ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbastl23h03
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1ref|NM_191405.1| Oryza sativa (japonica cultivar-group), predic... 64 4e-07
2dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic D... 64 4e-07
3dbj|AP003106.1| Oryza sativa (japonica cultivar-group) genomic D... 64 4e-07
4dbj|AP003371.5| Oryza sativa (japonica cultivar-group) genomic D... 64 4e-07
5dbj|AK070376.1| Oryza sativa (japonica cultivar-group) cDNA clon... 64 4e-07
6gb|BC087433.1| Xenopus laevis hypothetical LOC496153, mRNA (cDNA... 44 0.33
7gb|AC107959.8| Homo sapiens chromosome 8, clone RP11-875O11, com... 42 1.3
8emb|AL161736.33| Human DNA sequence from clone RP11-421E17 on ch... 42 1.3
9gb|AC100861.2| Homo sapiens chromosome 8, clone RP11-1149O23, co... 42 1.3
10gb|AC093156.2| Homo sapiens chromosome 1 clone RP11-87O11, compl... 42 1.3
11gb|AY673996.1| Gracilaria tenuistipitata var. liui chloroplast, ... 40 5.2
12gb|AC084315.4| Mus musculus strain C57BL6/J chromosome 6 clone R... 40 5.2
13gb|AC091395.4| Mus musculus strain C57BL6/J chromosome 6 clone R... 40 5.2
14gb|AC140251.2| Mus musculus BAC clone RP24-289C19 from chromosom... 40 5.2
15gb|AC160398.8| Mus musculus 6 BAC RP23-162K3 (Roswell Park Cance... 40 5.2
16gb|AC112260.6| Mus musculus BAC clone RP23-185L5 from chromosome... 40 5.2
17gb|AC126007.16| Medicago truncatula clone mth2-11o4, complete se... 40 5.2
18emb|AL139413.11| Human DNA sequence from clone RP5-1033K19 on ch... 40 5.2
19emb|AL049541.24|HSJ991B18 Human DNA sequence from clone RP5-991B... 40 5.2
20gb|AC109350.5| Homo sapiens BAC clone RP11-267D2 from 4, complet... 40 5.2
21gb|AC104305.2| Homo sapiens chromosome 3 clone RP11-523D22, comp... 40 5.2
22gb|AC013432.4| Drosophila melanogaster, chromosome X, region 15F... 40 5.2
23gb|AF320347.1|AF320347 Mus musculus odorant receptor ORZ6 (Orz6)... 40 5.2
24gb|AC156400.9| Mus musculus 6 BAC RP24-299B14 (Roswell Park Canc... 40 5.2
25gb|AC012096.8|AC012096 Drosophila melanogaster, chromosome X, re... 40 5.2
26gb|AC010975.9| Homo sapiens BAC clone RP11-191H23 from 2, comple... 40 5.2
27gb|AE003505.3| Drosophila melanogaster chromosome X, section 57 ... 40 5.2
28gb|CP000155.1| Hahella chejuensis KCTC 2396, complete genome 40 5.2
29dbj|AB216046.1| Equus caballus DNA, microsatellite TKY2103 40 5.2
30emb|X69871.1|DMFORKEDA D.melanogaster putative f gene 40 5.2

>ref|NM_191405.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 2550

 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 53/60 (88%)
 Strand = Plus / Minus

                                                                        
Query: 328  tcatggtggcattcacgatgaatgtcacgagctgcttctgcccgctggggatgaagaact 387
            |||||||||| || |||| ||| |||||  ||||| ||||||||||||||||||||||||
Sbjct: 2446 tcatggtggcgttgacgacgaaggtcacctgctgcctctgcccgctggggatgaagaact 2387



to top

>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete
                sequence
          Length = 43261740

 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 53/60 (88%)
 Strand = Plus / Minus

                                                                            
Query: 328      tcatggtggcattcacgatgaatgtcacgagctgcttctgcccgctggggatgaagaact 387
                |||||||||| || |||| ||| |||||  ||||| ||||||||||||||||||||||||
Sbjct: 32449414 tcatggtggcgttgacgacgaaggtcacctgctgcctctgcccgctggggatgaagaact 32449355



to top

>dbj|AP003106.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC
             clone:P0665A11
          Length = 166421

 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 53/60 (88%)
 Strand = Plus / Minus

                                                                         
Query: 328   tcatggtggcattcacgatgaatgtcacgagctgcttctgcccgctggggatgaagaact 387
             |||||||||| || |||| ||| |||||  ||||| ||||||||||||||||||||||||
Sbjct: 36935 tcatggtggcgttgacgacgaaggtcacctgctgcctctgcccgctggggatgaagaact 36876



to top

>dbj|AP003371.5| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, BAC
              clone:B1143G03
          Length = 137770

 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 53/60 (88%)
 Strand = Plus / Minus

