ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbastl23e04
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1emb|BX005481.11| Zebrafish DNA sequence from clone CH211-79C1 in... 42 0.30
2gb|AC113099.12| Mus musculus chromosome 8, clone RP23-314N20, co... 40 1.2
3emb|BX321882.7| Zebrafish DNA sequence from clone DKEYP-30F1 in ... 40 1.2
4gb|AC008124.8|AC008124 Homo sapiens Chromosome 12q13-62.7-72 BAC... 40 1.2
5gb|AE017308.1| Mycoplasma mobile 163K complete genome 38 4.7
6gb|AC155713.14| Mus musculus 10 BAC RP24-117K18 (Roswell Park Ca... 38 4.7
7gb|AC149645.4| Bos taurus BAC CH240-50L4 (Children's Hospital O... 38 4.7
8gb|AC148336.4| Mus musculus BAC clone RP23-21J15 from chromosome... 38 4.7
9gb|BC023112.1| Mus musculus chondroitin sulfate GalNAcT-2, mRNA ... 38 4.7
10gb|BC060169.1| Mus musculus chondroitin sulfate GalNAcT-2, mRNA ... 38 4.7
11emb|AL731563.9| Human DNA sequence from clone RP11-344N10 on chr... 38 4.7
12gb|AC109441.3| Homo sapiens chromosome 5 clone CTC-269P20, compl... 38 4.7
13emb|AL627163.3| Zebrafish DNA sequence from clone XX-KT90 Contai... 38 4.7
14dbj|AK145992.1| Mus musculus 14 days pregnant adult female place... 38 4.7
15gb|AC026337.29| Homo sapiens 2 BAC RP11-105E24 (Roswell Park Can... 38 4.7
16gb|AC010584.5| Homo sapiens chromosome 5 clone CTC-218H9, comple... 38 4.7
17dbj|AK028045.1| Mus musculus adult male liver cDNA, RIKEN full-l... 38 4.7
18gb|DQ231548.1| Brassica rapa subsp. pekinensis chloroplast sequence 38 4.7
19gb|AY587540.1| Brassica juncea YCF3 (ycf3) gene, complete cds; a... 38 4.7
20gb|AC012555.27| Homo sapiens 12 RP11-650K20 (Roswell Park Cancer... 38 4.7
21gb|AC018678.9| Homo sapiens BAC clone RP11-279E17 from 2, comple... 38 4.7
22ref|NM_030165.3| Mus musculus chondroitin sulfate GalNAcT-2 (Gal... 38 4.7
23dbj|BS000166.1| Pan troglodytes chromosome 22 clone:RP43-094M15,... 38 4.7
24emb|AL359680.4|CNS05TEY Human chromosome 14 DNA sequence BAC R-7... 38 4.7
25gb|AC153920.5| Mus musculus 10 BAC RP23-82M21 (Roswell Park Canc... 38 4.7
26gb|AC135861.5| Mus musculus BAC clone RP23-179J18 from 6, comple... 38 4.7
27emb|AL359333.6|CNS05TET Human chromosome 14 DNA sequence BAC R-4... 38 4.7

>emb|BX005481.11| Zebrafish DNA sequence from clone CH211-79C1 in linkage group 1, complete
              sequence
          Length = 170604

 Score = 42.1 bits (21), Expect = 0.30
 Identities = 30/33 (90%)
 Strand = Plus / Plus

                                               
Query: 17     aaaatagataaaaaatctatggatctagtaaat 49
              |||||| ||||||||||| ||||||| ||||||
Sbjct: 134950 aaaataaataaaaaatctttggatctggtaaat 134982



to top

>gb|AC113099.12| Mus musculus chromosome 8, clone RP23-314N20, complete sequence
          Length = 199694

 Score = 40.1 bits (20), Expect = 1.2
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 4     gaatactacgtacaaaatagataa 27
             |||||| |||||||||||||||||
Sbjct: 81547 gaataccacgtacaaaatagataa 81524



to top

>emb|BX321882.7| Zebrafish DNA sequence from clone DKEYP-30F1 in linkage group 12,
              complete sequence
          Length = 187475

 Score = 40.1 bits (20), Expect = 1.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 17     aaaatagataaaaaatctat 36
              ||||||||||||||||||||
Sbjct: 141813 aaaatagataaaaaatctat 141832



to top

>gb|AC008124.8|AC008124 Homo sapiens Chromosome 12q13-62.7-72 BAC RPCI11-352M15 (Roswell Park
              Cancer Institute Human BAC Library) complete sequence
          Length = 183387

