>ref|XM_849931.1| PREDICTED: Canis familiaris similar to G2/mitotic-specific cyclin
           B1 (LOC489180), mRNA
          Length = 929

 Score = 42.1 bits (21), Expect = 0.65
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 17  catcattcacatcaagaattacatc 41
           |||||||||| ||||||||||||||
Sbjct: 105 catcattcacctcaagaattacatc 81

>emb|BX511157.10| Zebrafish DNA sequence from clone DKEY-197M14 in linkage group 5,
             complete sequence
          Length = 159528

 Score = 42.1 bits (21), Expect = 0.65
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 63    tgaagttttacagtgtaaaaa 83
             |||||||||||||||||||||
Sbjct: 11082 tgaagttttacagtgtaaaaa 11062

>ref|XM_675903.1| Aspergillus nidulans FGSC A4 hypothetical protein (AN7726.2), mRNA
          Length = 3714

 Score = 40.1 bits (20), Expect = 2.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 138  tgccgtgcctttcaaattcc 157
            ||||||||||||||||||||
Sbjct: 2280 tgccgtgcctttcaaattcc 2299

>gb|AC133189.3| Mus musculus BAC clone RP23-354M9 from chromosome 15, complete sequence
          Length = 198577

 Score = 40.1 bits (20), Expect = 2.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 5     tctcctctttgccatcattc 24
             ||||||||||||||||||||
Sbjct: 16504 tctcctctttgccatcattc 16485


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 1,797,231
Number of Sequences: 3902068
Number of extensions: 1797231
Number of successful extensions: 127470
Number of sequences better than 10.0: 4
Number of HSP's better than 10.0 without gapping: 4
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 127463
Number of HSP's gapped (non-prelim): 7
length of query: 204
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 182
effective length of database: 17,147,199,772
effective search space: 3120790358504
effective search space used: 3120790358504
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)