                                                                          
Query: 328    tcatggtggcattcacgatgaatgtcacgagctgcttctgcccgctggggatgaagaact 387
              |||||||||| || |||| ||| |||||  ||||| ||||||||||||||||||||||||
Sbjct: 128911 tcatggtggcgttgacgacgaaggtcacctgctgcctctgcccgctggggatgaagaact 128852



to top

>dbj|AK070376.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023050H13, full
            insert sequence
          Length = 3095

 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 53/60 (88%)
 Strand = Plus / Minus

                                                                        
Query: 328  tcatggtggcattcacgatgaatgtcacgagctgcttctgcccgctggggatgaagaact 387
            |||||||||| || |||| ||| |||||  ||||| ||||||||||||||||||||||||
Sbjct: 2747 tcatggtggcgttgacgacgaaggtcacctgctgcctctgcccgctggggatgaagaact 2688



to top

>gb|BC087433.1| Xenopus laevis hypothetical LOC496153, mRNA (cDNA clone MGC:99244
           IMAGE:7209988), complete cds
          Length = 911

 Score = 44.1 bits (22), Expect = 0.33
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 16  cattcatcatcaaaagatgggc 37
           ||||||||||||||||||||||
Sbjct: 656 cattcatcatcaaaagatgggc 635



to top

>gb|AC107959.8| Homo sapiens chromosome 8, clone RP11-875O11, complete sequence
          Length = 211291

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 121    acatgcttcaaaaatgtacac 141
              |||||||||||||||||||||
Sbjct: 170156 acatgcttcaaaaatgtacac 170176



to top

>emb|AL161736.33| Human DNA sequence from clone RP11-421E17 on chromosome 1 Contains the
             3' end of the FNBP2 gene for formin binding protein 2 and
             a RAP1, GTP-GDP dissociation stimulator 1 (RAP1GDS1)
             pseudogene, complete sequence
          Length = 159474

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 87    taggtaaacagtaactcatctactt 111
             |||| ||||||||||||||||||||
Sbjct: 80768 taggcaaacagtaactcatctactt 80744



to top

>gb|AC100861.2| Homo sapiens chromosome 8, clone RP11-1149O23, complete sequence
          Length = 164692

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 121    acatgcttcaaaaatgtacac 141
              |||||||||||||||||||||
Sbjct: 120415 acatgcttcaaaaatgtacac 120435



to top

>gb|AC093156.2| Homo sapiens chromosome 1 clone RP11-87O11, complete sequence
          Length = 198846

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 226    aggaactctacacagccttgg 246
              |||||||||||||||||||||
Sbjct: 168311 aggaactctacacagccttgg 168291



to top

>gb|AY673996.1| Gracilaria tenuistipitata var. liui chloroplast, complete genome
          Length = 183883

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 128   tcaaaaatgtacaccaaacaaaca 151
             ||||||||||||||||| ||||||
Sbjct: 11153 tcaaaaatgtacaccaatcaaaca 11130



to top

>gb|AC084315.4| Mus musculus strain C57BL6/J chromosome 6 clone RP23-353M17, complete
            sequence
          Length = 92644

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 58   tacagttactgctccccaaa 77
            ||||||||||||||||||||
Sbjct: 8888 tacagttactgctccccaaa 8907



to top

>gb|AC091395.4| Mus musculus strain C57BL6/J chromosome 6 clone RP23-288L22, complete
              sequence
          Length = 163323

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 58     tacagttactgctccccaaa 77
              ||||||||||||||||||||
Sbjct: 162650 tacagttactgctccccaaa 162669



to top

>gb|AC140251.2| Mus musculus BAC clone RP24-289C19 from chromosome 12, complete sequence
          Length = 177652

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 133    aatgtacaccaaacaaacacaact 156
              |||| |||||||||||||||||||
Sbjct: 122995 aatgaacaccaaacaaacacaact 122972



to top

>gb|AC160398.8| Mus musculus 6 BAC RP23-162K3 (Roswell Park Cancer Institute (C57BL/6J
             Female) Mouse BAC Library) complete sequence
          Length = 215426

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                         
Query: 53    ccctttacagttactgctccccaaacaa 80
             ||||||||||| |||| |||||||||||
Sbjct: 29715 ccctttacagtcactgttccccaaacaa 29742



to top

>gb|AC112260.6| Mus musculus BAC clone RP23-185L5 from chromosome 18, complete sequence
          Length = 216325

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 275    gtgccccctgtccccatagaactc 298
              ||||||||||||||||||| ||||
Sbjct: 179076 gtgccccctgtccccataggactc 179099



to top

>gb|AC126007.16| Medicago truncatula clone mth2-11o4, complete sequence
          Length = 106747