 Score = 40.1 bits (20), Expect = 1.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 16     caaaatagataaaaaatcta 35
              ||||||||||||||||||||
Sbjct: 124694 caaaatagataaaaaatcta 124675



to top

>gb|AE017308.1| Mycoplasma mobile 163K complete genome
          Length = 777079

 Score = 38.2 bits (19), Expect = 4.7
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 13     gtacaaaatagataaaaaa 31
              |||||||||||||||||||
Sbjct: 171321 gtacaaaatagataaaaaa 171303



to top

>gb|AC155713.14| Mus musculus 10 BAC RP24-117K18 (Roswell Park Cancer Institute (C57BL/6J
              Male) Mouse BAC Library) complete sequence
          Length = 156147

 Score = 38.2 bits (19), Expect = 4.7
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 71     gacttccagttccaccagt 89
              |||||||||||||||||||
Sbjct: 143033 gacttccagttccaccagt 143015



to top

>gb|AC149645.4| Bos taurus  BAC CH240-50L4 (Children's Hospital Oakland Research
             Institute Bovine BAC Library (male)) complete sequence
          Length = 198061

 Score = 38.2 bits (19), Expect = 4.7
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 72    acttccagttccaccagta 90
             |||||||||||||||||||
Sbjct: 30185 acttccagttccaccagta 30203



to top

>gb|AC148336.4| Mus musculus BAC clone RP23-21J15 from chromosome 18, complete sequence
          Length = 238060

 Score = 38.2 bits (19), Expect = 4.7
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 17     aaaatagataaaaaatcta 35
              |||||||||||||||||||
Sbjct: 121571 aaaatagataaaaaatcta 121589



to top

>gb|BC023112.1| Mus musculus chondroitin sulfate GalNAcT-2, mRNA (cDNA clone
            IMAGE:4010410), complete cds
          Length = 2163

 Score = 38.2 bits (19), Expect = 4.7
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                               
Query: 36   tggatctagtaaatgaccc 54
            |||||||||||||||||||
Sbjct: 1630 tggatctagtaaatgaccc 1612



to top

>gb|BC060169.1| Mus musculus chondroitin sulfate GalNAcT-2, mRNA (cDNA clone
            MGC:63447 IMAGE:6826555), complete cds
          Length = 5279

 Score = 38.2 bits (19), Expect = 4.7
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                               
Query: 36   tggatctagtaaatgaccc 54
            |||||||||||||||||||
Sbjct: 4752 tggatctagtaaatgaccc 4734



to top

>emb|AL731563.9| Human DNA sequence from clone RP11-344N10 on chromosome 10 Contains the
             P4HA1 gene for procollagen-proline, 2-oxoglutarate
             4-dioxygenase (proline 4-hydroxylase) alpha polypeptide I,
             a novel gene, a novel pseudogene, a ribosomal protein L17
             (RPL17) pseudogene and a CpG island, complete sequence
          Length = 129559

 Score = 38.2 bits (19), Expect = 4.7
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 74    ttccagttccaccagtatt 92
             |||||||||||||||||||
Sbjct: 42695 ttccagttccaccagtatt 42677



to top

>gb|AC109441.3| Homo sapiens chromosome 5 clone CTC-269P20, complete sequence
          Length = 89908

 Score = 38.2 bits (19), Expect = 4.7
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                    
Query: 5     aatactacgtacaaaatagataa 27
             ||||||| |||||||||||||||
Sbjct: 48299 aatactatgtacaaaatagataa 48321



to top

>emb|AL627163.3| Zebrafish DNA sequence from clone XX-KT90 Contains part of a novel gene
             and a novel gene similar to SLC17A6 (solute carrier family
             17 (sodium-dependent inorganic phosphate cotransporter),
             member 6), complete sequence
          Length = 93831

 Score = 38.2 bits (19), Expect = 4.7
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                    
Query: 15    acaaaatagataaaaaatctatg 37
             |||||||| ||||||||||||||
Sbjct: 75942 acaaaataaataaaaaatctatg 75964



to top

>dbj|AK145992.1| Mus musculus 14 days pregnant adult female placenta cDNA, RIKEN
            full-length enriched library, clone:I530023B14
            product:chondroitin sulfate GalNAcT-2, full insert
            sequence
          Length = 3639

 Score = 38.2 bits (19), Expect = 4.7
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                               
Query: 36   tggatctagtaaatgaccc 54
            |||||||||||||||||||
Sbjct: 3137 tggatctagtaaatgaccc 3119



to top

>gb|AC026337.29| Homo sapiens 2 BAC RP11-105E24 (Roswell Park Cancer Institute Human BAC
             Library) complete sequence
          Length = 171004

 Score = 38.2 bits (19), Expect = 4.7
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 17    aaaatagataaaaaatcta 35
             |||||||||||||||||||
Sbjct: 60794 aaaatagataaaaaatcta 60776



to top

>gb|AC010584.5| Homo sapiens chromosome 5 clone CTC-218H9, complete sequence
          Length = 113216

