ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbastl23h06
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1gb|AY310735.1| Homo sapiens glycine cleavage system protein H (a... 44 0.26
2gb|AC092718.3| Homo sapiens chromosome 16 clone RP11-303E16, com... 44 0.26
3emb|BX649247.9| Zebrafish DNA sequence from clone DKEY-181C10 in... 40 4.1
4emb|AL354776.15| Human DNA sequence from clone RP11-196N14 on ch... 40 4.1
5emb|AL133412.7| Human DNA sequence from clone RP11-78H18 on chro... 40 4.1
6emb|BX572077.7| Zebrafish DNA sequence from clone DKEY-103G5 in ... 40 4.1
7gb|AC026368.37| Homo sapiens 12 BAC RP11-103B5 (Roswell Park Can... 40 4.1

>gb|AY310735.1| Homo sapiens glycine cleavage system protein H (aminomethyl carrier)
            (GCSH) gene, complete cds
          Length = 15085

 Score = 44.1 bits (22), Expect = 0.26
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                  
Query: 245  aaactgacctcctggaacaact 266
            ||||||||||||||||||||||
Sbjct: 6242 aaactgacctcctggaacaact 6221



to top

>gb|AC092718.3| Homo sapiens chromosome 16 clone RP11-303E16, complete sequence
          Length = 203229

 Score = 44.1 bits (22), Expect = 0.26
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 245   aaactgacctcctggaacaact 266
             ||||||||||||||||||||||
Sbjct: 91621 aaactgacctcctggaacaact 91600



to top

>emb|BX649247.9| Zebrafish DNA sequence from clone DKEY-181C10 in linkage group 15,
             complete sequence
          Length = 194916

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 231   ttaacaacatgtaaaaactg 250
             ||||||||||||||||||||
Sbjct: 92451 ttaacaacatgtaaaaactg 92432



to top

>emb|AL354776.15| Human DNA sequence from clone RP11-196N14 on chromosome 20 Contains the
             3' end of the PPP4R1L gene for protein phosphatase 4
             regulatory subunit 1-like, the C20orf85 gene for an
             ankyrin domain-containing protein, the C20orf86 gene and
             three CpG islands, complete sequence
          Length = 146208

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 137   tcttgcaacgttacacatattctt 160
             |||||||| |||||||||||||||
Sbjct: 21641 tcttgcaaagttacacatattctt 21664



to top

>emb|AL133412.7| Human DNA sequence from clone RP11-78H18 on chromosome 9q22.1-22.33
             Contains the 5' end of the TNFSF15 gene for tumor necrosis
             factor (ligand) superfamily, member 15 (TL1, VEG1), a PRP4
             pre-mRNA processing factor 4 homolog B (PR4H, Prp4, PRP4H,
             PRP4K, KIAA0536) (PRPF4B) pseudogene and the TNFSF8 gene
             for tumor necrosis factor (ligand) superfamily, member 8
             (CD153, CD30L, CD30LG), complete sequence
          Length = 158717

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 232   taacaacatgtaaaaactgacctc 255
             |||||||||||| |||||||||||
Sbjct: 93415 taacaacatgtacaaactgacctc 93392



to top

>emb|BX572077.7| Zebrafish DNA sequence from clone DKEY-103G5 in linkage group 15,
              complete sequence
          Length = 213513

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 240    tgtaaaaactgacctcctggaaca 263
              ||||||||||||| ||||||||||
Sbjct: 168250 tgtaaaaactgacatcctggaaca 168273



to top

>gb|AC026368.37| Homo sapiens 12 BAC RP11-103B5 (Roswell Park Cancer Institute Human BAC
              Library) complete sequence
          Length = 177594

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 14     ttccaaagctgttcaatttc 33
              ||||||||||||||||||||
Sbjct: 162274 ttccaaagctgttcaatttc 162255


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 2,421,099
Number of Sequences: 3902068
Number of extensions: 2421099
Number of successful extensions: 42950
Number of sequences better than 10.0: 7
Number of HSP's better than 10.0 without gapping: 7
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 42938
Number of HSP's gapped (non-prelim): 12
length of query: 313
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 291
effective length of database: 17,147,199,772
effective search space: 4989835133652
effective search space used: 4989835133652
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top