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 10    atttctcattcatcatcaaa 29
             ||||||||||||||||||||
Sbjct: 62869 atttctcattcatcatcaaa 62850



to top

>emb|AL139413.11| Human DNA sequence from clone RP5-1033K19 on chromosome 1 Contains a
             transcription elongation factor B (SIII) polypeptide 1
             (15kDa, elongin C) (TCEB1) pseudogene, a pseudogene
             similar to part of BET1 homolog (S. cerevisiae) (BET1),
             the RPE65 gene for 65kDa retinal pigment
             epithelium-specific protein and the 3' end of the gene for
              cell cycle control protein SDP35 (SDP35), complete
             sequence
          Length = 103139

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 3     gaaaaggatttctcattcat 22
             ||||||||||||||||||||
Sbjct: 34200 gaaaaggatttctcattcat 34181



to top

>emb|AL049541.24|HSJ991B18 Human DNA sequence from clone RP5-991B18 on chromosome 20q13.11-13.3
              Contains a putative novel gene, ESTs, STSs and GSSs,
              complete sequence
          Length = 129874

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 93     aacagtaactcatctactta 112
              ||||||||||||||||||||
Sbjct: 109896 aacagtaactcatctactta 109915



to top

>gb|AC109350.5| Homo sapiens BAC clone RP11-267D2 from 4, complete sequence
          Length = 58068

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 63    ttactgctccccaaacaaaa 82
             ||||||||||||||||||||
Sbjct: 43302 ttactgctccccaaacaaaa 43321



to top

>gb|AC104305.2| Homo sapiens chromosome 3 clone RP11-523D22, complete sequence
          Length = 149858

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 69    ctccccaaacaaaacaacta 88
             ||||||||||||||||||||
Sbjct: 44533 ctccccaaacaaaacaacta 44552



to top

>gb|AC013432.4| Drosophila melanogaster, chromosome X, region 15F-15F, BAC clone
              BACR01K05, complete sequence
          Length = 162761

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 94     acagtaactcatctacttac 113
              ||||||||||||||||||||
Sbjct: 139890 acagtaactcatctacttac 139909



to top

>gb|AF320347.1|AF320347 Mus musculus odorant receptor ORZ6 (Orz6) gene, complete cds
          Length = 2931

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 53  ccctttacagttactgctccccaaacaa 80
           ||||||||||| |||| |||||||||||
Sbjct: 805 ccctttacagtcactgttccccaaacaa 778



to top

>gb|AC156400.9| Mus musculus 6 BAC RP24-299B14 (Roswell Park Cancer Institute (C57BL/6J
             Male) Mouse BAC Library) complete sequence
          Length = 158629

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                         
Query: 53    ccctttacagttactgctccccaaacaa 80
             ||||||||||| |||| |||||||||||
Sbjct: 34339 ccctttacagtcactgttccccaaacaa 34312



to top

>gb|AC012096.8|AC012096 Drosophila melanogaster, chromosome X, region 15E-15F, BAC clone
              BACR18O02, complete sequence
          Length = 177793

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 94     acagtaactcatctacttac 113
              ||||||||||||||||||||
Sbjct: 111324 acagtaactcatctacttac 111305



to top

>gb|AC010975.9| Homo sapiens BAC clone RP11-191H23 from 2, complete sequence
          Length = 171249

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 10    atttctcattcatcatcaaa 29
             ||||||||||||||||||||
Sbjct: 12297 atttctcattcatcatcaaa 12278



to top

>gb|AE003505.3| Drosophila melanogaster chromosome X, section 57 of 74 of the complete
             sequence
          Length = 314205

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 94    acagtaactcatctacttac 113
             ||||||||||||||||||||
Sbjct: 26509 acagtaactcatctacttac 26490



to top

>gb|CP000155.1| Hahella chejuensis KCTC 2396, complete genome
          Length = 7215267

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 108     acttacatggacgacatgct 127
               ||||||||||||||||||||
Sbjct: 1676734 acttacatggacgacatgct 1676715



to top

>dbj|AB216046.1| Equus caballus DNA, microsatellite TKY2103
          Length = 155

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 138 acaccaaacaaacacaacta 157
           ||||||||||||||||||||
Sbjct: 68  acaccaaacaaacacaacta 87



to top

>emb|X69871.1|DMFORKEDA D.melanogaster putative f gene
          Length = 19408

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 94  acagtaactcatctacttac 113
           ||||||||||||||||||||
Sbjct: 524 acagtaactcatctacttac 505


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 4,084,652
Number of Sequences: 3902068
Number of extensions: 4084652
Number of successful extensions: 62110
Number of sequences better than 10.0: 30
Number of HSP's better than 10.0 without gapping: 30
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 62037
Number of HSP's gapped (non-prelim): 73
length of query: 387
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 365
effective length of database: 17,147,199,772
effective search space: 6258727916780
effective search space used: 6258727916780
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top