>gb|AC166325.1| Mus musculus BAC clone RP24-421O23 from chromosome 13, complete
             sequence
          Length = 192167

 Score = 42.1 bits (21), Expect = 0.42
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 14    aaacacaatgttaccaccatg 34
             |||||||||||||||||||||
Sbjct: 56882 aaacacaatgttaccaccatg 56902

>gb|AC154603.3| Mus musculus BAC clone RP23-344D21 from chromosome 13, complete
            sequence
          Length = 216297

 Score = 42.1 bits (21), Expect = 0.42
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 14   aaacacaatgttaccaccatg 34
            |||||||||||||||||||||
Sbjct: 2001 aaacacaatgttaccaccatg 1981

>gb|AC153609.2| Mus musculus 6 BAC RP23-77I23 (Roswell Park Cancer Institute
            (C57BL/6J Female) Mouse BAC Library) complete sequence
          Length = 221782

 Score = 38.2 bits (19), Expect = 6.6
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                               
Query: 107  gccattccaggtgcttgat 125
            |||||||||||||||||||
Sbjct: 9298 gccattccaggtgcttgat 9316

>gb|CP000069.1| Trypanosoma brucei chromosome 6, complete sequence
          Length = 1618915

 Score = 38.2 bits (19), Expect = 6.6
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                     
Query: 4      acagtacaggaaacacaatgtta 26
              |||| ||||||||||||||||||
Sbjct: 812323 acagaacaggaaacacaatgtta 812345

>gb|AC084047.3| Trypanosoma brucei chromosome 6 clone RPCI93-5F5, complete sequence
          Length = 152595

 Score = 38.2 bits (19), Expect = 6.6
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                    
Query: 4     acagtacaggaaacacaatgtta 26
             |||| ||||||||||||||||||
Sbjct: 22048 acagaacaggaaacacaatgtta 22070

>emb|AL592503.5| Human DNA sequence from clone RP11-267A5 on chromosome 13, complete
             sequence
          Length = 99970

 Score = 38.2 bits (19), Expect = 6.6
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 26    accaccatgcctctgaatg 44
             |||||||||||||||||||
Sbjct: 99030 accaccatgcctctgaatg 99012

>emb|AL160255.14| Human DNA sequence from clone RP11-60N6 on chromosome 13 Contains the
            5' end of a novel gene (KIAA0774), complete sequence
          Length = 172923

 Score = 38.2 bits (19), Expect = 6.6
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                               
Query: 26   accaccatgcctctgaatg 44
            |||||||||||||||||||
Sbjct: 1060 accaccatgcctctgaatg 1042

>gb|CP000091.1| Ralstonia eutropha JMP134 chromosome 2, complete sequence
          Length = 2726152

 Score = 38.2 bits (19), Expect = 6.6
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                  
Query: 103     tccggccattccaggtgct 121
               |||||||||||||||||||
Sbjct: 1699806 tccggccattccaggtgct 1699788

>emb|BX950870.7| Zebrafish DNA sequence from clone DKEY-242M17 in linkage group 6,
              complete sequence
          Length = 186279

 Score = 38.2 bits (19), Expect = 6.6
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 33     tgcctctgaatgccatgtt 51
              |||||||||||||||||||
Sbjct: 101462 tgcctctgaatgccatgtt 101480

>gb|AC005156.1|AC005156 Homo sapiens PAC clone RP5-1099C19 from 7q21-q22, complete sequence
          Length = 73899

 Score = 38.2 bits (19), Expect = 6.6
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 11    aggaaacacaatgttacca 29
             |||||||||||||||||||
Sbjct: 39711 aggaaacacaatgttacca 39729

>emb|BX000481.5| Zebrafish DNA sequence from clone CH211-13A4 in linkage group 5,
             complete sequence
          Length = 163926

 Score = 38.2 bits (19), Expect = 6.6
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 1     gctacagtacaggaaacac 19
             |||||||||||||||||||
Sbjct: 91095 gctacagtacaggaaacac 91077

>emb|AL954699.4| Zebrafish DNA sequence from clone CH211-264H3 in linkage group 5,
             complete sequence
          Length = 143013

 Score = 38.2 bits (19), Expect = 6.6
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 1     gctacagtacaggaaacac 19
             |||||||||||||||||||
Sbjct: 92834 gctacagtacaggaaacac 92816

>emb|CR382127.1| Yarrowia lipolytica chromosome A of strain CLIB122 of Yarrowia lipolytica
          Length = 2303261

 Score = 38.2 bits (19), Expect = 6.6
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                  
Query: 37      tctgaatgccatgttgtaa 55
               |||||||||||||||||||
Sbjct: 1236164 tctgaatgccatgttgtaa 1236182

>emb|AL772194.6| Mouse DNA sequence from clone RP23-331M18 on chromosome 4, complete
             sequence
          Length = 176496

 Score = 38.2 bits (19), Expect = 6.6
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 5     cagtacaggaaacacaatg 23
             |||||||||||||||||||
Sbjct: 37538 cagtacaggaaacacaatg 37556


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 1,299,950
Number of Sequences: 3902068
Number of extensions: 1299950
Number of successful extensions: 81573
Number of sequences better than 10.0: 14
Number of HSP's better than 10.0 without gapping: 14
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 81527
Number of HSP's gapped (non-prelim): 46
length of query: 139
length of database: 17,233,045,268
effective HSP length: 21
effective length of query: 118
effective length of database: 17,151,101,840
effective search space: 2023830017120
effective search space used: 2023830017120
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 19 (38.2 bits)