 Score = 38.2 bits (19), Expect = 4.7
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                   
Query: 5    aatactacgtacaaaatagataa 27
            ||||||| |||||||||||||||
Sbjct: 7052 aatactatgtacaaaatagataa 7030



to top

>dbj|AK028045.1| Mus musculus adult male liver cDNA, RIKEN full-length enriched
            library, clone:1300005F02 product:hypothetical
            Nucleotide-diphospho-sugar transferases structure
            containing protein, full insert sequence
          Length = 3633

 Score = 38.2 bits (19), Expect = 4.7
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                               
Query: 36   tggatctagtaaatgaccc 54
            |||||||||||||||||||
Sbjct: 3130 tggatctagtaaatgaccc 3112



to top

>gb|DQ231548.1| Brassica rapa subsp. pekinensis chloroplast sequence
          Length = 153482

 Score = 38.2 bits (19), Expect = 4.7
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 17    aaaatagataaaaaatcta 35
             |||||||||||||||||||
Sbjct: 44149 aaaatagataaaaaatcta 44167



to top

>gb|AY587540.1| Brassica juncea YCF3 (ycf3) gene, complete cds; and photosystem-I
          P700 chlorophyll (psaA) gene, partial cds; chloroplast
          Length = 3231

 Score = 38.2 bits (19), Expect = 4.7
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                             
Query: 17 aaaatagataaaaaatcta 35
          |||||||||||||||||||
Sbjct: 65 aaaatagataaaaaatcta 47



to top

>gb|AC012555.27| Homo sapiens 12 RP11-650K20 (Roswell Park Cancer Institute Human BAC
             Library) complete sequence
          Length = 95597

 Score = 38.2 bits (19), Expect = 4.7
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 33    ctatggatctagtaaatga 51
             |||||||||||||||||||
Sbjct: 42412 ctatggatctagtaaatga 42430



to top

>gb|AC018678.9| Homo sapiens BAC clone RP11-279E17 from 2, complete sequence
          Length = 169991

 Score = 38.2 bits (19), Expect = 4.7
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 17     aaaatagataaaaaatcta 35
              |||||||||||||||||||
Sbjct: 101042 aaaatagataaaaaatcta 101024



to top

>ref|NM_030165.3| Mus musculus chondroitin sulfate GalNAcT-2 (Galnact2), mRNA
          Length = 3676

 Score = 38.2 bits (19), Expect = 4.7
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                               
Query: 36   tggatctagtaaatgaccc 54
            |||||||||||||||||||
Sbjct: 3149 tggatctagtaaatgaccc 3131



to top

>dbj|BS000166.1| Pan troglodytes chromosome 22 clone:RP43-094M15, map 22, complete
             sequences
          Length = 158730

 Score = 38.2 bits (19), Expect = 4.7
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 26    aaaaaatctatggatctag 44
             |||||||||||||||||||
Sbjct: 82832 aaaaaatctatggatctag 82850



to top

>emb|AL359680.4|CNS05TEY Human chromosome 14 DNA sequence BAC R-716B8 of library RPCI-11 from
             chromosome 14 of Homo sapiens (Human), complete sequence
          Length = 175009

 Score = 38.2 bits (19), Expect = 4.7
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 17    aaaatagataaaaaatcta 35
             |||||||||||||||||||
Sbjct: 92726 aaaatagataaaaaatcta 92708



to top

>gb|AC153920.5| Mus musculus 10 BAC RP23-82M21 (Roswell Park Cancer Institute (C57BL/6J
             Female) Mouse BAC Library) complete sequence
          Length = 129551

 Score = 38.2 bits (19), Expect = 4.7
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 71    gacttccagttccaccagt 89
             |||||||||||||||||||
Sbjct: 71177 gacttccagttccaccagt 71159



to top

>gb|AC135861.5| Mus musculus BAC clone RP23-179J18 from 6, complete sequence
          Length = 202869

 Score = 38.2 bits (19), Expect = 4.7
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 36    tggatctagtaaatgaccc 54
             |||||||||||||||||||
Sbjct: 47054 tggatctagtaaatgaccc 47036



to top

>emb|AL359333.6|CNS05TET Human chromosome 14 DNA sequence BAC R-478J3 of library RPCI-11 from
             chromosome 14 of Homo sapiens (Human), complete sequence
          Length = 151719

 Score = 38.2 bits (19), Expect = 4.7
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 17    aaaatagataaaaaatcta 35
             |||||||||||||||||||
Sbjct: 15136 aaaatagataaaaaatcta 15118


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 994,161
Number of Sequences: 3902068
Number of extensions: 994161
Number of successful extensions: 80301
Number of sequences better than 10.0: 27
Number of HSP's better than 10.0 without gapping: 27
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 80243
Number of HSP's gapped (non-prelim): 58
length of query: 105
length of database: 17,233,045,268
effective HSP length: 21
effective length of query: 84
effective length of database: 17,151,101,840
effective search space: 1440692554560
effective search space used: 1440692554560
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 19 (38.2 bits)
to top