>emb|AL512363.11| Human DNA sequence from clone RP11-524H19 on chromosome 6 Contains
            the 3' end of transforming protein P21A (K-RAS) (C-K-RAS)
            pseudogene, a novel gene, the 5' end of the gene for a
            novel protein and a CpG island, complete sequence
          Length = 113075

 Score = 44.1 bits (22), Expect = 0.17
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                  
Query: 150  aaagttacaagaacaaatgaat 171
            ||||||||||||||||||||||
Sbjct: 5392 aaagttacaagaacaaatgaat 5371

>emb|AL591711.22| Mouse DNA sequence from clone RP23-19L12 on chromosome 2, complete
              sequence
          Length = 197743

 Score = 44.1 bits (22), Expect = 0.17
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 81     acacatatgtactgataataat 102
              ||||||||||||||||||||||
Sbjct: 118819 acacatatgtactgataataat 118798

>gb|AC158949.6| Mus musculus chromosome 7, clone RP23-305I23, complete sequence
          Length = 159999

 Score = 42.1 bits (21), Expect = 0.66
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 68    aggatatattccaacacatat 88
             |||||||||||||||||||||
Sbjct: 61272 aggatatattccaacacatat 61252

>gb|AC110551.9| Mus musculus chromosome 7, clone RP23-245P16, complete sequence
          Length = 155691

 Score = 42.1 bits (21), Expect = 0.66
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 68     aggatatattccaacacatat 88
              |||||||||||||||||||||
Sbjct: 113432 aggatatattccaacacatat 113412

>gb|AC159244.4| Mus musculus BAC clone RP24-309L4 from chromosome 12, complete sequence
          Length = 216500

 Score = 40.1 bits (20), Expect = 2.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 19    gatgagaactgtaccagctt 38
             ||||||||||||||||||||
Sbjct: 92740 gatgagaactgtaccagctt 92721

>ref|XM_774264.1| Giardia lamblia ATCC 50803 hypothetical protein (GLP_165_15468_21509)
            partial mRNA
          Length = 6042

 Score = 40.1 bits (20), Expect = 2.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 78   ccaacacatatgtactgata 97
            ||||||||||||||||||||
Sbjct: 3663 ccaacacatatgtactgata 3682

>gb|AC067940.5| Homo sapiens BAC clone RP11-818E9 from 2, complete sequence
          Length = 148267

 Score = 40.1 bits (20), Expect = 2.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 83    acatatgtactgataataat 102
             ||||||||||||||||||||
Sbjct: 98980 acatatgtactgataataat 98999


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 1,978,385
Number of Sequences: 3902068
Number of extensions: 1978385
Number of successful extensions: 139342
Number of sequences better than 10.0: 7
Number of HSP's better than 10.0 without gapping: 7
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 139329
Number of HSP's gapped (non-prelim): 13
length of query: 206
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 184
effective length of database: 17,147,199,772
effective search space: 3155084758048
effective search space used: 3155084758048
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)