>gb|AC087806.3| Papio anubis clone RP41-187H19, complete sequence
          Length = 166510

 Score = 44.1 bits (22), Expect = 0.31
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 47    atttgttatctatatatcccta 68
             ||||||||||||||||||||||
Sbjct: 47297 atttgttatctatatatcccta 47276

>emb|CR847512.10| Zebrafish DNA sequence from clone DKEYP-13G11 in linkage group 9,
             complete sequence
          Length = 169581

 Score = 44.1 bits (22), Expect = 0.31
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 123   aatgaacccattaaataaaaaa 144
             ||||||||||||||||||||||
Sbjct: 84815 aatgaacccattaaataaaaaa 84794

>emb|CR762496.7| Zebrafish DNA sequence from clone DKEY-212J2 in linkage group 21,
            complete sequence
          Length = 239780

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 23   atctgcatgcatttttatatg 43
            |||||||||||||||||||||
Sbjct: 9718 atctgcatgcatttttatatg 9698

>gb|AC142270.4| Mus musculus BAC clone RP24-115G23 from chromosome 3, complete sequence
          Length = 170870

 Score = 40.1 bits (20), Expect = 4.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 125   tgaacccattaaataaaaaa 144
             ||||||||||||||||||||
Sbjct: 70286 tgaacccattaaataaaaaa 70305

>gb|AC102783.10| Mus musculus chromosome 14, clone RP23-390K3, complete sequence
          Length = 199993

 Score = 40.1 bits (20), Expect = 4.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 112   acacacaggacaatgaaccc 131
             ||||||||||||||||||||
Sbjct: 75245 acacacaggacaatgaaccc 75264

>gb|AE004144.1| Vibrio cholerae O1 biovar eltor str. N16961 chromosome I, section 52
            of 251 of the complete chromosome
          Length = 11491

 Score = 40.1 bits (20), Expect = 4.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 268  gatgaaatcttcatccgtga 287
            ||||||||||||||||||||
Sbjct: 4053 gatgaaatcttcatccgtga 4034

>gb|AC109805.8| Mus musculus chromosome 3, clone RP23-91D14, complete sequence
          Length = 171006

 Score = 40.1 bits (20), Expect = 4.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 125   tgaacccattaaataaaaaa 144
             ||||||||||||||||||||
Sbjct: 68398 tgaacccattaaataaaaaa 68417

>emb|AL353803.23| Human DNA sequence from clone RP11-65J3 on chromosome 9 Contains three
             novel genes, the 5' end of a novel gene, a novel
             pseudogene and seven CpG islands, complete sequence
          Length = 165696

 Score = 40.1 bits (20), Expect = 4.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 26    tgcatgcatttttatatgcc 45
             ||||||||||||||||||||
Sbjct: 55321 tgcatgcatttttatatgcc 55340

>emb|AL645760.15| Mouse DNA sequence from clone DN-262D11 on chromosome 3 Contains the 5'
             end of the Man1b gene for mannosidase 1 beta, a pseudogene
             similar to arylsulfatase A (Arsa) and a CpG island,
             complete sequence
          Length = 135825

 Score = 40.1 bits (20), Expect = 4.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 127   aacccattaaataaaaaaca 146
             ||||||||||||||||||||
Sbjct: 17517 aacccattaaataaaaaaca 17536

>gb|AC026403.4| Homo sapiens chromosome 5 clone CTB-63M22, complete sequence
          Length = 138536

 Score = 40.1 bits (20), Expect = 4.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 23    atctgcatgcatttttatat 42
             ||||||||||||||||||||
Sbjct: 18588 atctgcatgcatttttatat 18607

>emb|AL606757.11| Mouse DNA sequence from clone RP23-356K2 on chromosome 3, complete
              sequence
          Length = 127113

 Score = 40.1 bits (20), Expect = 4.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 127    aacccattaaataaaaaaca 146
              ||||||||||||||||||||
Sbjct: 112209 aacccattaaataaaaaaca 112228


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 2,947,207
Number of Sequences: 3902068
Number of extensions: 2947207
Number of successful extensions: 51644
Number of sequences better than 10.0: 11
Number of HSP's better than 10.0 without gapping: 11
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 51629
Number of HSP's gapped (non-prelim): 15
length of query: 359
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 337
effective length of database: 17,147,199,772
effective search space: 5778606323164
effective search space used: 5778606323164
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)