus chromosome 18, clone RP24-192J22, co... 40 2.8
343gb|AC160970.7| Mus musculus BAC clone RP24-492D11 from chromosom... 40 2.8
344gb|AC163342.2| Mus musculus BAC clone RP24-115M13 from chromosom... 40 2.8
345emb|BX119920.7| Zebrafish DNA sequence from clone CH211-46O21 in... 40 2.8
346emb|AL596122.14| Mouse DNA sequence from clone RP23-320E6 on chr... 40 2.8
347emb|AJ314906.1|HSA314906 Homo sapiens partial OBSCN gene for obs... 40 2.8
348gb|AC154233.3| Mus musculus BAC clone RP24-345G9 from chromosome... 40 2.8
349gb|AC139749.4| Homo sapiens chromosome 11, clone RP13-870H17, co... 40 2.8
350emb|BX511087.12| Zebrafish DNA sequence from clone DKEY-261O7 in... 40 2.8
351emb|CR407560.11| Zebrafish DNA sequence from clone CH211-180L14,... 40 2.8
352gb|AY678298.1| Lycopersicon esculentum clone 56B23 chromosome 6,... 40 2.8
353gb|AC090013.16| Homo sapiens 12 BAC RP11-407P2 (Roswell Park Can... 40 2.8
354gb|AC007834.40| Homo sapiens 12 BAC RP11-7G5 (Roswell Park Cance... 40 2.8
355gb|AC156982.8| Mus musculus chromosome 19, clone RP23-183N3, com... 40 2.8
356emb|BX510929.10| Zebrafish DNA sequence from clone CH211-261F9, ... 40 2.8
357emb|AL929349.10| Zebrafish DNA sequence from clone CH211-207D24 ... 40 2.8
358gb|AC116419.32| Mus musculus chromosome 1, clone RP24-89C10, com... 40 2.8
359gb|AE006465.1| Homo sapiens 16p13.3 sequence section 4 of 8 40 2.8
360emb|BX537142.10| Zebrafish DNA sequence from clone CH211-271D10 ... 40 2.8
361emb|BX571727.8| Zebrafish DNA sequence from clone DKEY-14I22 in ... 40 2.8
362gb|AY129964.1| Mus musculus strain C3H GPI-gamma 4 gene, complet... 40 2.8
363emb|BX323809.14| Zebrafish DNA sequence from clone DKEY-42J10 in... 40 2.8
364gb|AC011490.7| Homo sapiens chromosome 19 clone CTB-179L3, compl... 40 2.8
365gb|AC015722.6| Homo sapiens chromosome 15, clone RP11-167B3, com... 40 2.8
366emb|BX511161.6| Zebrafish DNA sequence from clone DKEY-248G17 in... 40 2.8
367gb|AC008540.6| Homo sapiens chromosome 19 clone CTC-496P20, comp... 40 2.8
368emb|BX649258.11| Zebrafish DNA sequence from clone CH211-203F4 i... 40 2.8
369gb|AC111654.6| Rattus norvegicus Chr BAC CH230-108G17 (Children'... 40 2.8
370gb|CP000282.1| Saccharophagus degradans 2-40, complete genome 40 2.8
371gb|AC063949.21| Homo sapiens 12 BAC RP11-693J15 (Roswell Park Ca... 40 2.8
372emb|BX927071.12| Zebrafish DNA sequence from clone DKEY-286O23 i... 40 2.8
373gb|AC092377.3| Homo sapiens chromosome 16 clone RP11-680G10, com... 40 2.8
374dbj|AB051897.1| Mus musculus Scya6, Scya9, Scya16-ps, Scya5 gene... 40 2.8
375gb|AC022021.10| Homo sapiens chromosome 10 clone RP11-351M16, co... 40 2.8
376gb|AC073866.16| Homo sapiens 12q BAC RP11-120B18 (Roswell Park C... 40 2.8
377dbj|AK138024.1| Mus musculus 16 days neonate thymus cDNA, RIKEN ... 40 2.8
378gb|AC011847.9| Homo sapiens chromosome 15, clone RP11-348J6, com... 40 2.8
379gb|AC097382.3| Homo sapiens BAC clone RP11-367J11 from 4, comple... 40 2.8
380dbj|AK137923.1| Mus musculus 16 days neonate thymus cDNA, RIKEN ... 40 2.8
381gb|AF469965.1| Oncorhynchus mykiss microsatellite OMM1178 sequence 40 2.8
382gb|AC009433.11| Homo sapiens, clone RP11-108N14, complete sequence 40 2.8
383gb|AC105410.1| Homo sapiens chromosome 16 clone CTD-2348G11, com... 40 2.8
384gb|AC067836.6| Homo sapiens chromosome 8, clone RP11-785H20, com... 40 2.8
385gb|AC011498.7| Homo sapiens chromosome 19 clone CTB-50L17, compl... 40 2.8
386emb|BX000689.17| Zebrafish DNA sequence from clone DKEY-79M5 in ... 40 2.8
387dbj|AK170794.1| Mus musculus NOD-derived CD11c +ve dendritic cel... 40 2.8
388emb|AL954374.4| Mouse DNA sequence from clone RP23-445A5 on chro... 40 2.8
389emb|BX322601.9| Zebrafish DNA sequence from clone DKEY-170H8 in ... 40 2.8
390gb|AC154105.2| Mus musculus BAC clone RP24-457N12 from chromosom... 40 2.8
391emb|BX664745.13| Zebrafish DNA sequence from clone DKEY-242A8 in... 40 2.8
392emb|BX088704.7| Zebrafish DNA sequence from clone CH211-208M6 in... 40 2.8
393emb|BX470167.7| Zebrafish DNA sequence from clone DKEYP-86G2 in ... 40 2.8
394gb|AC158313.7| Mus musculus chromosome 8, clone RP23-246H16, com... 40 2.8
395emb|BX255912.10| Zebrafish DNA sequence from clone CH211-267H23,... 40 2.8
396gb|AE008684.1|AE008684 Mus musculus T-cell receptor alpha/delta ... 40 2.8
397gb|AC037486.4| Homo sapiens chromosome 8, clone RP11-398G24, com... 40 2.8
398dbj|AK040673.1| Mus musculus adult male aorta and vein cDNA, RIK... 40 2.8
399gb|AC151986.4| Mus musculus BAC clone RP23-365E22 from chromosom... 40 2.8
400gb|AC159629.2| Mus musculus BAC clone RP24-178C15 from chromosom... 40 2.8
401gb|AC008586.6|AC008586 Homo sapiens chromosome 5 clone CTC-568N2... 40 2.8
402gb|AC025839.12| Homo sapiens chromosome 8, clone RP11-370K2, com... 40 2.8
403gb|AC026791.4|AC026791 Homo sapiens chromosome 5 clone CTD-2265D... 40 2.8
404gb|AC011071.12|AC011071 Drosophila melanogaster, chromosome X, r... 40 2.8
405dbj|AK083031.1| Mus musculus 12 days embryo spinal cord cDNA, RI... 40 2.8
406dbj|AK086467.1| Mus musculus 15 days embryo head cDNA, RIKEN ful... 40 2.8
407emb|BX294388.5| Zebrafish DNA sequence from clone DKEYP-35F11 in... 40 2.8
408dbj|AK082651.1| Mus musculus 0 day neonate cerebellum cDNA, RIKE... 40 2.8
409gb|AC155949.8| Mus musculus 6 BAC RP24-407P20 (Roswell Park Canc... 40 2.8
410emb|AL929493.20| Zebrafish DNA sequence from clone CH211-157D2, ... 40 2.8
411dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic D... 40 2.8
412dbj|AP008215.1| Oryza sativa (japonica cultivar-group) genomic D... 40 2.8
413gb|AC009041.10| Homo sapiens chromosome 16 clone RP11-161M6, com... 40 2.8
414dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic D... 40 2.8
415dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic D... 40 2.8
416dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic D... 40 2.8
417gb|AC096996.2| Homo sapiens chromosome 16 clone RP11-3M1, comple... 40 2.8
418dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic D... 40 2.8
419gb|AC007224.5| Homo sapiens chromosome 16 clone RP11-475D10, com... 40 2.8
420dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic D... 40 2.8
421gb|AC009035.9| Homo sapiens chromosome 16 clone RP11-142A12, com... 40 2.8
422emb|BX005336.10| Zebrafish DNA sequence from clone DKEY-85K7 in ... 40 2.8
423gb|AC092384.5| Homo sapiens chromosome 16 clone RP11-830F9, comp... 40 2.8
424gb|AC012509.13| Homo sapiens BAC clone RP11-532A9 from 2, comple... 40 2.8
425gb|AC153568.5| Mus musculus 10 BAC RP23-66K22 (Roswell Park Canc... 40 2.8
426gb|AC103726.5| Homo sapiens chromosome 8, clone RP11-737F9, comp... 40 2.8
427gb|AC102022.8| Mus musculus chromosome 8, clone RP24-67K5, compl... 40 2.8
428dbj|AP001732.1| Homo sapiens genomic DNA, chromosome 21q, sectio... 40 2.8
429gb|AC126943.5| Mus musculus BAC clone RP23-307F3 from chromosome... 40 2.8
430gb|AC069209.38| Homo sapiens 12 BAC RP11-340F14 (Roswell Park Ca... 40 2.8
431gb|AC017033.5| Homo sapiens BAC clone RP11-297J22 from 2, comple... 40 2.8
432gb|AC012494.8| Homo sapiens BAC clone RP11-312P13 from 2, comple... 40 2.8
433gb|AC012449.7| Homo sapiens BAC clone RP11-321K13 from 2, comple... 40 2.8
434dbj|AP003274.4| Oryza sativa (japonica cultivar-group) genomic D... 40 2.8
435gb|AC004916.2|AC004916 Homo sapiens PAC clone RP5-891L14 from 7p... 40 2.8
436gb|AC091132.16| Homo sapiens chromosome 17, clone RP11-798G7, co... 40 2.8
437gb|AC021636.16| Homo sapiens chromosome 8, clone RP11-637F16, co... 40 2.8
438gb|AC004147.2| Homo sapiens chromosome 17, clone CTC-304I17, com... 40 2.8
439gb|AC108448.12| Homo sapiens chromosome 11, clone CTD-2544D21, c... 40 2.8
440gb|AC009803.17| Homo sapiens 12 BAC RP11-1028N23 (Roswell Park C... 40 2.8
441gb|AC134437.3| Mus musculus BAC clone RP24-450H12 from chromosom... 40 2.8
442emb|BX005069.9| Zebrafish DNA sequence from clone CH211-132P1 in... 40 2.8
443dbj|AP004380.2| Oryza sativa (japonica cultivar-group) genomic D... 40 2.8
444dbj|AP006533.3| Oryza sativa (japonica cultivar-group) genomic D... 40 2.8
445dbj|AP006055.3| Oryza sativa (japonica cultivar-group) genomic D... 40 2.8
446emb|BX005277.11| Zebrafish DNA sequence from clone CH211-167H2, ... 40 2.8
447dbj|AP004309.3| Oryza sativa (japonica cultivar-group) genomic D... 40 2.8
448emb|BX323029.6| Zebrafish DNA sequence from clone CH211-261O16, ... 40 2.8
449dbj|BS000108.1| Pan troglodytes chromosome 22 clone:PTB-237C02, ... 40 2.8
450emb|AL772311.19| Mouse DNA sequence from clone RP23-87P16 on chr... 40 2.8
451dbj|AK120002.1| Oryza sativa (japonica cultivar-group) cDNA clon... 40 2.8
452emb|AL442117.1|H0421H08 Oryza sativa genomic DNA, chromosome X, ... 40 2.8
453emb|AJ299718.1|HSA299718 Homo sapiens partial MASP2 gene, intron 7 40 2.8
454emb|BX284684.8| Zebrafish DNA sequence from clone DKEY-14I10 in ... 40 2.8
455dbj|AK068104.1| Oryza sativa (japonica cultivar-group) cDNA clon... 40 2.8
456gb|AC008000.7|AC008000 Homo sapiens 3q25-26 BAC CITB-371O18 (Cal... 40 2.8
457gb|AC154212.2| Mus musculus BAC clone RP24-120A9 from 16, comple... 40 2.8
458gb|AC140488.4| Mus musculus BAC clone RP24-142A8 from 9, complet... 40 2.8
459gb|AC124191.4| Mus musculus BAC clone RP23-275E4 from 18, comple... 40 2.8
460emb|BX640480.22| Zebrafish DNA sequence from clone DKEYP-86F2 in... 40 2.8
461emb|CR381630.12| Zebrafish DNA sequence from clone CH211-234G24 ... 40 2.8
462emb|BX936416.11| Zebrafish DNA sequence from clone CH211-194I16 ... 40 2.8
463emb|BX936391.7| Zebrafish DNA sequence from clone CH211-114A22 i... 40 2.8
464emb|BX465225.10| Zebrafish DNA sequence from clone DKEY-29F10 in... 40 2.8
465emb|BX469895.7| Zebrafish DNA sequence from clone DKEY-152C18 in... 40 2.8
466emb|BX510919.4| Zebrafish DNA sequence from clone DKEY-164K19 in... 40 2.8
467emb|CR388140.8| Zebrafish DNA sequence from clone CH211-190G11, ... 40 2.8
468gb|AC153578.4| Mus musculus 6 BAC RP23-218P2 (Roswell Park Cance... 40 2.8
469gb|AC007193.1|AC007193 Homo sapiens chromosome 19, BAC 82621 (CI... 40 2.8
470emb|AL512544.3| Oryza sativa genomic DNA, chromosome 4, BAC clon... 40 2.8
471gb|AC007459.1|AC007459 Homo sapiens chromosome 16 clone 306C6, c... 40 2.8
472gb|AC122205.6| Mus musculus BAC clone RP23-76C13 from chromosome... 40 2.8
473gb|AC006952.6|AC006952 Homo sapiens chromosome 9, clone hRPK.374... 40 2.8
474gb|AC007124.1|AC007124 Human genomic clone P1-11874, complete se... 40 2.8
475gb|AC006930.1|AC006930 Homo sapiens chromosome 19, cosmid R33243... 40 2.8
476gb|AE003512.3| Drosophila melanogaster chromosome X, section 64 ... 40 2.8
477gb|AC006506.1|AC006506 Homo sapiens chromosome 19, cosmid F25233... 40 2.8
478emb|AL357093.4|CNS05TDS Human chromosome 14 DNA sequence BAC R-3... 40 2.8
479gb|AC124613.18| Mus musculus chromosome 1, clone RP24-380F12, co... 40 2.8
480dbj|AP001709.1| Homo sapiens genomic DNA, chromosome 21q, sectio... 40 2.8
481gb|AC110572.13| Mus musculus chromosome 5, clone RP23-316P20, co... 40 2.8
482emb|CT572991.10| Mouse DNA sequence from clone RP24-434I23 on ch... 40 2.8
483gb|AC119259.15| Mus musculus chromosome 18, clone RP24-285N19, c... 40 2.8
484emb|CR626961.6| Zebrafish DNA sequence from clone CH211-160F13 i... 40 2.8
485dbj|AP003095.2| Homo sapiens genomic DNA, chromosome 11q, clone:... 40 2.8
486dbj|AP005714.3| Homo sapiens genomic DNA, chromosome 8q24, clone... 40 2.8
487emb|CT573501.1| Medicago truncatula chromosome 5 clone mth2-60o2... 40 2.8
488gb|AC107371.17| Mus musculus chromosome 7, clone RP24-66D2, comp... 40 2.8
489gb|AC174083.2| Mus musculus BAC clone RP23-25B17 from chromosome... 40 2.8
490emb|CR848750.27| Zebrafish DNA sequence from clone RP71-4B23 in ... 40 2.8
491emb|AL929379.14| Zebrafish DNA sequence from clone CH211-156H6, ... 40 2.8
492emb|AL591703.14| Mouse DNA sequence from clone RP23-448P12 on ch... 40 2.8
493emb|AL591411.14| Mouse DNA sequence from clone RP23-428M13 on ch... 40 2.8
494emb|AL844548.7| Mouse DNA sequence from clone RP23-263D22 on chr... 40 2.8
495emb|AL606685.3|OSJN00090 Oryza sativa genomic DNA, chromosome 4,... 40 2.8
496emb|AL606637.3|OSJN00076 Oryza sativa genomic DNA, chromosome 4,... 40 2.8
497emb|AL606635.3|OSJN00057 Oryza sativa genomic DNA, chromosome 4,... 40 2.8
498gb|AC132372.4| Mus musculus BAC clone RP23-478B10 from 8, comple... 40 2.8
499emb|BX000443.5| Zebrafish DNA sequence from clone DKEY-5K18 in l... 40 2.8
500gb|AC139330.4| Mus musculus BAC clone RP24-206O6 from 12, comple... 40 2.8

