>gb|AY532593.1| Triticum aestivum minichromosomal maintenance factor (MCM2) gene,
            exons 1 through 18 and complete sequence
          Length = 8809

 Score =  218 bits (110), Expect = 7e-54
 Identities = 162/178 (91%), Gaps = 1/178 (0%)
 Strand = Plus / Minus

                                                                        
Query: 65   gatggcgtcaggtgcatataacactgaattatgacatcaagaaggtacaaacatctctaa 124
            ||||||||||| | |||| ||||||||||||||| |||||||||||||| ||||||| ||
Sbjct: 8259 gatggcgtcagttccata-aacactgaattatgatatcaagaaggtacagacatctcgaa 8201

                                                                        
Query: 125  atgccactggaggcacaagggtttcagatagcaaacagtacaccaacaccagaattcccg 184
            ||||| ||| |||||||||||||||||||||||||||||||||||| | ||||| || | 
Sbjct: 8200 atgccgctgtaggcacaagggtttcagatagcaaacagtacaccaatatcagaactctca 8141

                                                                      
Query: 185  taaaacagacacgagcagtcattttgccaacttacactacaagtggacatttctagct 242
             ||||||||||| ||||||||||||||| |||||||||||||||||||||||||||||
Sbjct: 8140 caaaacagacacaagcagtcattttgccgacttacactacaagtggacatttctagct 8083



 Score = 44.1 bits (22), Expect = 0.23
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                  
Query: 252  gctcttgaacaaagaggtagct 273
            ||||||||||||||||||||||
Sbjct: 8085 gctcttgaacaaagaggtagct 8064

>gb|AC142351.1| Pan troglodytes BAC clone RP43-21J15 from 7, complete sequence
          Length = 159635

 Score = 40.1 bits (20), Expect = 3.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 113    aaacatctctaaatgccact 132
              ||||||||||||||||||||
Sbjct: 104407 aaacatctctaaatgccact 104388

>emb|AL365203.19| Human DNA sequence from clone RP11-479G22 on chromosome 10 Contains the
             3' end of a novel gene (FLJ13031) (FLJ40349), the ITGB1
             gene for integrin beta 1 (fibronectin receptor beta
             polypeptide antigen CD29 includes MDF2 MSK12), an
             adenylate kinase 3 like 1 (AK3L1) pseudogene, a novel
             gene, the 5' end of a novel gene, a NADH dehydrogenase
             subunit 4L (ND4L) pseudogene, a pseudogene similar to part
             of integrin beta 2 (antigen CD18 (p95) lymphocyte
             function-associated antigen 1; macrophage antigen 1
             (mac-1) beta subunit) (ITGB2) and a CpG island, complete
             sequence
          Length = 197973

 Score = 40.1 bits (20), Expect = 3.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 133   ggaggcacaagggtttcaga 152
             ||||||||||||||||||||
Sbjct: 92711 ggaggcacaagggtttcaga 92692

>gb|AC103949.6| Homo sapiens chromosome 18, clone RP11-671P2, complete sequence
          Length = 177301

 Score = 40.1 bits (20), Expect = 3.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 113    aaacatctctaaatgccact 132
              ||||||||||||||||||||
Sbjct: 117250 aaacatctctaaatgccact 117231

>gb|AC026839.7| Homo sapiens chromosome 5, clone RP11-186B13, complete sequence
          Length = 156721

 Score = 40.1 bits (20), Expect = 3.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 113   aaacatctctaaatgccact 132
             ||||||||||||||||||||
Sbjct: 25257 aaacatctctaaatgccact 25276

>gb|AC108022.3| Homo sapiens BAC clone RP11-9D8 from 4, complete sequence
          Length = 162609

 Score = 40.1 bits (20), Expect = 3.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 72    tcaggtgcatataacactga 91
             ||||||||||||||||||||
Sbjct: 18559 tcaggtgcatataacactga 18578

>gb|AC090059.9| Homo sapiens 12 BAC RP11-604C20 (Roswell Park Cancer Institute Human
             BAC Library) complete sequence
          Length = 130125

 Score = 40.1 bits (20), Expect = 3.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 15    ataatgattgtcccaaaagt 34
             ||||||||||||||||||||
Sbjct: 45587 ataatgattgtcccaaaagt 45606


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 2,066,590
Number of Sequences: 3902068
Number of extensions: 2066590
Number of successful extensions: 38671
Number of sequences better than 10.0: 7
Number of HSP's better than 10.0 without gapping: 7
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 38661
Number of HSP's gapped (non-prelim): 10
length of query: 273
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 251
effective length of database: 17,147,199,772
effective search space: 4303947142772
effective search space used: 4303947142772
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)