>gb|AC091119.2| Canis familiaris clone RP81-142A6, complete sequence
          Length = 150149

 Score = 50.1 bits (25), Expect = 0.003
 Identities = 31/33 (93%)
 Strand = Plus / Plus

                                              
Query: 178   atccatccatccatccaccaacatctagctacc 210
             ||||||||||||||||||| ||||||| |||||
Sbjct: 53827 atccatccatccatccacccacatctacctacc 53859



to top

>gb|AC126174.9| Homo sapiens 12 BAC RP11-504F21 (Roswell Park Cancer Institute Human
             BAC Library) complete sequence
          Length = 88686

 Score = 48.1 bits (24), Expect = 0.012
 Identities = 27/28 (96%)
 Strand = Plus / Plus

                                         
Query: 56    cattcatccactcgttcattcattcaac 83
             ||||||||||||| ||||||||||||||
Sbjct: 38444 cattcatccactcattcattcattcaac 38471



to top

>emb|AL603766.4| Human DNA sequence from clone RP11-365H23 on chromosome 6 Contains a
             small nuclear ribonucleoprotein polypeptide B'' (SNRPB2)
             pseudogene, complete sequence
          Length = 80539

 Score = 48.1 bits (24), Expect = 0.012
 Identities = 27/28 (96%)
 Strand = Plus / Plus

                                         
Query: 50    atgatccattcatccactcgttcattca 77
             |||||||||||||||| |||||||||||
Sbjct: 44734 atgatccattcatccattcgttcattca 44761



to top

>gb|AC105014.5| Homo sapiens chromosome 15, clone RP11-466P9, complete sequence
          Length = 189047

 Score = 48.1 bits (24), Expect = 0.012
 Identities = 27/28 (96%)
 Strand = Plus / Minus

                                         
Query: 55    ccattcatccactcgttcattcattcaa 82
             |||| |||||||||||||||||||||||
Sbjct: 74581 ccatccatccactcgttcattcattcaa 74554



to top

>gb|AC134913.6| Mus musculus BAC clone RP23-195M6 from chromosome 13, complete sequence
          Length = 223130

 Score = 48.1 bits (24), Expect = 0.012
 Identities = 27/28 (96%)
 Strand = Plus / Minus

                                          
Query: 53     atccattcatccactcgttcattcattc 80
              |||||||||||||||| |||||||||||
Sbjct: 175309 atccattcatccactcattcattcattc 175282



to top

>gb|AC096628.14| Mus musculus strain C57BL/6J chromosome 13 clone rp23-81n4, complete
            sequence
          Length = 194818

 Score = 48.1 bits (24), Expect = 0.012
 Identities = 27/28 (96%)
 Strand = Plus / Minus

                                        
Query: 53   atccattcatccactcgttcattcattc 80
            |||||||||||||||| |||||||||||
Sbjct: 1237 atccattcatccactcattcattcattc 1210



to top

>gb|AC133896.7| Mus musculus chromosome 5, clone RP24-529E15, complete sequence
          Length = 187415

 Score = 46.1 bits (23), Expect = 0.046
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                         
Query: 55     ccattcatccactcgttcattcattca 81
              ||||||| |||||||||||||||||||
Sbjct: 125525 ccattcagccactcgttcattcattca 125551



to top

>emb|AL591397.3| Human DNA sequence from clone RP11-240M16 on chromosome 6 Contains
            the 3' end of a novel gene and a laminin receptor 1 (67kD
            ribosomal protein SA) (LAMR1) pseudogene, complete
            sequence
          Length = 82646

 Score = 46.1 bits (23), Expect = 0.046
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                           
Query: 56   cattcatccactcgttcattcattcaactgt 86
            ||||||| |||||||||||||| ||||||||
Sbjct: 2244 cattcattcactcgttcattcaatcaactgt 2274



to top

>emb|AL161658.21| Human DNA sequence from clone RP11-470C13 on chromosome 20 Contains
            the 3' end of the gene for KIAA1272 protein (similar to
            rat tulip proteins 1 and 2), the INSM1 gene for
            insulinoma-associated protein 1, the 3' end of the
            C20orf26 gene and a CpG island, complete sequence
          Length = 67356

 Score = 46.1 bits (23), Expect = 0.046
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                       
Query: 178  atccatccatccatccaccaacatcta 204
            ||||||||||||||||||| |||||||
Sbjct: 4162 atccatccatccatccacccacatcta 4136



to top

>gb|AC161813.2| Mus musculus chromosome 5, clone RP23-264M9, complete sequence
          Length = 154852

 Score = 46.1 bits (23), Expect = 0.046
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                         
Query: 55     ccattcatccactcgttcattcattca 81
              ||||||| |||||||||||||||||||
Sbjct: 129748 ccattcagccactcgttcattcattca 129722



to top

>gb|AC103874.2| Homo sapiens chromosome 15, clone RP11-907B8, complete sequence
          Length = 158897

 Score = 46.1 bits (23), Expect = 0.046
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                        
Query: 178   atccatccatccatccaccaacatcta 204
             ||||||||||||||||| |||||||||
Sbjct: 87759 atccatccatccatccatcaacatcta 87733



to top

>emb|AL606925.16| Mouse DNA sequence from clone RP23-12J1 on chromosome 4, complete
              sequence
          Length = 239244

 Score = 46.1 bits (23), Expect = 0.046
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                     
Query: 177    gatccatccatccatccaccaac 199
              |||||||||||||||||||||||
Sbjct: 173780 gatccatccatccatccaccaac 173758



to top

>gb|AC165078.2| Mus musculus BAC clone RP24-287O1 from chromosome 12, complete sequence
          Length = 172492

 Score = 44.1 bits (22), Expect = 0.18
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                       
Query: 56    cattcatccactcgttcattcattca 81
             ||||||| ||||||||||||||||||
Sbjct: 86765 cattcattcactcgttcattcattca 86790



to top

>gb|AC115746.10| Mus musculus chromosome 15, clone RP23-3J8, complete sequence
          Length = 214765

 Score = 44.1 bits (22), Expect = 0.18
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 178   atccatccatccatccaccaac 199
             ||||||||||||||||||||||
Sbjct: 27295 atccatccatccatccaccaac 27316



to top

>ref|XM_914623.2| PREDICTED: Mus musculus RIKEN cDNA C230098I05 gene (C230098I05Rik),
            mRNA
          Length = 3942

 Score = 44.1 bits (22), Expect = 0.18
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                  
Query: 178  atccatccatccatccaccaac 199
            ||||||||||||||||||||||
Sbjct: 2449 atccatccatccatccaccaac 2470



to top

>gb|AC067941.7| Homo sapiens BAC clone RP11-815K3 from 7, complete sequence
          Length = 215994

 Score = 44.1 bits (22), Expect = 0.18
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 178   atccatccatccatccaccaac 199
             ||||||||||||||||||||||
Sbjct: 11618 atccatccatccatccaccaac 11639



to top

>ref|XM_983707.1| PREDICTED: Mus musculus RIKEN cDNA C230098I05 gene (C230098I05Rik),
            mRNA
          Length = 3926

 Score = 44.1 bits (22), Expect = 0.18
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                  
Query: 178  atccatccatccatccaccaac 199
            ||||||||||||||||||||||
Sbjct: 2433 atccatccatccatccaccaac 2454



to top

>ref|XM_194378.6| PREDICTED: Mus musculus RIKEN cDNA C230098I05 gene (C230098I05Rik),
            mRNA
          Length = 3926

 Score = 44.1 bits (22), Expect = 0.18
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                  
Query: 178  atccatccatccatccaccaac 199
            ||||||||||||||||||||||
Sbjct: 2433 atccatccatccatccaccaac 2454



to top

>gb|AC146479.2| Pan troglodytes BAC clone CH251-424F5 from Y, complete sequence
          Length = 163250

 Score = 44.1 bits (22), Expect = 0.18
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 178    atccatccatccatccaccaac 199
              ||||||||||||||||||||||
Sbjct: 138981 atccatccatccatccaccaac 139002



to top

>emb|CR936360.14| Human DNA sequence from clone RP13-440N7 on chromosome X, complete
              sequence
          Length = 154563

 Score = 44.1 bits (22), Expect = 0.18
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 178    atccatccatccatccaccaac 199
              ||||||||||||||||||||||
Sbjct: 116329 atccatccatccatccaccaac 116308



to top

>gb|AC089999.20| Homo sapiens 12 BAC RP11-545P7 (Roswell Park Cancer Institute Human BAC
              Library) complete sequence
          Length = 199522

 Score = 44.1 bits (22), Expect = 0.18
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                        
Query: 56     cattcatccactcgttcattcattca 81
              ||||||| ||||||||||||||||||
Sbjct: 145694 cattcattcactcgttcattcattca 145719



to top

>gb|AC125050.6| Mus musculus BAC clone RP23-372I18 from chromosome 7, complete sequence
          Length = 199810

 Score = 44.1 bits (22), Expect = 0.18
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 178   atccatccatccatccaccaac 199
             ||||||||||||||||||||||
Sbjct: 36335 atccatccatccatccaccaac 36356



to top

>gb|AC121993.2| Mus musculus BAC clone RP24-301F19 from 3, complete sequence
          Length = 163385

 Score = 44.1 bits (22), Expect = 0.18
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                        
Query: 56     cattcatccactcgttcattcattca 81
              ||||||| ||||||||||||||||||
Sbjct: 121492 cattcattcactcgttcattcattca 121467



to top

>gb|AC146478.2| Pan troglodytes BAC clone CH251-409D17 from Y, complete sequence
          Length = 149556

 Score = 44.1 bits (22), Expect = 0.18
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 178   atccatccatccatccaccaac 199
             ||||||||||||||||||||||
Sbjct: 39483 atccatccatccatccaccaac 39504



to top

>gb|AC101490.8| Mus musculus chromosome 3, clone RP23-188O2, complete sequence
          Length = 247848

 Score = 44.1 bits (22), Expect = 0.18
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                       
Query: 178   atccatccatccatccaccaacatct 203
             ||||||||||||||||| ||||||||
Sbjct: 83214 atccatccatccatccagcaacatct 83239



to top

>emb|AL445199.37| Human DNA sequence from clone RP13-439H18 on chromosome 10 Contains the
             GPR123 gene for G protein-coupled receptor 123, a novel
             gene (containing KIAA1768, FLJ00378 and FLJ00252), gene
             FLJ25027, the UTF1 gene for undifferentiated embryonic
             cell transcription factor 1, the 5' end of the VENTX2 gene
             for VENT-like homeobox2, a novel gene, a 60S ribosomal
             protein L5 (RPL5) pseudogene and twenty five CpG islands,
             complete sequence
          Length = 212199

 Score = 44.1 bits (22), Expect = 0.18
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 178   atccatccatccatccaccaac 199
             ||||||||||||||||||||||
Sbjct: 35705 atccatccatccatccaccaac 35684



 Score = 44.1 bits (22), Expect = 0.18
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 178   atccatccatccatccaccaac 199
             ||||||||||||||||||||||
Sbjct: 35565 atccatccatccatccaccaac 35544



 Score = 44.1 bits (22), Expect = 0.18
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 178   atccatccatccatccaccaac 199
             ||||||||||||||||||||||
Sbjct: 35433 atccatccatccatccaccaac 35412



to top

>emb|BX908382.8| Human DNA sequence from clone WI2-87105E3 on chromosome X Contains the
             5' end of the CRLF2 gene for cytokine receptor-like factor
             2, complete sequence
          Length = 33657

 Score = 44.1 bits (22), Expect = 0.18
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 178   atccatccatccatccaccaac 199
             ||||||||||||||||||||||
Sbjct: 31461 atccatccatccatccaccaac 31440



to top

>emb|AL445532.8| Human DNA sequence from clone RP11-263K15 on chromosome 9 Contains the
             3' end of the NTRK2 gene for Neurotrophic tyrosine kinase,
             receptor, type 2 (TRKB), complete sequence
          Length = 171629

 Score = 44.1 bits (22), Expect = 0.18
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                       
Query: 56    cattcatccactcgttcattcattca 81
             ||||||||||| ||||||||||||||
Sbjct: 94690 cattcatccacccgttcattcattca 94665



to top

>gb|AC079199.9| Homo sapiens chromosome 17, clone RP11-94L15, complete sequence
          Length = 161815

 Score = 44.1 bits (22), Expect = 0.18
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                       
Query: 56    cattcatccactcgttcattcattca 81
             ||||||||||||| ||||||||||||
Sbjct: 48558 cattcatccactcattcattcattca 48583



to top

>gb|AC040933.12| Homo sapiens chromosome 17, clone CTD-2019C10, complete sequence
          Length = 168585

 Score = 44.1 bits (22), Expect = 0.18
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                       
Query: 56    cattcatccactcgttcattcattca 81
             ||||||||||||| ||||||||||||
Sbjct: 85886 cattcatccactcattcattcattca 85911



to top

>emb|AL136528.11| Human DNA sequence from clone RP5-1092A11 on chromosome 1p36.2-36.33
             Contains the 5' end of the gene for a novel protein
             (FLJ32825), a novel gene (KIAA0495), two novel genes, the
             TP73 gene for tumor protein p73, the 5' end of the WDR8
             gene for WD repeat domain 8 and five CpG islands, complete
             sequence
          Length = 138941

 Score = 44.1 bits (22), Expect = 0.18
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 178   atccatccatccatccaccaac 199
             ||||||||||||||||||||||
Sbjct: 42356 atccatccatccatccaccaac 42377



to top

>emb|AL080251.23|HSDJ93P18 Human DNA sequence from clone RP1-93P18 on chromosome 1p35.2-36.23
             Contains the 5' end of the ALDH4A1 gene for aldehyde
             dehydrogenase 4 family, member A1, a novel gene and a CpG
             island, complete sequence
          Length = 103216

 Score = 44.1 bits (22), Expect = 0.18
 Identities = 34/38 (89%)
 Strand = Plus / Plus

                                                   
Query: 55    ccattcatccactcgttcattcattcaactgttttcac 92
             |||||||| || || ||||||||||||| |||||||||
Sbjct: 73422 ccattcattcattcattcattcattcaaatgttttcac 73459



to top

>emb|AL035588.21|HS696P19 Human DNA sequence from clone RP4-696P19 on chromosome 6p12.3-21.2
             Contains the 3' end of the TFEB gene for transcription
             factor EB (TCFEB), a nucleophosmin (nucleolar
             phosphoprotein B23, numatrin) (NPM1) pseudogene, the MDFI
             gene for MyoD family inhibitor, the 5' end of a novel gene
             and two CpG islands, complete sequence
          Length = 110665

 Score = 44.1 bits (22), Expect = 0.18
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 178   atccatccatccatccaccaac 199
             ||||||||||||||||||||||
Sbjct: 22170 atccatccatccatccaccaac 22191



to top

>gb|AC148836.6| Pan troglodytes BAC clone CH251-2C8 from chromosome 7, complete
             sequence
          Length = 219717

 Score = 44.1 bits (22), Expect = 0.18
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 178   atccatccatccatccaccaac 199
             ||||||||||||||||||||||
Sbjct: 39674 atccatccatccatccaccaac 39653



to top

>gb|AC171134.2| Helobdella robusta clone CH306-1A5, complete sequence
          Length = 95814

 Score = 44.1 bits (22), Expect = 0.18
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                       
Query: 56    cattcatccactcgttcattcattca 81
             ||||||||||||| ||||||||||||
Sbjct: 92082 cattcatccactcattcattcattca 92057



to top

>emb|BX511261.12| Zebrafish DNA sequence from clone DKEYP-59G7 in linkage group 1, complete
              sequence
          Length = 185266

 Score = 44.1 bits (22), Expect = 0.18
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 177    gatccatccatccatccaccaa 198
              ||||||||||||||||||||||
Sbjct: 153133 gatccatccatccatccaccaa 153112



 Score = 42.1 bits (21), Expect = 0.72
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 178    atccatccatccatccaccaa 198
              |||||||||||||||||||||
Sbjct: 152956 atccatccatccatccaccaa 152936



 Score = 42.1 bits (21), Expect = 0.72
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 178    atccatccatccatccaccaa 198
              |||||||||||||||||||||
Sbjct: 152776 atccatccatccatccaccaa 152756



 Score = 42.1 bits (21), Expect = 0.72
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 178    atccatccatccatccaccaa 198
              |||||||||||||||||||||
Sbjct: 152608 atccatccatccatccaccaa 152588



 Score = 42.1 bits (21), Expect = 0.72
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 178    atccatccatccatccaccaa 198
              |||||||||||||||||||||
Sbjct: 152444 atccatccatccatccaccaa 152424



 Score = 42.1 bits (21), Expect = 0.72
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 178    atccatccatccatccaccaa 198
              |||||||||||||||||||||
Sbjct: 152028 atccatccatccatccaccaa 152008



to top

>emb|CR626867.6| Human DNA sequence from clone XX-HCC1954_8J23, complete sequence
          Length = 89963

 Score = 44.1 bits (22), Expect = 0.18
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                       
Query: 56    cattcatccactcgttcattcattca 81
             ||||||||||||| ||||||||||||
Sbjct: 46817 cattcatccactcattcattcattca 46842



to top

>emb|CR626880.9| Human DNA sequence from clone XX-HCC1954_11K06, complete sequence
          Length = 151284

 Score = 44.1 bits (22), Expect = 0.18
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                       
Query: 56    cattcatccactcgttcattcattca 81
             ||||||||||||| ||||||||||||
Sbjct: 74945 cattcatccactcattcattcattca 74970



to top

>gb|AC078903.11| Homo sapiens chromosome 17, clone RP11-1084K4, complete sequence
          Length = 95359

 Score = 44.1 bits (22), Expect = 0.18
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                      
Query: 56   cattcatccactcgttcattcattca 81
            ||||||| ||||||||||||||||||
Sbjct: 9602 cattcattcactcgttcattcattca 9627



to top

>emb|BX663524.6| Zebrafish DNA sequence from clone DKEY-97K15, complete sequence
          Length = 196030

 Score = 44.1 bits (22), Expect = 0.18
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 178   atccatccatccatccaccaac 199
             ||||||||||||||||||||||
Sbjct: 12695 atccatccatccatccaccaac 12674



to top

>dbj|BS000632.2| Pan troglodytes chromosome Y clone: PTB-399O20, complete sequence
          Length = 199770

 Score = 44.1 bits (22), Expect = 0.18
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 178   atccatccatccatccaccaac 199
             ||||||||||||||||||||||
Sbjct: 64182 atccatccatccatccaccaac 64203



to top

>gb|AC087491.5| Homo sapiens chromosome 17, clone RP11-62N23, complete sequence
          Length = 157216

 Score = 44.1 bits (22), Expect = 0.18
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                        
Query: 56     cattcatccactcgttcattcattca 81
              ||||||||||||| ||||||||||||
Sbjct: 134711 cattcatccactcattcattcattca 134736



to top

>emb|BX548247.6| Zebrafish DNA sequence from clone DKEY-177G18 in linkage group 23,
              complete sequence
          Length = 180406

 Score = 44.1 bits (22), Expect = 0.18
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 178    atccatccatccatccaccaac 199
              ||||||||||||||||||||||
Sbjct: 108017 atccatccatccatccaccaac 107996



to top

>gb|DP000054.1| Pan troglodytes chromosome Y, partial sequence
          Length = 23952694

 Score = 44.1 bits (22), Expect = 0.18
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                      
Query: 178      atccatccatccatccaccaac 199
                ||||||||||||||||||||||
Sbjct: 17658236 atccatccatccatccaccaac 17658215



to top

>gb|AC109580.14| Danio rerio strain AB clone busm1-183j13, complete sequence
          Length = 94348

 Score = 44.1 bits (22), Expect = 0.18
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 178   atccatccatccatccaccaac 199
             ||||||||||||||||||||||
Sbjct: 82413 atccatccatccatccaccaac 82434



to top

>emb|BX323839.13| Zebrafish DNA sequence from clone CH211-217K17 in linkage group 1,
              complete sequence
          Length = 155358

 Score = 44.1 bits (22), Expect = 0.18
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 178    atccatccatccatccaccaac 199
              ||||||||||||||||||||||
Sbjct: 118465 atccatccatccatccaccaac 118486



to top

>emb|BX247866.12| Zebrafish DNA sequence from clone DKEY-216J12 in linkage group 1,
              complete sequence
          Length = 197473

 Score = 44.1 bits (22), Expect = 0.18
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 177    gatccatccatccatccaccaa 198
              ||||||||||||||||||||||
Sbjct: 156910 gatccatccatccatccaccaa 156889



to top

>emb|BX649370.5| Zebrafish DNA sequence from clone DKEY-97I11 in linkage group 24,
              complete sequence
          Length = 167578

 Score = 44.1 bits (22), Expect = 0.18
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                        
Query: 56     cattcatccactcgttcattcattca 81
              ||||||| ||||||||||||||||||
Sbjct: 153794 cattcattcactcgttcattcattca 153769



to top

>emb|BX248082.11| Zebrafish DNA sequence from clone CH211-237B12 in linkage group 16,
              complete sequence
          Length = 152455

 Score = 44.1 bits (22), Expect = 0.18
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                        
Query: 56     cattcatccactcgttcattcattca 81
              ||||||| ||||||||||||||||||
Sbjct: 145590 cattcattcactcgttcattcattca 145565



to top

>dbj|AK090234.1| Mus musculus 16 days neonate male diencephalon cDNA, RIKEN
           full-length enriched library, clone:G630023A01
           product:unclassifiable, full insert sequence
          Length = 1920

 Score = 44.1 bits (22), Expect = 0.18
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 178 atccatccatccatccaccaac 199
           ||||||||||||||||||||||
Sbjct: 429 atccatccatccatccaccaac 450



to top

>emb|AL929518.16| Zebrafish DNA sequence from clone CH211-163F10 in linkage group 2,
              complete sequence
          Length = 162473

 Score = 44.1 bits (22), Expect = 0.18
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 178    atccatccatccatccaccaac 199
              ||||||||||||||||||||||
Sbjct: 144328 atccatccatccatccaccaac 144349



 Score = 44.1 bits (22), Expect = 0.18
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 178    atccatccatccatccaccaac 199
              ||||||||||||||||||||||
Sbjct: 144300 atccatccatccatccaccaac 144321



to top

>emb|AL929396.18| Zebrafish DNA sequence from clone CH211-93G23 in linkage group 1,
             complete sequence
          Length = 169067

 Score = 44.1 bits (22), Expect = 0.18
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 178   atccatccatccatccaccaac 199
             ||||||||||||||||||||||
Sbjct: 45185 atccatccatccatccaccaac 45164



to top

>gb|AC138028.1| Homo sapiens chromosome 16 clone RP5-1142A6, complete sequence
          Length = 127698

 Score = 44.1 bits (22), Expect = 0.18
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                           
Query: 53    atccattcatccactcgttcattcattcaa 82
             ||||||||||||| || |||||||||||||
Sbjct: 25793 atccattcatccattcattcattcattcaa 25764



to top

>gb|AC061992.11| Homo sapiens chromosome 17, clone RP11-806H10, complete sequence
          Length = 100190

 Score = 44.1 bits (22), Expect = 0.18
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                       
Query: 56    cattcatccactcgttcattcattca 81
             ||||||| ||||||||||||||||||
Sbjct: 14813 cattcattcactcgttcattcattca 14788



to top

>gb|AY208911.1| Homo sapiens v-erb-b2 erythroblastic leukemia viral oncogene homolog
            2, neuro/glioblastoma derived oncogene homolog (avian)
            (ERBB2) gene, complete cds
          Length = 30837

 Score = 44.1 bits (22), Expect = 0.18
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                      
Query: 56   cattcatccactcgttcattcattca 81
            ||||||||||||| ||||||||||||
Sbjct: 5222 cattcatccactcattcattcattca 5247



to top

>gb|AC122129.9| Homo sapiens chromosome 17, clone RP1-253P7, complete sequence
          Length = 159868

 Score = 44.1 bits (22), Expect = 0.18
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                     
Query: 56  cattcatccactcgttcattcattca 81
           ||||||| ||||||||||||||||||
Sbjct: 195 cattcattcactcgttcattcattca 170



to top

>dbj|AB096613.1| Homo sapiens DNA, 20kb-MKN7 rearranged sequence
          Length = 20271

 Score = 44.1 bits (22), Expect = 0.18
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                       
Query: 56    cattcatccactcgttcattcattca 81
             ||||||||||||| ||||||||||||
Sbjct: 18512 cattcatccactcattcattcattca 18537



to top

>dbj|AP000977.4| Homo sapiens genomic DNA, chromosome 11q, clone:RP11-730K11, complete
             sequence
          Length = 187080

 Score = 44.1 bits (22), Expect = 0.18
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                       
Query: 56    cattcatccactcgttcattcattca 81
             |||||||||| |||||||||||||||
Sbjct: 94044 cattcatccattcgttcattcattca 94019



to top

>emb|AL354000.7|HS253P07 Homo from PAC RP1-253P07 and  PAC RP1-281I13 (complete covert by PAC
              RP1-253P07), complete sequence
          Length = 159876

 Score = 44.1 bits (22), Expect = 0.18
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                        
Query: 56     cattcatccactcgttcattcattca 81
              ||||||| ||||||||||||||||||
Sbjct: 159681 cattcattcactcgttcattcattca 159706



to top

>gb|AC003663.1|AC003663 Homo sapiens chromosome 17, clone HCIT87G17, complete sequence
          Length = 132070

 Score = 44.1 bits (22), Expect = 0.18
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 178   atccatccatccatccaccaac 199
             ||||||||||||||||||||||
Sbjct: 28064 atccatccatccatccaccaac 28043



to top

>gb|AC136147.4| Mus musculus BAC clone RP23-18B3 from 8, complete sequence
          Length = 210916

 Score = 44.1 bits (22), Expect = 0.18
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                       
Query: 56    cattcatccactcgttcattcattca 81
             ||||||| ||||||||||||||||||
Sbjct: 42892 cattcattcactcgttcattcattca 42917



to top

>gb|AC150648.2| Mus musculus BAC clone RP23-235N5 from 7, complete sequence
          Length = 190414

 Score = 44.1 bits (22), Expect = 0.18
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 178    atccatccatccatccaccaac 199
              ||||||||||||||||||||||
Sbjct: 122158 atccatccatccatccaccaac 122179



to top

>gb|AC127288.4| Mus musculus BAC clone RP23-358J11 from 8, complete sequence
          Length = 210710

 Score = 44.1 bits (22), Expect = 0.18
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 178   atccatccatccatccaccaac 199
             ||||||||||||||||||||||
Sbjct: 55047 atccatccatccatccaccaac 55026



to top

>emb|AL954313.6| Zebrafish DNA sequence from clone CH211-257J20 in linkage group 11,
             complete sequence
          Length = 156381

 Score = 44.1 bits (22), Expect = 0.18
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 178   atccatccatccatccaccaac 199
             ||||||||||||||||||||||
Sbjct: 84666 atccatccatccatccaccaac 84645



 Score = 44.1 bits (22), Expect = 0.18
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 178   atccatccatccatccaccaac 199
             ||||||||||||||||||||||
Sbjct: 84626 atccatccatccatccaccaac 84605



 Score = 44.1 bits (22), Expect = 0.18
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 178   atccatccatccatccaccaac 199
             ||||||||||||||||||||||
Sbjct: 84245 atccatccatccatccaccaac 84224



to top

>gb|AC161433.5| Mus musculus chromosome 8, clone RP23-50F12, complete sequence
          Length = 253440

 Score = 44.1 bits (22), Expect = 0.18
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 178    atccatccatccatccaccaac 199
              ||||||||||||||||||||||
Sbjct: 190637 atccatccatccatccaccaac 190658



to top

>emb|AL672259.9| Mouse DNA sequence from clone RP23-169M4 on chromosome 2, complete
             sequence
          Length = 179832

 Score = 44.1 bits (22), Expect = 0.18
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 178   atccatccatccatccaccaac 199
             ||||||||||||||||||||||
Sbjct: 96402 atccatccatccatccaccaac 96423



to top

>emb|AL831790.3| Mouse DNA sequence from clone RP23-334I5 on chromosome 4, complete
              sequence
          Length = 206074

 Score = 44.1 bits (22), Expect = 0.18
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                        
Query: 56     cattcatccactcgttcattcattca 81
              |||||||||||| |||||||||||||
Sbjct: 133466 cattcatccactagttcattcattca 133441



 Score = 44.1 bits (22), Expect = 0.18
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                        
Query: 56     cattcatccactcgttcattcattca 81
              ||||||||||||| ||||||||||||
Sbjct: 133260 cattcatccactcattcattcattca 133235



 Score = 44.1 bits (22), Expect = 0.18
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                        
Query: 56     cattcatccactcgttcattcattca 81
              ||||||||||||| ||||||||||||
Sbjct: 133236 cattcatccactcattcattcattca 133211



to top

>dbj|AP003159.1| Homo sapiens genomic DNA, chromosome 1p36 clone:1024F16, complete
             sequence
          Length = 113733

 Score = 44.1 bits (22), Expect = 0.18
 Identities = 34/38 (89%)
 Strand = Plus / Plus

                                                   
Query: 55    ccattcatccactcgttcattcattcaactgttttcac 92
             |||||||| || || ||||||||||||| |||||||||
Sbjct: 74544 ccattcattcattcattcattcattcaaatgttttcac 74581



to top

>gb|AC153851.27| Mus musculus 6 BAC RP23-61N4 (Roswell Park Cancer Institute (C57BL/6J
             Female) Mouse BAC Library) complete sequence
          Length = 217854

 Score = 42.1 bits (21), Expect = 0.72
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 146   ctacatataacatacagagtc 166
             |||||||||||||||||||||
Sbjct: 52645 ctacatataacatacagagtc 52625



 Score = 42.1 bits (21), Expect = 0.72
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 146   ctacatataacatacagagtc 166
             |||||||||||||||||||||
Sbjct: 30498 ctacatataacatacagagtc 30518



to top

>gb|AY559433.1| Thielaviopsis basicola clone NG3/NG4 ISSR sequence
          Length = 439

 Score = 42.1 bits (21), Expect = 0.72
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 178 atccatccatccatccaccaa 198
           |||||||||||||||||||||
Sbjct: 130 atccatccatccatccaccaa 150



to top

>gb|AY169492.1| Oryza latifolia isolate 100914 clone 2 alcohol dehydrogenase II
           (adh2) gene, exons 3 through 7 and partial cds
          Length = 1648

 Score = 42.1 bits (21), Expect = 0.72
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 177 gatccatccatccatccacca 197
           |||||||||||||||||||||
Sbjct: 54  gatccatccatccatccacca 34



to top

>gb|AE000663.1|MMAE000663 Mus musculus TCR beta locus from bases 1 to 250611 (section 1 of 3) of
              the complete sequence
          Length = 250611

 Score = 42.1 bits (21), Expect = 0.72
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 146    ctacatataacatacagagtc 166
              |||||||||||||||||||||
Sbjct: 115437 ctacatataacatacagagtc 115417



 Score = 42.1 bits (21), Expect = 0.72
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 146   ctacatataacatacagagtc 166
             |||||||||||||||||||||
Sbjct: 93292 ctacatataacatacagagtc 93312



to top

>gb|U93895.1|MNU93895 Megaptera novaeangliae clone GAAT400 microsatellite sequence
          Length = 251

 Score = 42.1 bits (21), Expect = 0.72
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 53  atccattcatccactcgttcattcattca 81
           ||||||||||||| || ||||||||||||
Sbjct: 109 atccattcatccattcattcattcattca 137



to top

>gb|AC134553.5| Mus musculus BAC clone RP24-280H19 from chromosome 12, complete
             sequence
          Length = 168895

 Score = 42.1 bits (21), Expect = 0.72
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                          
Query: 53    atccattcatccactcgttcattcattca 81
             ||||||||||| |||| ||||||||||||
Sbjct: 13715 atccattcatctactcattcattcattca 13743



to top

>gb|AC114342.12| Mus musculus chromosome 5, clone RP24-143H14, complete sequence
          Length = 171509

 Score = 42.1 bits (21), Expect = 0.72
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 57    attcatccactcgttcattcattca 81
             |||||||||||| ||||||||||||
Sbjct: 61974 attcatccactcattcattcattca 61998



to top

>gb|AC161514.4| Mus musculus chromosome 7, clone RP23-378L12, complete sequence
          Length = 190426

 Score = 42.1 bits (21), Expect = 0.72
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 178  atccatccatccatccaccaa 198
            |||||||||||||||||||||
Sbjct: 5838 atccatccatccatccaccaa 5818



to top

>gb|AC010976.6| Homo sapiens BAC clone RP11-286H15 from 2, complete sequence
          Length = 204142

 Score = 42.1 bits (21), Expect = 0.72
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 178   atccatccatccatccaccaa 198
             |||||||||||||||||||||
Sbjct: 97618 atccatccatccatccaccaa 97638



to top

>gb|AC133648.3| Mus musculus BAC clone RP23-291B1 from chromosome 7, complete sequence
          Length = 207234

 Score = 42.1 bits (21), Expect = 0.72
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                           
Query: 53     atccattcatccactcgttcattcattca 81
              ||||||||||||| || ||||||||||||
Sbjct: 154798 atccattcatccattcattcattcattca 154826



to top

>gb|AY498860.1| Homo sapiens tumor necrosis factor receptor superfamily, member 8
           (TNFRSF8) gene, complete cds
          Length = 84102

 Score = 42.1 bits (21), Expect = 0.72
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 178 atccatccatccatccaccaa 198
           |||||||||||||||||||||
Sbjct: 748 atccatccatccatccaccaa 768



to top

>emb|BX927112.16| Zebrafish DNA sequence from clone DKEY-109M11 in linkage group 1,
              complete sequence
          Length = 131888

 Score = 42.1 bits (21), Expect = 0.72
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 178    atccatccatccatccaccaa 198
              |||||||||||||||||||||
Sbjct: 102816 atccatccatccatccaccaa 102836



to top

>emb|BX936415.10| Zebrafish DNA sequence from clone CH211-242N18 in linkage group 6,
              complete sequence
          Length = 176089

 Score = 42.1 bits (21), Expect = 0.72
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 179    tccatccatccatccaccaac 199
              |||||||||||||||||||||
Sbjct: 106702 tccatccatccatccaccaac 106682



to top

>emb|CR354562.12| Zebrafish DNA sequence from clone DKEY-25B23 in linkage group 23,
             complete sequence
          Length = 201764

 Score = 42.1 bits (21), Expect = 0.72
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 178   atccatccatccatccaccaa 198
             |||||||||||||||||||||
Sbjct: 70164 atccatccatccatccaccaa 70184



 Score = 40.1 bits (20), Expect = 2.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 178   atccatccatccatccacca 197
             ||||||||||||||||||||
Sbjct: 92495 atccatccatccatccacca 92476



to top

>gb|AC122058.4| Mus musculus BAC clone RP24-468G7 from chromosome 14, complete sequence
          Length = 143331

 Score = 42.1 bits (21), Expect = 0.72
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 178    atccatccatccatccaccaa 198
              |||||||||||||||||||||
Sbjct: 110960 atccatccatccatccaccaa 110980



to top

>gb|AC025778.8| Homo sapiens chromosome 16 clone CTD-2504F3, complete sequence
          Length = 208417

 Score = 42.1 bits (21), Expect = 0.72
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 178    atccatccatccatccaccaa 198
              |||||||||||||||||||||
Sbjct: 186867 atccatccatccatccaccaa 186887



to top

>gb|AC112998.15| Mus musculus chromosome 3, clone RP23-147E7, complete sequence
          Length = 203273

 Score = 42.1 bits (21), Expect = 0.72
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 57    attcatccactcgttcattcattca 81
             |||||||||||| ||||||||||||
Sbjct: 38868 attcatccactcattcattcattca 38844



to top

>gb|AC127567.4| Mus musculus BAC clone RP24-191P12 from chromosome 6, complete sequence
          Length = 185620

 Score = 42.1 bits (21), Expect = 0.72
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 178   atccatccatccatccaccaa 198
             |||||||||||||||||||||
Sbjct: 27891 atccatccatccatccaccaa 27911



to top

>gb|AC121930.3| Mus musculus BAC clone RP24-205C1 from chromosome 15, complete sequence
          Length = 148390

 Score = 42.1 bits (21), Expect = 0.72
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 178    atccatccatccatccaccaa 198
              |||||||||||||||||||||
Sbjct: 119013 atccatccatccatccaccaa 119033



to top

>gb|AC125229.3| Mus musculus BAC clone RP23-45P1 from 5, complete sequence
          Length = 167771

 Score = 42.1 bits (21), Expect = 0.72
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 178    atccatccatccatccaccaa 198
              |||||||||||||||||||||
Sbjct: 122547 atccatccatccatccaccaa 122527



to top

>emb|CR376783.22| Zebrafish DNA sequence from clone DKEY-41N20 in linkage group 13,
             complete sequence
          Length = 205064

 Score = 42.1 bits (21), Expect = 0.72
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 178   atccatccatccatccaccaa 198
             |||||||||||||||||||||
Sbjct: 11602 atccatccatccatccaccaa 11582



 Score = 42.1 bits (21), Expect = 0.72
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 178   atccatccatccatccaccaa 198
             |||||||||||||||||||||
Sbjct: 11103 atccatccatccatccaccaa 11083



to top

>emb|CR723510.1|CNS0GL7G Tetraodon nigroviridis full-length cDNA
          Length = 1150

 Score = 42.1 bits (21), Expect = 0.72
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 53  atccattcatccactcgttcattcattca 81
           |||| |||||||| |||||||||||||||
Sbjct: 953 atccgttcatccattcgttcattcattca 925



to top

>ref|XM_855601.1| PREDICTED: Canis familiaris similar to aquaporin 8, transcript
           variant 2 (LOC608036), mRNA
          Length = 1254

 Score = 42.1 bits (21), Expect = 0.72
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                    
Query: 56  cattcatccactcgttcattcattc 80
           ||||||| |||||||||||||||||
Sbjct: 251 cattcattcactcgttcattcattc 275



to top

>gb|AC108430.11| Mus musculus chromosome 14, clone RP23-166L19, complete sequence
          Length = 204251

 Score = 42.1 bits (21), Expect = 0.72
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 178    atccatccatccatccaccaa 198
              |||||||||||||||||||||
Sbjct: 191474 atccatccatccatccaccaa 191494



to top

>gb|AC004906.3| Homo sapiens PAC clone RP5-852O24 from 7, complete sequence
          Length = 97749

 Score = 42.1 bits (21), Expect = 0.72
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 178   atccatccatccatccaccaa 198
             |||||||||||||||||||||
Sbjct: 46123 atccatccatccatccaccaa 46103



to top

>emb|CR925794.8| Zebrafish DNA sequence from clone CH211-202A23 in linkage group 13,
             complete sequence
          Length = 132763

 Score = 42.1 bits (21), Expect = 0.72
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 178   atccatccatccatccaccaa 198
             |||||||||||||||||||||
Sbjct: 26534 atccatccatccatccaccaa 26554



to top

>emb|CR762417.10| Zebrafish DNA sequence from clone DKEY-229E7 in linkage group 5,
             complete sequence
          Length = 78646

 Score = 42.1 bits (21), Expect = 0.72
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 178   atccatccatccatccaccaa 198
             |||||||||||||||||||||
Sbjct: 76044 atccatccatccatccaccaa 76064



to top

>emb|Z85994.1|HS32I10 Human DNA sequence from clone RP1-32I10 on chromosome 22, complete
           sequence
          Length = 93312

 Score = 42.1 bits (21), Expect = 0.72
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 178 atccatccatccatccaccaa 198
           |||||||||||||||||||||
Sbjct: 689 atccatccatccatccaccaa 669



to top

>emb|AL929500.4| Human DNA sequence from clone CITF22-57B10 on chromosome 22, complete
            sequence
          Length = 8930

 Score = 42.1 bits (21), Expect = 0.72
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 178  atccatccatccatccaccaa 198
            |||||||||||||||||||||
Sbjct: 7619 atccatccatccatccaccaa 7599



to top

>emb|AL591386.19| Human DNA sequence from clone RP11-349K21 on chromosome 9, complete
             sequence
          Length = 69657

 Score = 42.1 bits (21), Expect = 0.72
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 178   atccatccatccatccaccaacatc 202
             |||||||||||||||||||| ||||
Sbjct: 44798 atccatccatccatccaccaccatc 44822



 Score = 42.1 bits (21), Expect = 0.72
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 178   atccatccatccatccaccaacatc 202
             |||||||||||||||||||| ||||
Sbjct: 44776 atccatccatccatccaccaccatc 44800



 Score = 42.1 bits (21), Expect = 0.72
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 178   atccatccatccatccaccaacatc 202
             |||||||||||||||||||| ||||
Sbjct: 44522 atccatccatccatccaccaccatc 44546



 Score = 42.1 bits (21), Expect = 0.72
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 178   atccatccatccatccaccaacatc 202
             |||||||||||||||||||| ||||
Sbjct: 44500 atccatccatccatccaccaccatc 44524



 Score = 42.1 bits (21), Expect = 0.72
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 178   atccatccatccatccaccaacatc 202
             |||||||||||||||||||| ||||
Sbjct: 44330 atccatccatccatccaccaccatc 44354



 Score = 42.1 bits (21), Expect = 0.72
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 178   atccatccatccatccaccaacatc 202
             |||||||||||||||||||| ||||
Sbjct: 44308 atccatccatccatccaccaccatc 44332



 Score = 42.1 bits (21), Expect = 0.72
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 178   atccatccatccatccaccaacatc 202
             |||||||||||||||||||| ||||
Sbjct: 44263 atccatccatccatccaccaccatc 44287



 Score = 40.1 bits (20), Expect = 2.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 178   atccatccatccatccacca 197
             ||||||||||||||||||||
Sbjct: 44582 atccatccatccatccacca 44601



 Score = 40.1 bits (20), Expect = 2.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 178   atccatccatccatccacca 197
             ||||||||||||||||||||
Sbjct: 44188 atccatccatccatccacca 44207



 Score = 40.1 bits (20), Expect = 2.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 178   atccatccatccatccacca 197
             ||||||||||||||||||||
Sbjct: 44154 atccatccatccatccacca 44173



 Score = 40.1 bits (20), Expect = 2.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 178   atccatccatccatccacca 197
             ||||||||||||||||||||
Sbjct: 44132 atccatccatccatccacca 44151



 Score = 40.1 bits (20), Expect = 2.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 178   atccatccatccatccacca 197
             ||||||||||||||||||||
Sbjct: 44110 atccatccatccatccacca 44129



 Score = 40.1 bits (20), Expect = 2.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 178   atccatccatccatccacca 197
             ||||||||||||||||||||
Sbjct: 43983 atccatccatccatccacca 44002



 Score = 40.1 bits (20), Expect = 2.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 178   atccatccatccatccacca 197
             ||||||||||||||||||||
Sbjct: 43621 atccatccatccatccacca 43640



to top

>emb|AL512424.14| Human DNA sequence from clone RP11-453E2 on chromosome 10 Contains the
             5' end of the SLIT1 gene for slit homolog 1 (Drosophila),
             a novel gene and a CpG island, complete sequence
          Length = 172510

 Score = 42.1 bits (21), Expect = 0.72
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 57    attcatccactcgttcattcattca 81
             ||||||||||| |||||||||||||
Sbjct: 10432 attcatccacttgttcattcattca 10408



to top

>emb|AL499625.4| Human DNA sequence from clone LA20-66F10 on chromosome 20 Contains
            part of the BPI gene for
            bactericidal/permeability-increasing protein and part of
            a novel gene, complete sequence
          Length = 12916

 Score = 42.1 bits (21), Expect = 0.72
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 178  atccatccatccatccaccaa 198
            |||||||||||||||||||||
Sbjct: 3095 atccatccatccatccaccaa 3075



to top

>emb|AL357835.11| Human DNA sequence from clone RP11-426M1 on chromosome 1 Contains the
             TNFRSF8 gene for tumor necrosis factor receptor
             superfamily member 8, a ribosomal protein L23a (RPL23A)
             pseudogene, the 5' end of the TNFRSF1B gene for tumor
             necrosis factor receptor superfamily member 1B and three
             CpG islands, complete sequence
          Length = 151498

 Score = 42.1 bits (21), Expect = 0.72
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 178   atccatccatccatccaccaa 198
             |||||||||||||||||||||
Sbjct: 16370 atccatccatccatccaccaa 16390



to top

>emb|AL121829.30|HSJ697K14 Human DNA sequence from clone RP4-697K14 on chromosome 20 Contains the
             C20orf148 gene for a novel tyrosine kinase, the PTK6 gene
             for protein tyrosine kinase 6, a novel gene, the EEF1A2
             gene for eukaryotic translation elongation factor 1 alpha
             2, the 5' end of the KCNQ2 gene for potassium
             voltage-gated channel (KQT-like subfamily member 2), the
             gene for peroxisomal proliferator-activated receptor A
             interacting complex 285 (PRIC285)(FLJ00244, KIAA1769), the
             C20orf149 gene, the gene for novel protein MGC5356
             (MGC5356), the gene for a novel protein (LOC200213), a
             novel gene and thirteen CpG islands, complete sequence
          Length = 113196

 Score = 42.1 bits (21), Expect = 0.72
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 178   atccatccatccatccaccaa 198
             |||||||||||||||||||||
Sbjct: 20788 atccatccatccatccaccaa 20768



to top

>emb|AL121756.14|HSDJ726C3 Human DNA sequence from clone RP4-726C3 on chromosome 20 Contains the
              C20orf185 gene for the possible ortholog of potential
              ligand_binding protein RYA3 (Rat), the C20orf186 gene for
              the possible ortholog of potential ligand_binding protein
              RY2G5 (Rat), the 5' end of the SPAG4L gene for sperm
              associated antigen 4-like, a novel gene, a FAM16AX (family
              with sequence similarity 16, member A, X-linked)
              pseudogene, the BPIL3 gene for
              bactericidal/permeability-increasing protein-like 3 and a
              CpG island, complete sequence
          Length = 129502

 Score = 42.1 bits (21), Expect = 0.72
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 178    atccatccatccatccaccaa 198
              |||||||||||||||||||||
Sbjct: 105528 atccatccatccatccaccaa 105548



to top

>emb|AL031984.13|HS173D1 Human DNA sequence from clone RP1-173D1 on chromosome 1p36.21-36.33
             Contains the 5' UTR of the gene for a novel protein
             (FLJ34970, FLJ20321) and a CpG island, complete sequence
          Length = 117338

 Score = 42.1 bits (21), Expect = 0.72
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                          
Query: 53    atccattcatccactcgttcattcattca 81
             ||||| |||| ||||||||||||||||||
Sbjct: 90240 atccactcattcactcgttcattcattca 90268



to top

>gb|AC163089.3| Mus musculus chromosome 5, clone RP23-346P15, complete sequence
          Length = 197826

 Score = 42.1 bits (21), Expect = 0.72
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                       
Query: 57     attcatccactcgttcattcattca 81
              |||||||||||| ||||||||||||
Sbjct: 143609 attcatccactcattcattcattca 143633



to top

>emb|AL008721.1|HS390C10 Human DNA sequence from clone CTA-390C10 on chromosome 22q11.21-12.1,
             complete sequence
          Length = 114231

 Score = 42.1 bits (21), Expect = 0.72
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 178   atccatccatccatccaccaa 198
             |||||||||||||||||||||
Sbjct: 71799 atccatccatccatccaccaa 71819



to top

>emb|X15400.1|DMGLASS Drosophila glass gene encoding a zinc finger protein
          Length = 9954

 Score = 42.1 bits (21), Expect = 0.72
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 177  gatccatccatccatccacca 197
            |||||||||||||||||||||
Sbjct: 3853 gatccatccatccatccacca 3833



to top

>emb|AL591174.13| Mouse DNA sequence from clone RP23-271B20 on chromosome 11, complete
             sequence
          Length = 205379

 Score = 42.1 bits (21), Expect = 0.72
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 178   atccatccatccatccaccaa 198
             |||||||||||||||||||||
Sbjct: 99954 atccatccatccatccaccaa 99974



to top

>emb|CR759869.14| Zebrafish DNA sequence from clone DKEY-238F11 in linkage group 13,
              complete sequence
          Length = 284763

 Score = 42.1 bits (21), Expect = 0.72
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 178    atccatccatccatccaccaa 198
              |||||||||||||||||||||
Sbjct: 239386 atccatccatccatccaccaa 239366



to top

>emb|CR405705.11| Zebrafish DNA sequence from clone DKEY-64E13 in linkage group 17,
             complete sequence
          Length = 155058

 Score = 42.1 bits (21), Expect = 0.72
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                          
Query: 53    atccattcatccactcgttcattcattca 81
             ||||||||||| | |||||||||||||||
Sbjct: 65671 atccattcatctattcgttcattcattca 65643



to top

>emb|CR925715.4| Zebrafish DNA sequence from clone CH211-212C11 in linkage group 14,
             complete sequence
          Length = 132743

 Score = 42.1 bits (21), Expect = 0.72
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 178   atccatccatccatccaccaa 198
             |||||||||||||||||||||
Sbjct: 26534 atccatccatccatccaccaa 26554



to top

>emb|AL645842.15| Mouse DNA sequence from clone RP23-20A9 on chromosome 11 Contains two
             novel genes and the 3' end of the Accn1 gene for neuronal
             amiloride-sensitive cation channel 1 (degenerin), complete
             sequence
          Length = 114190

 Score = 42.1 bits (21), Expect = 0.72
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 176   ggatccatccatccatccacc 196
             |||||||||||||||||||||
Sbjct: 95821 ggatccatccatccatccacc 95801



to top

>emb|CR847843.7| Zebrafish DNA sequence from clone RP71-50C18 in linkage group 14,
              complete sequence
          Length = 162935

 Score = 42.1 bits (21), Expect = 0.72
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                           
Query: 53     atccattcatccactcgttcattcattca 81
              ||||||||||||| || ||||||||||||
Sbjct: 120910 atccattcatccattcattcattcattca 120938



to top

>emb|AL954256.1| Pan troglodytes chromosome 22 clone PTB-129I16 map 22q22.3, complete
              sequence
          Length = 180777

 Score = 42.1 bits (21), Expect = 0.72
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 178    atccatccatccatccaccaa 198
              |||||||||||||||||||||
Sbjct: 106887 atccatccatccatccaccaa 106907



to top

>gb|AC090739.13| Homo sapiens chromosome 8, clone RP11-503E24, complete sequence
          Length = 189048

 Score = 42.1 bits (21), Expect = 0.72
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 57    attcatccactcgttcattcattca 81
             |||||||||||| ||||||||||||
Sbjct: 46512 attcatccactcattcattcattca 46536



to top

>gb|AC022239.16| Homo sapiens chromosome 8, clone RP11-148O21, complete sequence
          Length = 191630

 Score = 42.1 bits (21), Expect = 0.72
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 176   ggatccatccatccatccacc 196
             |||||||||||||||||||||
Sbjct: 94369 ggatccatccatccatccacc 94349



to top

>emb|BX511168.4| Zebrafish DNA sequence from clone DKEY-22F5 in linkage group 21,
             complete sequence
          Length = 263757

 Score = 42.1 bits (21), Expect = 0.72
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 178   atccatccatccatccaccaa 198
             |||||||||||||||||||||
Sbjct: 55458 atccatccatccatccaccaa 55438



to top

>emb|AL928995.19| Zebrafish DNA sequence from clone CH211-215M21 in linkage group 20
              Contains the gene for a novel protein similar to human
              tubulin tyrosine ligase-like family, member 2 (TTLL2),
              seven genes for novel proteins similar to vertebrate pim
              oncogene family, two genes for transposase, seven novel
              genes, the 5' end of a novel gene and a CpG island,
              complete sequence
          Length = 202735

 Score = 42.1 bits (21), Expect = 0.72
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 177    gatccatccatccatccacca 197
              |||||||||||||||||||||
Sbjct: 180441 gatccatccatccatccacca 180421



to top

>emb|AL672072.18| Zebrafish DNA sequence from clone BUSM1-55H21 Contains a CpG island,
             complete sequence
          Length = 100697

 Score = 42.1 bits (21), Expect = 0.72
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                          
Query: 53    atccattcatccactcgttcattcattca 81
             ||||||||||| | |||||||||||||||
Sbjct: 34008 atccattcatctattcgttcattcattca 33980



to top

>emb|BX323071.16| Zebrafish DNA sequence from clone DKEYP-51F12, complete sequence
          Length = 208116

 Score = 42.1 bits (21), Expect = 0.72
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 178    atccatccatccatccaccaa 198
              |||||||||||||||||||||
Sbjct: 172733 atccatccatccatccaccaa 172753



to top

>emb|BX649302.22| Zebrafish DNA sequence from clone CH211-248I6 in linkage group 12,
              complete sequence
          Length = 154089

 Score = 42.1 bits (21), Expect = 0.72
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 178    atccatccatccatccaccaa 198
              |||||||||||||||||||||
Sbjct: 119410 atccatccatccatccaccaa 119430



to top

>emb|CR361558.6| Zebrafish DNA sequence from clone DKEY-22K11 in linkage group 13,
              complete sequence
          Length = 204631

 Score = 42.1 bits (21), Expect = 0.72
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 178    atccatccatccatccaccaa 198
              |||||||||||||||||||||
Sbjct: 116664 atccatccatccatccaccaa 116644



to top

>emb|BX469911.9| Zebrafish DNA sequence from clone DKEY-13K9 in linkage group 5, complete
              sequence
          Length = 226730

 Score = 42.1 bits (21), Expect = 0.72
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                       
Query: 180    ccatccatccatccaccaacatcta 204
              ||||||||||||||||| |||||||
Sbjct: 148587 ccatccatccatccacccacatcta 148563



to top

>emb|BX470135.8| Zebrafish DNA sequence from clone RP71-15H20 in linkage group 8,
             complete sequence
          Length = 147292

 Score = 42.1 bits (21), Expect = 0.72
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                          
Query: 53    atccattcatccactcgttcattcattca 81
             ||||||||||||| |||||| ||||||||
Sbjct: 19510 atccattcatccattcgttcgttcattca 19482



to top

>gb|AE014177.1| Mus musculus piebald deletion region section 5 of 11 of the complete
              sequence
          Length = 400029

 Score = 42.1 bits (21), Expect = 0.72
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 178    atccatccatccatccaccaa 198
              |||||||||||||||||||||
Sbjct: 346121 atccatccatccatccaccaa 346141



to top

>gb|AC020912.6| Homo sapiens chromosome 19 clone CTD-2583G20, complete sequence
          Length = 163225

 Score = 42.1 bits (21), Expect = 0.72
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 178   atccatccatccatccaccaa 198
             |||||||||||||||||||||
Sbjct: 68875 atccatccatccatccaccaa 68855



to top

>gb|AC008735.9| Homo sapiens chromosome 19 clone CTD-2537I9, complete sequence
          Length = 223879

 Score = 42.1 bits (21), Expect = 0.72
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 178    atccatccatccatccaccaa 198
              |||||||||||||||||||||
Sbjct: 133794 atccatccatccatccaccaa 133774



to top

>gb|AC008742.9| Homo sapiens chromosome 19 clone CTD-2553C6, complete sequence
          Length = 194624

 Score = 42.1 bits (21), Expect = 0.72
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                           
Query: 53     atccattcatccactcgttcattcattca 81
              |||||||||| ||||||||||| ||||||
Sbjct: 139735 atccattcattcactcgttcatccattca 139763



to top

>emb|BX571718.9| Zebrafish DNA sequence from clone DKEYP-111A10 in linkage group 14,
             complete sequence
          Length = 168697

 Score = 42.1 bits (21), Expect = 0.72
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 178   atccatccatccatccaccaa 198
             |||||||||||||||||||||
Sbjct: 78843 atccatccatccatccaccaa 78823



to top

>gb|AC010063.7| Drosophila melanogaster 3L BAC RP98-16A3 (Roswell Park Cancer Institute
             Drosophila BAC Library) complete sequence
          Length = 194006

 Score = 42.1 bits (21), Expect = 0.72
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 56    cattcatccactcgttcattcattc 80
             |||||||||| ||||||||||||||
Sbjct: 92395 cattcatccattcgttcattcattc 92419



to top

>emb|BX908742.7| Zebrafish DNA sequence from clone DKEY-246G23 in linkage group 18,
             complete sequence
          Length = 232903

 Score = 42.1 bits (21), Expect = 0.72
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                          
Query: 53    atccattcatccactcgttcattcattca 81
             |||||||||||||| | ||||||||||||
Sbjct: 11381 atccattcatccacacattcattcattca 11353



to top

>emb|BX510305.5| Zebrafish DNA sequence from clone CH211-107P11 in linkage group 23,
              complete sequence
          Length = 156938

 Score = 42.1 bits (21), Expect = 0.72
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                           
Query: 53     atccattcatccactcgttcattcattca 81
              ||||||||||||| || ||||||||||||
Sbjct: 153579 atccattcatccattcattcattcattca 153607



to top

>gb|AC079955.9| Homo sapiens chromosome 10 clone RP11-134O16, complete sequence
          Length = 192042

 Score = 42.1 bits (21), Expect = 0.72
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 178   atccatccatccatccaccaa 198
             |||||||||||||||||||||
Sbjct: 69872 atccatccatccatccaccaa 69892



to top

>gb|AC023566.11| Homo sapiens chromosome 8, clone RP11-660D5, complete sequence
          Length = 184543

 Score = 42.1 bits (21), Expect = 0.72
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                          
Query: 53    atccattcatccactcgttcattcattca 81
             |||||||||| ||||| ||||||||||||
Sbjct: 14269 atccattcattcactcattcattcattca 14241



to top

>gb|AC069082.9| Homo sapiens chromosome 15, clone RP11-716C8, complete sequence
          Length = 163533

 Score = 42.1 bits (21), Expect = 0.72
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                           
Query: 60     catccactcgttcattcattcaactgttt 88
              ||||||||| |||||||||||| ||||||
Sbjct: 156122 catccactcattcattcattcatctgttt 156150



to top

>gb|AC099494.3| Homo sapiens chromosome 16 clone RP11-1102P22, complete sequence
          Length = 143557

 Score = 42.1 bits (21), Expect = 0.72
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 179   tccatccatccatccaccaac 199
             |||||||||||||||||||||
Sbjct: 76599 tccatccatccatccaccaac 76579



to top

>gb|AC090119.1|AC090119 Takifugu rubripes clone 242D16, complete sequence
          Length = 107344

 Score = 42.1 bits (21), Expect = 0.72
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 178  atccatccatccatccaccaa 198
            |||||||||||||||||||||
Sbjct: 5659 atccatccatccatccaccaa 5679



to top

>gb|AC011797.8| Homo sapiens, clone RP11-17L5, complete sequence
          Length = 158389

 Score = 42.1 bits (21), Expect = 0.72
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                          
Query: 60    catccactcgttcattcattcaactgttt 88
             ||||||||| |||||||||||| ||||||
Sbjct: 56791 catccactcattcattcattcatctgttt 56819



to top

>gb|AC016832.8| Homo sapiens, clone RP11-132E3, complete sequence
          Length = 184558

 Score = 42.1 bits (21), Expect = 0.72
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 58    ttcatccactcgttcattcattcaa 82
             ||||||||||| |||||||||||||
Sbjct: 94741 ttcatccactcattcattcattcaa 94717



to top

>emb|BX276178.15| Zebrafish DNA sequence from clone CH211-245G9, complete sequence
          Length = 150884

 Score = 42.1 bits (21), Expect = 0.72
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                          
Query: 53    atccattcatccactcgttcattcattca 81
             ||||||||||||| || ||||||||||||
Sbjct: 90778 atccattcatccattcattcattcattca 90750



to top

>emb|BX571973.15| Zebrafish DNA sequence from clone DKEY-254A11 in linkage group 22,
             complete sequence
          Length = 214325

 Score = 42.1 bits (21), Expect = 0.72
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 178   atccatccatccatccaccaa 198
             |||||||||||||||||||||
Sbjct: 44608 atccatccatccatccaccaa 44588



to top

>gb|AC008514.8| Homo sapiens chromosome 5 clone CTC-455F18, complete sequence
          Length = 172525

 Score = 42.1 bits (21), Expect = 0.72
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 178    atccatccatccatccaccaa 198
              |||||||||||||||||||||
Sbjct: 167437 atccatccatccatccaccaa 167457



to top

>gb|AC051619.7|AC051619 Homo sapiens chromosome 15 clone CTD-2651B20 map 15q21.1, complete
             sequence
          Length = 213999

 Score = 42.1 bits (21), Expect = 0.72
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                          
Query: 53    atccattcatccactcgttcattcattca 81
             |||||| ||||||||| ||||||||||||
Sbjct: 76809 atccatccatccactcattcattcattca 76837



to top

>gb|AC158806.4| Mus musculus 10 BAC RP24-89F13 (Roswell Park Cancer Institute (C57BL/6J
             Male) Mouse BAC Library) complete sequence
          Length = 227508

 Score = 42.1 bits (21), Expect = 0.72
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                          
Query: 53    atccattcatccactcgttcattcattca 81
             |||||| ||||||||| ||||||||||||
Sbjct: 73696 atccatccatccactcattcattcattca 73668



to top

>gb|AC139676.3| Homo sapiens chromosome 8, clone RP13-648O9, complete sequence
          Length = 166153

 Score = 42.1 bits (21), Expect = 0.72
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                          
Query: 53    atccattcatccactcgttcattcattca 81
             |||||| |||||| |||||||||||||||
Sbjct: 97527 atccatccatccattcgttcattcattca 97555



to top

>gb|AC119271.11| Mus musculus chromosome 7, clone RP24-373F15, complete sequence
          Length = 178814

 Score = 42.1 bits (21), Expect = 0.72
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 178   atccatccatccatccaccaa 198
             |||||||||||||||||||||
Sbjct: 31509 atccatccatccatccaccaa 31489



to top

>dbj|AB121692.1| Mus musculus peptidylarginine deiminase gene cluster (Padi2, Padi1,
             Padi23, Padi4, Padi6), complete cds
          Length = 240498

 Score = 42.1 bits (21), Expect = 0.72
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                          
Query: 53    atccattcatccactcgttcattcattca 81
             |||||||||| ||||| ||||||||||||
Sbjct: 44486 atccattcattcactcattcattcattca 44514



to top

>gb|AC093642.5| Homo sapiens BAC clone RP11-341N2 from 2, complete sequence
          Length = 158203

 Score = 42.1 bits (21), Expect = 0.72
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 178   atccatccatccatccaccaacatc 202
             |||||||||||||||||||| ||||
Sbjct: 29212 atccatccatccatccaccaccatc 29236



 Score = 40.1 bits (20), Expect = 2.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 178   atccatccatccatccacca 197
             ||||||||||||||||||||
Sbjct: 29276 atccatccatccatccacca 29295



 Score = 40.1 bits (20), Expect = 2.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 178   atccatccatccatccacca 197
             ||||||||||||||||||||
Sbjct: 29245 atccatccatccatccacca 29264



 Score = 40.1 bits (20), Expect = 2.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 178   atccatccatccatccacca 197
             ||||||||||||||||||||
Sbjct: 29168 atccatccatccatccacca 29187



 Score = 40.1 bits (20), Expect = 2.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 178   atccatccatccatccacca 197
             ||||||||||||||||||||
Sbjct: 29066 atccatccatccatccacca 29085



 Score = 40.1 bits (20), Expect = 2.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 178   atccatccatccatccacca 197
             ||||||||||||||||||||
Sbjct: 29039 atccatccatccatccacca 29058



 Score = 40.1 bits (20), Expect = 2.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 178   atccatccatccatccacca 197
             ||||||||||||||||||||
Sbjct: 29009 atccatccatccatccacca 29028



 Score = 40.1 bits (20), Expect = 2.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 178   atccatccatccatccacca 197
             ||||||||||||||||||||
Sbjct: 28853 atccatccatccatccacca 28872



 Score = 40.1 bits (20), Expect = 2.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 178   atccatccatccatccacca 197
             ||||||||||||||||||||
Sbjct: 28626 atccatccatccatccacca 28645



 Score = 40.1 bits (20), Expect = 2.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 178   atccatccatccatccacca 197
             ||||||||||||||||||||
Sbjct: 28519 atccatccatccatccacca 28538



 Score = 40.1 bits (20), Expect = 2.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 178   atccatccatccatccacca 197
             ||||||||||||||||||||
Sbjct: 28459 atccatccatccatccacca 28478



 Score = 40.1 bits (20), Expect = 2.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 178   atccatccatccatccacca 197
             ||||||||||||||||||||
Sbjct: 28316 atccatccatccatccacca 28335



to top

>gb|AC113186.6| Homo sapiens chromosome 8, clone RP11-941L11, complete sequence
          Length = 151000

 Score = 42.1 bits (21), Expect = 0.72
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                          
Query: 53    atccattcatccactcgttcattcattca 81
             |||||||||| ||||| ||||||||||||
Sbjct: 73804 atccattcattcactcattcattcattca 73776



to top

>gb|AC068418.5| Homo sapiens chromosome 17, clone RP11-728E14, complete sequence
          Length = 202992

 Score = 42.1 bits (21), Expect = 0.72
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                          
Query: 53    atccattcatccactcgttcattcattca 81
             |||||| ||||||||| ||||||||||||
Sbjct: 87575 atccatccatccactcattcattcattca 87547



to top

>gb|AC116910.11| Homo sapiens chromosome 17, clone CTD-2573C9, complete sequence
          Length = 149156

 Score = 42.1 bits (21), Expect = 0.72
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 178    atccatccatccatccaccaa 198
              |||||||||||||||||||||
Sbjct: 144179 atccatccatccatccaccaa 144199



 Score = 42.1 bits (21), Expect = 0.72
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 178    atccatccatccatccaccaa 198
              |||||||||||||||||||||
Sbjct: 144007 atccatccatccatccaccaa 144027



to top

>gb|AC068483.6| Homo sapiens BAC clone RP11-31G7 from 2, complete sequence
          Length = 157285

 Score = 42.1 bits (21), Expect = 0.72
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 178   atccatccatccatccaccaa 198
             |||||||||||||||||||||
Sbjct: 39238 atccatccatccatccaccaa 39258



to top

>gb|AC007406.1| Homo sapiens 12 BAC RPCI11-283I3 (Roswell Park Cancer Institute Human
             BAC Library) complete sequence
          Length = 177402

 Score = 42.1 bits (21), Expect = 0.72
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 54    tccattcatccactcgttcat 74
             |||||||||||||||||||||
Sbjct: 44359 tccattcatccactcgttcat 44339



to top

>emb|BX248117.9| Zebrafish DNA sequence from clone CH211-226D5, complete sequence
          Length = 181542

 Score = 42.1 bits (21), Expect = 0.72
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                          
Query: 53    atccattcatccactcgttcattcattca 81
             ||||||||||||| |||||||||| ||||
Sbjct: 13315 atccattcatccattcgttcattcgttca 13343



to top

>gb|AC124057.12| Homo sapiens chromosome 11, clone RP5-915F1, complete sequence
          Length = 155082

 Score = 42.1 bits (21), Expect = 0.72
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 178    atccatccatccatccaccaa 198
              |||||||||||||||||||||
Sbjct: 104392 atccatccatccatccaccaa 104372



to top

>gb|AC127521.11| Homo sapiens chromosome 17, clone RP13-580F15, complete sequence
          Length = 31450

 Score = 42.1 bits (21), Expect = 0.72
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 178   atccatccatccatccaccaa 198
             |||||||||||||||||||||
Sbjct: 31340 atccatccatccatccaccaa 31320



to top

>gb|AC010442.7| Homo sapiens chromosome 5 clone CTD-2228K2, complete sequence
          Length = 153197

 Score = 42.1 bits (21), Expect = 0.72
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 178   atccatccatccatccaccaa 198
             |||||||||||||||||||||
Sbjct: 75323 atccatccatccatccaccaa 75343



to top

>gb|AC119253.7| Mus musculus chromosome 15, clone RP24-279A15, complete sequence
          Length = 163503

 Score = 42.1 bits (21), Expect = 0.72
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 178    atccatccatccatccaccaa 198
              |||||||||||||||||||||
Sbjct: 141132 atccatccatccatccaccaa 141112



to top

>gb|AC167565.1| Mus musculus BAC clone RP24-84D8 from chromosome 14, complete sequence
          Length = 199101

 Score = 42.1 bits (21), Expect = 0.72
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                       
Query: 178    atccatccatccatccaccaacatc 202
              |||||||||||||||||||| ||||
Sbjct: 180778 atccatccatccatccaccaccatc 180802



to top

>emb|AL935034.18| Zebrafish DNA sequence from clone CH211-160A3 in linkage group 12,
             complete sequence
          Length = 171213

 Score = 42.1 bits (21), Expect = 0.72
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 178   atccatccatccatccaccaa 198
             |||||||||||||||||||||
Sbjct: 90537 atccatccatccatccaccaa 90517



 Score = 40.1 bits (20), Expect = 2.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 178    atccatccatccatccacca 197
              ||||||||||||||||||||
Sbjct: 139913 atccatccatccatccacca 139932



to top

>gb|AC152169.2| Mus musculus BAC clone RP23-79L13 from chromosome 14, complete sequence
          Length = 236748

 Score = 42.1 bits (21), Expect = 0.72
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                          
Query: 53    atccattcatccactcgttcattcattca 81
             |||||| ||||||||| ||||||||||||
Sbjct: 32850 atccatccatccactcattcattcattca 32878



to top

>emb|BX247882.6| Zebrafish DNA sequence from clone CH211-224P3 in linkage group 14,
              complete sequence
          Length = 196155

 Score = 42.1 bits (21), Expect = 0.72
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 178    atccatccatccatccaccaa 198
              |||||||||||||||||||||
Sbjct: 163996 atccatccatccatccaccaa 163976



to top

>emb|AL929074.5| Zebrafish DNA sequence from clone CH211-101B14, complete sequence
          Length = 165705

 Score = 42.1 bits (21), Expect = 0.72
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                           
Query: 53     atccattcatccactcgttcattcattca 81
              ||||||||||||| || ||||||||||||
Sbjct: 159968 atccattcatccattcattcattcattca 159940



to top

>gb|AF148621.1|AF148621 Oryza latifolia alcohol dehydrogenase II (Adh2) gene, exons 3
           through 7, partial cds
          Length = 1702

 Score = 42.1 bits (21), Expect = 0.72
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 177 gatccatccatccatccacca 197
           |||||||||||||||||||||
Sbjct: 58  gatccatccatccatccacca 38



to top

>gb|AF112229.1|HSCD30P2 Homo sapiens CD30 protein (CD30) gene, promoter, exon 1, and
           partial cds
          Length = 936

 Score = 42.1 bits (21), Expect = 0.72
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 178 atccatccatccatccaccaa 198
           |||||||||||||||||||||
Sbjct: 204 atccatccatccatccaccaa 224



to top

>emb|AJ311494.1|HSA311494 Homo sapiens polymorphic CD30 promoter from the human Hodgkin's
            lymphoma-derived cell line L540
          Length = 1612

 Score = 42.1 bits (21), Expect = 0.72
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 178  atccatccatccatccaccaa 198
            |||||||||||||||||||||
Sbjct: 1005 atccatccatccatccaccaa 1025



to top

>emb|AJ311493.1|HSA311493 Homo sapiens polymorphic CD30 promoter from the human Hodgkin's
            lymphoma-derived cell line L591
          Length = 1608

 Score = 42.1 bits (21), Expect = 0.72
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 178  atccatccatccatccaccaa 198
            |||||||||||||||||||||
Sbjct: 1001 atccatccatccatccaccaa 1021



to top

>emb|AJ311492.1|HSA311492 Homo sapiens polymorphic CD30 promoter of the anaplastic large cell
            lymphoma cell line SU-DHL1
          Length = 1605

 Score = 42.1 bits (21), Expect = 0.72
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 178  atccatccatccatccaccaa 198
            |||||||||||||||||||||
Sbjct: 998  atccatccatccatccaccaa 1018



to top

>emb|AJ311491.1|HSA311491 Homo sapiens polymorphic CD30 promoter of the anaplastic large cell
            lymphoma cell line DEL
          Length = 1596

 Score = 42.1 bits (21), Expect = 0.72
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 178  atccatccatccatccaccaa 198
            |||||||||||||||||||||
Sbjct: 989  atccatccatccatccaccaa 1009



to top

>emb|AJ311490.1|HSA311490 Homo sapiens polymorphic CD30 promoter from the human Hodgkin's
            lymphoma-derived cell line L428
          Length = 1596

 Score = 42.1 bits (21), Expect = 0.72
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 178  atccatccatccatccaccaa 198
            |||||||||||||||||||||
Sbjct: 989  atccatccatccatccaccaa 1009



to top

>emb|AJ311489.1|HSA311489 Homo sapiens polymorphic CD30 promoter from tonsillar tissue
          Length = 1329

 Score = 42.1 bits (21), Expect = 0.72
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 178 atccatccatccatccaccaa 198
           |||||||||||||||||||||
Sbjct: 722 atccatccatccatccaccaa 742



to top

>emb|AJ311488.1|HSA311488 Homo sapiens polymorphic CD30 promoter from Hodgkin's
           lymphoma-derived cell line L1236
          Length = 1177

 Score = 42.1 bits (21), Expect = 0.72
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 178 atccatccatccatccaccaa 198
           |||||||||||||||||||||
Sbjct: 570 atccatccatccatccaccaa 590



to top

>emb|AJ311487.1|HSA311487 Homo sapiens polymorphic CD30 promoter from pancreatic tissue
          Length = 1173

 Score = 42.1 bits (21), Expect = 0.72
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 178 atccatccatccatccaccaa 198
           |||||||||||||||||||||
Sbjct: 566 atccatccatccatccaccaa 586



to top

>emb|CR626902.14| Zebrafish DNA sequence from clone CH211-1F22 in linkage group 1, complete
              sequence
          Length = 130900

 Score = 42.1 bits (21), Expect = 0.72
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                           
Query: 53     atccattcatccactcgttcattcattca 81
              |||||||||| ||||| ||||||||||||
Sbjct: 129665 atccattcattcactcattcattcattca 129637



 Score = 40.1 bits (20), Expect = 2.8
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                          
Query: 53     atccattcatccactcgttcattcattc 80
              |||||||||| ||||| |||||||||||
Sbjct: 129785 atccattcattcactcattcattcattc 129758



to top

>emb|AJ308522.1|HSA308522 Homo sapiens partial CD30 gene, promoter region, isolate placenta
           No.1
          Length = 1054

 Score = 42.1 bits (21), Expect = 0.72
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 178 atccatccatccatccaccaa 198
           |||||||||||||||||||||
Sbjct: 447 atccatccatccatccaccaa 467



to top

>emb|AJ308521.1|HSA308521 Homo sapiens partial CD30 gene, promoter region, cell line Ho
          Length = 1050

 Score = 42.1 bits (21), Expect = 0.72
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 178 atccatccatccatccaccaa 198
           |||||||||||||||||||||
Sbjct: 443 atccatccatccatccaccaa 463



to top

>emb|AJ272029.1|HSA272029 Homo sapiens partial CD30 gene for cytokine receptor CD30 and
            promoter region
          Length = 6518

 Score = 42.1 bits (21), Expect = 0.72
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 178  atccatccatccatccaccaa 198
            |||||||||||||||||||||
Sbjct: 2523 atccatccatccatccaccaa 2543



to top

>emb|AL163302.2|HS21C102 Homo sapiens chromosome 21 segment HS21C102
          Length = 340000

 Score = 42.1 bits (21), Expect = 0.72
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 178   atccatccatccatccaccaa 198
             |||||||||||||||||||||
Sbjct: 10653 atccatccatccatccaccaa 10673



to top

>gb|AC151910.4| Mus musculus BAC clone RP23-67A17 from 14, complete sequence
          Length = 207254

 Score = 42.1 bits (21), Expect = 0.72
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 178   atccatccatccatccaccaa 198
             |||||||||||||||||||||
Sbjct: 46386 atccatccatccatccaccaa 46406



to top

>emb|CR759910.13| Zebrafish DNA sequence from clone DKEYP-79C4 in linkage group 19,
             complete sequence
          Length = 217814

 Score = 42.1 bits (21), Expect = 0.72
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 178   atccatccatccatccaccaa 198
             |||||||||||||||||||||
Sbjct: 67993 atccatccatccatccaccaa 67973



to top

>emb|CR628326.8| Zebrafish DNA sequence from clone CH211-247N12 in linkage group 19,
             complete sequence
          Length = 146234

 Score = 42.1 bits (21), Expect = 0.72
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                          
Query: 53    atccattcatccactcgttcattcattca 81
             ||||||||||||| || ||||||||||||
Sbjct: 40994 atccattcatccattcattcattcattca 40966



to top

>gb|AC154412.3| Mus musculus BAC clone RP24-225G4 from 14, complete sequence
          Length = 182048

 Score = 42.1 bits (21), Expect = 0.72
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 178   atccatccatccatccaccaacatc 202
             |||||||||||||||||||| ||||
Sbjct: 34472 atccatccatccatccaccaccatc 34496



to top

>emb|BX927293.15| Zebrafish DNA sequence from clone DKEY-95H12 in linkage group 18,
              complete sequence
          Length = 150229

 Score = 42.1 bits (21), Expect = 0.72
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 178    atccatccatccatccaccaa 198
              |||||||||||||||||||||
Sbjct: 139517 atccatccatccatccaccaa 139537



to top

>emb|CR381614.10| Zebrafish DNA sequence from clone DKEY-72G4 in linkage group 20,
            complete sequence
          Length = 153083

 Score = 42.1 bits (21), Expect = 0.72
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                     
Query: 178  atccatccatccatccaccaacatc 202
            |||||||||||||||||||| ||||
Sbjct: 7224 atccatccatccatccaccatcatc 7248



to top

>emb|BX649423.7| Zebrafish DNA sequence from clone DKEY-18O7 in linkage group 4, complete
              sequence
          Length = 182374

 Score = 42.1 bits (21), Expect = 0.72
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 178    atccatccatccatccaccaa 198
              |||||||||||||||||||||
Sbjct: 116230 atccatccatccatccaccaa 116250



 Score = 42.1 bits (21), Expect = 0.72
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 178    atccatccatccatccaccaa 198
              |||||||||||||||||||||
Sbjct: 115854 atccatccatccatccaccaa 115874



 Score = 40.1 bits (20), Expect = 2.8
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 178   atccatccatccatccaccaacat 201
             ||||||||||||||||||| ||||
Sbjct: 28418 atccatccatccatccacctacat 28441



to top

>emb|AL672171.8| Zebrafish DNA sequence from clone BUSM1-270G24 in linkage group 3
             Contains a CpG island, complete sequence
          Length = 114103

 Score = 42.1 bits (21), Expect = 0.72
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                          
Query: 53    atccattcatccactcgttcattcattca 81
             ||||||||||| | |||||||||||||||
Sbjct: 36345 atccattcatctattcgttcattcattca 36317



to top

>gb|AC007228.1|AC007228 Homo sapiens chromosome 19, BAC 37295 (CIT-B-21A4), complete sequence
          Length = 130067

 Score = 42.1 bits (21), Expect = 0.72
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 57    attcatccactcgttcattcattca 81
             |||||||||||| ||||||||||||
Sbjct: 92654 attcatccactcattcattcattca 92630



to top

>gb|AE003473.3| Drosophila melanogaster chromosome 3L, section 7 of 83 of the complete
              sequence
          Length = 315108

 Score = 42.1 bits (21), Expect = 0.72
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                       
Query: 56     cattcatccactcgttcattcattc 80
              |||||||||| ||||||||||||||
Sbjct: 139500 cattcatccattcgttcattcattc 139476



to top

>emb|CR354589.19| Zebrafish DNA sequence from clone CH211-93L13 in linkage group 17,
             complete sequence
          Length = 114273

 Score = 42.1 bits (21), Expect = 0.72
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                          
Query: 53    atccattcatccactcgttcattcattca 81
             ||||||||||||| || ||||||||||||
Sbjct: 70865 atccattcatccattcattcattcattca 70893



to top

>dbj|AP001786.4| Homo sapiens genomic DNA, chromosome 11q, clone:RP11-176J24, complete
              sequences
          Length = 171744

 Score = 42.1 bits (21), Expect = 0.72
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 178    atccatccatccatccaccaa 198
              |||||||||||||||||||||
Sbjct: 143818 atccatccatccatccaccaa 143798



to top

>gb|AC119183.8| Mus musculus chromosome 15, clone RP24-172H2, complete sequence
          Length = 144236

 Score = 42.1 bits (21), Expect = 0.72
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 178  atccatccatccatccaccaa 198
            |||||||||||||||||||||
Sbjct: 3444 atccatccatccatccaccaa 3424



to top

>emb|AL837509.11| Mouse DNA sequence from clone RP23-44L6 on chromosome 2, complete
             sequence
          Length = 156698

 Score = 42.1 bits (21), Expect = 0.72
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 178   atccatccatccatccaccaa 198
             |||||||||||||||||||||
Sbjct: 74418 atccatccatccatccaccaa 74438



to top

>gb|AC003693.1|AC003693 Human Chromosome 11p15.5 PAC clone pDJ915f1 containing KvLQT1 gene,
             complete sequence
          Length = 155074

 Score = 42.1 bits (21), Expect = 0.72
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 178   atccatccatccatccaccaa 198
             |||||||||||||||||||||
Sbjct: 50687 atccatccatccatccaccaa 50707



to top

>dbj|AP002849.2| Homo sapiens genomic DNA, chromosome 8q23, clone: KB1495A5
          Length = 205990

 Score = 42.1 bits (21), Expect = 0.72
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                       
Query: 58     ttcatccactcgttcattcattcaa 82
              ||||||||||| |||||||||||||
Sbjct: 123375 ttcatccactcattcattcattcaa 123399



to top

>emb|AL691450.15| Mouse DNA sequence from clone RP23-20F9 on chromosome 2, complete
             sequence
          Length = 181372

 Score = 42.1 bits (21), Expect = 0.72
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 178   atccatccatccatccaccaa 198
             |||||||||||||||||||||
Sbjct: 25432 atccatccatccatccaccaa 25452



to top

>emb|BX322557.1|HS112E20 Homo sapiens chromosome 21 from PAC RP1-112E20 map 21q22.3 region
             D21S171-LA161, complete sequence
          Length = 124074

 Score = 42.1 bits (21), Expect = 0.72
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 178   atccatccatccatccaccaa 198
             |||||||||||||||||||||
Sbjct: 77870 atccatccatccatccaccaa 77890



to top

>gb|AC140449.3| Mus musculus BAC clone RP24-116C1 from 9, complete sequence
          Length = 222299

 Score = 42.1 bits (21), Expect = 0.72
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 178    atccatccatccatccaccaa 198
              |||||||||||||||||||||
Sbjct: 174212 atccatccatccatccaccaa 174232



 Score = 42.1 bits (21), Expect = 0.72
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 178    atccatccatccatccaccaa 198
              |||||||||||||||||||||
Sbjct: 174188 atccatccatccatccaccaa 174208



to top

>gb|AC140110.2| Mus musculus BAC clone RP23-29H6 from 6, complete sequence
          Length = 214089

 Score = 42.1 bits (21), Expect = 0.72
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 178   atccatccatccatccaccaa 198
             |||||||||||||||||||||
Sbjct: 10202 atccatccatccatccaccaa 10182



to top

>gb|AC147230.3| Mus musculus BAC clone RP23-239N12 from 15, complete sequence
          Length = 255976

 Score = 42.1 bits (21), Expect = 0.72
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 178   atccatccatccatccaccaa 198
             |||||||||||||||||||||
Sbjct: 69152 atccatccatccatccaccaa 69132



to top

>gb|AC145303.4| Mus musculus BAC clone RP23-411P20 from 14, complete sequence
          Length = 190168

 Score = 42.1 bits (21), Expect = 0.72
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 178   atccatccatccatccaccaa 198
             |||||||||||||||||||||
Sbjct: 31224 atccatccatccatccaccaa 31204



to top

>emb|CT025537.7| Mouse DNA sequence from clone RP23-454O17 on chromosome 14, complete
              sequence
          Length = 192695

 Score = 42.1 bits (21), Expect = 0.72
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 178    atccatccatccatccaccaa 198
              |||||||||||||||||||||
Sbjct: 175296 atccatccatccatccaccaa 175316



to top

>gb|AC113144.11| Homo sapiens chromosome 17, clone RP11-45G12, complete sequence
          Length = 149288

 Score = 42.1 bits (21), Expect = 0.72
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                           
Query: 53     atccattcatccactcgttcattcattca 81
              |||||| ||||||||| ||||||||||||
Sbjct: 134120 atccatccatccactcattcattcattca 134148



to top

>dbj|AP003071.3| Homo sapiens genomic DNA, chromosome 11 clone:RP11-554A11, complete
             sequence
          Length = 191898

 Score = 42.1 bits (21), Expect = 0.72
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 178   atccatccatccatccaccaa 198
             |||||||||||||||||||||
Sbjct: 31324 atccatccatccatccaccaa 31344



 Score = 42.1 bits (21), Expect = 0.72
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 178   atccatccatccatccaccaa 198
             |||||||||||||||||||||
Sbjct: 31232 atccatccatccatccaccaa 31252



 Score = 42.1 bits (21), Expect = 0.72
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 178   atccatccatccatccaccaa 198
             |||||||||||||||||||||
Sbjct: 31144 atccatccatccatccaccaa 31164



to top

>emb|AL772189.7| Zebrafish DNA sequence from clone CH211-135B6 in linkage group 17,
             complete sequence
          Length = 183958

 Score = 42.1 bits (21), Expect = 0.72
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 68    cgttcattcattcaactgttt 88
             |||||||||||||||||||||
Sbjct: 51402 cgttcattcattcaactgttt 51422



to top

>emb|AL807805.7| Mouse DNA sequence from clone RP23-48K5 on chromosome 4, complete
              sequence
          Length = 183495

 Score = 42.1 bits (21), Expect = 0.72
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                           
Query: 53     atccattcatccactcgttcattcattca 81
              |||||||||| ||||| ||||||||||||
Sbjct: 181251 atccattcattcactcattcattcattca 181223



to top

>emb|AJ289159.1|HSA289159 Homo sapiens CD30 gene for cytokine receptor CD30, exons 1-8
          Length = 24538

 Score = 42.1 bits (21), Expect = 0.72
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 178  atccatccatccatccaccaa 198
            |||||||||||||||||||||
Sbjct: 2523 atccatccatccatccaccaa 2543



to top

>emb|AL359681.5|CNS05TEZ Human chromosome 14 DNA sequence BAC C-2348N10 of library CalTech-D
             from chromosome 14 of Homo sapiens (Human), complete
             sequence
          Length = 104782

 Score = 42.1 bits (21), Expect = 0.72
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                          
Query: 53    atccattcatccactcgttcattcattca 81
             |||||||||| ||||| ||||||||||||
Sbjct: 49066 atccattcattcactcattcattcattca 49038



to top

>gb|AC161768.25| Mus musculus 6 BAC RP23-37C14 (Roswell Park Cancer Institute (C57BL/6J
              Female) Mouse BAC Library) complete sequence
          Length = 196068

 Score = 42.1 bits (21), Expect = 0.72
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 146    ctacatataacatacagagtc 166
              |||||||||||||||||||||
Sbjct: 149494 ctacatataacatacagagtc 149474



 Score = 42.1 bits (21), Expect = 0.72
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 146    ctacatataacatacagagtc 166
              |||||||||||||||||||||
Sbjct: 127347 ctacatataacatacagagtc 127367



to top

>gb|AC151981.3| Mus musculus BAC clone RP24-66K3 from chromosome 12, complete sequence
          Length = 185710

 Score = 42.1 bits (21), Expect = 0.72
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                          
Query: 53    atccattcatccactcgttcattcattca 81
             ||||||||||| |||| ||||||||||||
Sbjct: 68254 atccattcatctactcattcattcattca 68226



to top

>emb|AJ409012.1|HSA409012 Homo sapiens CD30 gene, promoter region, individual no.3
          Length = 1345

 Score = 42.1 bits (21), Expect = 0.72
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 178 atccatccatccatccaccaa 198
           |||||||||||||||||||||
Sbjct: 738 atccatccatccatccaccaa 758



to top

>emb|AJ409011.1|HSA409011 Homo sapiens CD30 gene, promoter region, individual no.2
          Length = 1165

 Score = 42.1 bits (21), Expect = 0.72
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 178 atccatccatccatccaccaa 198
           |||||||||||||||||||||
Sbjct: 558 atccatccatccatccaccaa 578



to top

>gb|AC151754.1| Ornithorhynchus anatinus chromosome UNK clone OABb-469A1, complete
             sequence
          Length = 138437

 Score = 40.1 bits (20), Expect = 2.8
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                                 
Query: 56    cattcatccactcgttcattcattcaactgttttca 91
             ||||||| || || ||||||||||||||||| ||||
Sbjct: 77360 cattcattcattcattcattcattcaactgtattca 77325



to top

>gb|AC167973.4| Mus musculus BAC clone RP23-453B4 from chromosome 9, complete sequence
          Length = 182190

 Score = 40.1 bits (20), Expect = 2.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 178    atccatccatccatccacca 197
              ||||||||||||||||||||
Sbjct: 117751 atccatccatccatccacca 117770



to top

>gb|DQ223119.1| Alasmidonta heterodon microsatellite AheB121 sequence
          Length = 375

 Score = 40.1 bits (20), Expect = 2.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 178 atccatccatccatccacca 197
           ||||||||||||||||||||
Sbjct: 83  atccatccatccatccacca 64



to top

>ref|NM_189851.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 228

 Score = 40.1 bits (20), Expect = 2.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 177 gatccatccatccatccacc 196
           ||||||||||||||||||||
Sbjct: 151 gatccatccatccatccacc 132



to top

>gb|AC147651.4| Homo sapiens BAC clone RP13-689E11 from 7, complete sequence
          Length = 162139

 Score = 40.1 bits (20), Expect = 2.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 177   gatccatccatccatccacc 196
             ||||||||||||||||||||
Sbjct: 11211 gatccatccatccatccacc 11192



to top

>gb|AC104882.30| Mus musculus chromosome 8, clone RP23-401L9, complete sequence
          Length = 209525

 Score = 40.1 bits (20), Expect = 2.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 179    tccatccatccatccaccaa 198
              ||||||||||||||||||||
Sbjct: 133582 tccatccatccatccaccaa 133563



to top

>gb|AF377947.3| Oryza sativa (japonica cultivar-group) chromosome 3, BAC clone
              OSJNBa0032E21, complete sequence
          Length = 137580

 Score = 40.1 bits (20), Expect = 2.8
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 169    caggcacggatccatccatccatc 192
              |||||||| |||||||||||||||
Sbjct: 135221 caggcacgcatccatccatccatc 135244



to top

>gb|AC123993.10| Mus musculus chromosome 3, clone RP24-357L20, complete sequence
          Length = 187115

 Score = 40.1 bits (20), Expect = 2.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 178   atccatccatccatccacca 197
             ||||||||||||||||||||
Sbjct: 86283 atccatccatccatccacca 86264



to top

>gb|CP000069.1| Trypanosoma brucei chromosome 6, complete sequence
          Length = 1618915

 Score = 40.1 bits (20), Expect = 2.8
 Identities = 32/36 (88%)
 Strand = Plus / Plus

                                                   
Query: 53      atccattcatccactcgttcattcattcaactgttt 88
               |||| |||||||| || |||||||||||| ||||||
Sbjct: 1025792 atccgttcatccattcattcattcattcacctgttt 1025827



to top

>gb|AC074258.6| Trypanosoma brucei chromosome 6 clone RPCI93-2N9, complete sequence
          Length = 148326

 Score = 40.1 bits (20), Expect = 2.8
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                                 
Query: 53    atccattcatccactcgttcattcattcaactgttt 88
             |||| |||||||| || |||||||||||| ||||||
Sbjct: 60561 atccgttcatccattcattcattcattcacctgttt 60526



to top

>gb|AC124985.16| Mus musculus chromosome 8, clone RP24-230O22, complete sequence
          Length = 171213

 Score = 40.1 bits (20), Expect = 2.8
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                              
Query: 50     atgatccattcatccactcgttcattcattca 81
              ||||| |||||||||| || ||||||||||||
Sbjct: 157160 atgattcattcatccattcattcattcattca 157191



to top

>gb|AC149676.2| Bos taurus  BAC CH240-43C16 (Children's Hospital Oakland Research
             Institute Bovine BAC Library (male)) complete sequence
          Length = 168416

 Score = 40.1 bits (20), Expect = 2.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 70    ttcattcattcaactgtttt 89
             ||||||||||||||||||||
Sbjct: 58377 ttcattcattcaactgtttt 58358



to top

>gb|AC118676.6| Mus musculus chromosome 7, clone RP24-178N18, complete sequence
          Length = 149930

 Score = 40.1 bits (20), Expect = 2.8
 Identities = 27/28 (96%), Gaps = 1/28 (3%)
 Strand = Plus / Minus

                                         
Query: 178   atccatccatccatcca-ccaacatcta 204
             ||||||||||||||||| ||||||||||
Sbjct: 97827 atccatccatccatccatccaacatcta 97800



to top

>gb|AC150881.4| Bos taurus  BAC CH240-354J15 (Children's Hospital Oakland Research
              Institute Bovine BAC Library (male)) complete sequence
          Length = 174996

 Score = 40.1 bits (20), Expect = 2.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 70     ttcattcattcaactgtttt 89
              ||||||||||||||||||||
Sbjct: 146450 ttcattcattcaactgtttt 146431



to top

>gb|AY676260.1| Acropora palmata strain ApPRs2 clone f6 18S ribosomal RNA gene,
           internal transcribed spacer 1, 5.8S ribosomal RNA gene,
           internal transcribed spacer 2, and 28S ribosomal RNA
           gene, complete sequence
          Length = 705

 Score = 40.1 bits (20), Expect = 2.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 174 acggatccatccatccatcc 193
           ||||||||||||||||||||
Sbjct: 138 acggatccatccatccatcc 157



to top

>gb|AC118318.7| Rattus norvegicus 7 BAC CH230-15G17 (Children's Hospital Oakland Research
              Institute) complete sequence
          Length = 128601

 Score = 40.1 bits (20), Expect = 2.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 178    atccatccatccatccacca 197
              ||||||||||||||||||||
Sbjct: 117747 atccatccatccatccacca 117728



to top

>gb|AC012376.12| Drosophila melanogaster clone BACR48C12, complete sequence
          Length = 183048

 Score = 40.1 bits (20), Expect = 2.8
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 66     ctcgttcattcattcaactgtttt 89
              |||||| |||||||||||||||||
Sbjct: 159074 ctcgtttattcattcaactgtttt 159097



to top

>gb|AC116393.10| Mus musculus chromosome 15, clone RP23-94I16, complete sequence
          Length = 217156

 Score = 40.1 bits (20), Expect = 2.8
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                          
Query: 54     tccattcatccactcgttcattcattca 81
              ||||||||| |||||| |||||||||||
Sbjct: 142632 tccattcattcactcgctcattcattca 142605



to top

>gb|AC166334.8| Mus musculus chromosome 7, clone RP23-470P9, complete sequence
          Length = 171861

 Score = 40.1 bits (20), Expect = 2.8
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                          
Query: 54     tccattcatccactcgttcattcattca 81
              ||||||||||||| | ||||||||||||
Sbjct: 104748 tccattcatccacccattcattcattca 104775



to top

>gb|AC116705.11| Mus musculus chromosome 5, clone RP23-26P10, complete sequence
          Length = 213155

 Score = 40.1 bits (20), Expect = 2.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 178    atccatccatccatccacca 197
              ||||||||||||||||||||
Sbjct: 151934 atccatccatccatccacca 151915



to top

>gb|AC137594.2| Oryza sativa (japonica cultivar-group) chromosome 9 BAC clone
             OSJNBa0065A15, complete sequence
          Length = 168806

 Score = 40.1 bits (20), Expect = 2.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 177   gatccatccatccatccacc 196
             ||||||||||||||||||||
Sbjct: 66693 gatccatccatccatccacc 66674



to top

>gb|AC104709.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone OJ1214_E03,
             complete sequence
          Length = 144601

 Score = 40.1 bits (20), Expect = 2.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 177   gatccatccatccatccacc 196
             ||||||||||||||||||||
Sbjct: 41930 gatccatccatccatccacc 41949



to top

>gb|AC068459.9| Mus musculus chromosome 12, clone RP23-158M23, complete sequence
          Length = 198494

 Score = 40.1 bits (20), Expect = 2.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 178    atccatccatccatccacca 197
              ||||||||||||||||||||
Sbjct: 146985 atccatccatccatccacca 146966



to top

>gb|AC129576.11| Mus musculus chromosome 10, clone RP24-343D9, complete sequence
          Length = 136276

 Score = 40.1 bits (20), Expect = 2.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 178   atccatccatccatccacca 197
             ||||||||||||||||||||
Sbjct: 65557 atccatccatccatccacca 65576



to top

>gb|AC147320.2| Pan troglodytes BAC clone RP43-44E12 from 7, complete sequence
          Length = 141313

 Score = 40.1 bits (20), Expect = 2.8
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                            
Query: 50   atgatccattcatccactcgttcattcattca 81
            ||||| ||||||| ||||| ||||||||||||
Sbjct: 1876 atgattcattcattcactctttcattcattca 1907



to top

>gb|AC147502.2| Mus musculus BAC clone RP23-111N9 from chromosome 7, complete sequence
          Length = 202934

 Score = 40.1 bits (20), Expect = 2.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 178    atccatccatccatccacca 197
              ||||||||||||||||||||
Sbjct: 185345 atccatccatccatccacca 185364



to top

>gb|AC147026.2| Mus musculus BAC clone RP23-249A22 from chromosome 19, complete
             sequence
          Length = 190038

 Score = 40.1 bits (20), Expect = 2.8
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                         
Query: 56    cattcatccactcgttcattcattcaac 83
             ||||||| ||||| ||||||||||||||
Sbjct: 39126 cattcattcactcattcattcattcaac 39153



to top

>gb|AC122302.4| Mus musculus BAC clone RP23-276E10 from chromosome 12, complete sequence
          Length = 172985

 Score = 40.1 bits (20), Expect = 2.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 178    atccatccatccatccacca 197
              ||||||||||||||||||||
Sbjct: 164732 atccatccatccatccacca 164751



to top

>gb|AC145307.3| Mus musculus BAC clone RP24-400C6 from chromosome 17, complete sequence
          Length = 203180

 Score = 40.1 bits (20), Expect = 2.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 178    atccatccatccatccacca 197
              ||||||||||||||||||||
Sbjct: 149654 atccatccatccatccacca 149635



to top

>gb|AC157552.10| Mus musculus chromosome 7, clone RP23-89C10, complete sequence
          Length = 195587

 Score = 40.1 bits (20), Expect = 2.8
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                         
Query: 54    tccattcatccactcgttcattcattca 81
             ||||||||||||| | ||||||||||||
Sbjct: 14189 tccattcatccacccattcattcattca 14216



to top

>gb|AC121264.8| Mus musculus chromosome 9, clone RP24-233F22, complete sequence
          Length = 194261

 Score = 40.1 bits (20), Expect = 2.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 178    atccatccatccatccacca 197
              ||||||||||||||||||||
Sbjct: 130434 atccatccatccatccacca 130415



to top

>gb|AC113201.15| Mus musculus chromosome 6, clone RP23-271G7, complete sequence
          Length = 205816

 Score = 40.1 bits (20), Expect = 2.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 178   atccatccatccatccacca 197
             ||||||||||||||||||||
Sbjct: 48455 atccatccatccatccacca 48474



to top

>gb|AC161217.7| Mus musculus chromosome 8, clone RP23-80D9, complete sequence
          Length = 234127

 Score = 40.1 bits (20), Expect = 2.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 178   atccatccatccatccacca 197
             ||||||||||||||||||||
Sbjct: 80568 atccatccatccatccacca 80549



to top

>gb|AC158608.10| Mus musculus 10 BAC RP24-405N1 (Roswell Park Cancer Institute (C57BL/6J
             Male) Mouse BAC Library) complete sequence
          Length = 181588

 Score = 40.1 bits (20), Expect = 2.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 178   atccatccatccatccacca 197
             ||||||||||||||||||||
Sbjct: 20134 atccatccatccatccacca 20115



to top

>gb|AC166939.2| Mus musculus BAC clone RP23-72K19 from chromosome 8, complete sequence
          Length = 236510

 Score = 40.1 bits (20), Expect = 2.8
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 178   atccatccatccatccaccaacat 201
             ||||||||||||||||||| ||||
Sbjct: 61783 atccatccatccatccacccacat 61760



to top

>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3
          Length = 36102668

 Score = 40.1 bits (20), Expect = 2.8
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                        
Query: 169      caggcacggatccatccatccatc 192
                |||||||| |||||||||||||||
Sbjct: 30668457 caggcacgcatccatccatccatc 30668434



to top

>gb|AC164086.3| Mus musculus BAC clone RP23-25E6 from chromosome 13, complete sequence
          Length = 214085

 Score = 40.1 bits (20), Expect = 2.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 178   atccatccatccatccacca 197
             ||||||||||||||||||||
Sbjct: 87082 atccatccatccatccacca 87101



to top

>gb|AC164155.2| Mus musculus BAC clone RP24-548I6 from chromosome 14, complete sequence
          Length = 215419

 Score = 40.1 bits (20), Expect = 2.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 177    gatccatccatccatccacc 196
              ||||||||||||||||||||
Sbjct: 202621 gatccatccatccatccacc 202640



to top

>gb|AC153919.8| Mus musculus 10 BAC RP23-91E23 (Roswell Park Cancer Institute (C57BL/6J
              Female) Mouse BAC Library) complete sequence
          Length = 264561

 Score = 40.1 bits (20), Expect = 2.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 178    atccatccatccatccacca 197
              ||||||||||||||||||||
Sbjct: 176848 atccatccatccatccacca 176829


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 2,947,818
Number of Sequences: 3902068
Number of extensions: 2947818
Number of successful extensions: 596645
Number of sequences better than 10.0: 549
Number of HSP's better than 10.0 without gapping: 549
Number of HSP's successfully gapped in prelim test: 2
Number of HSP's that attempted gapping in prelim test: 570220
Number of HSP's gapped (non-prelim): 24296
length of query: 223
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 201
effective length of database: 17,147,199,772
effective search space: 3446587154172
effective search space used: 3446587154172
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top