>gb|AC022142.4| Homo sapiens chromosome 5 clone CTD-2341D24, complete sequence
          Length = 173049

 Score = 40.1 bits (20), Expect = 0.68
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 29    aattaaattactactactat 48
             ||||||||||||||||||||
Sbjct: 69595 aattaaattactactactat 69614

>gb|AC016567.8| Homo sapiens chromosome 5 clone CTC-564E20, complete sequence
          Length = 159734

 Score = 40.1 bits (20), Expect = 0.68
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 29   aattaaattactactactat 48
            ||||||||||||||||||||
Sbjct: 2518 aattaaattactactactat 2537

>gb|AC008377.6| Homo sapiens chromosome 5 clone CTC-208O22, complete sequence
          Length = 126454

 Score = 40.1 bits (20), Expect = 0.68
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 29     aattaaattactactactat 48
              ||||||||||||||||||||
Sbjct: 102483 aattaaattactactactat 102464

>gb|AC008653.8|AC008653 Homo sapiens chromosome 5 clone CTB-18M1, complete sequence
          Length = 173049

 Score = 40.1 bits (20), Expect = 0.68
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 29    aattaaattactactactat 48
             ||||||||||||||||||||
Sbjct: 69595 aattaaattactactactat 69614

>gb|AC167563.3| Mus musculus BAC clone RP24-392I11 from chromosome 16, complete
             sequence
          Length = 201682

 Score = 40.1 bits (20), Expect = 0.68
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 28    aaattaaattactactacta 47
             ||||||||||||||||||||
Sbjct: 18493 aaattaaattactactacta 18512

>gb|AC154304.1| Mus musculus BAC clone RP24-491H15 from 16, complete sequence
          Length = 169500

 Score = 40.1 bits (20), Expect = 0.68
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 28     aaattaaattactactacta 47
              ||||||||||||||||||||
Sbjct: 154164 aaattaaattactactacta 154183

>gb|AY149028.1| Plasmodium chabaudi chabaudi strain AS clone YAC101, complete
            sequence
          Length = 80019

 Score = 38.2 bits (19), Expect = 2.7
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                               
Query: 26   ctaaattaaattactacta 44
            |||||||||||||||||||
Sbjct: 2938 ctaaattaaattactacta 2920


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 720,980
Number of Sequences: 3902068
Number of extensions: 720980
Number of successful extensions: 44598
Number of sequences better than 10.0: 7
Number of HSP's better than 10.0 without gapping: 7
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 44585
Number of HSP's gapped (non-prelim): 13
length of query: 69
length of database: 17,233,045,268
effective HSP length: 21
effective length of query: 48
effective length of database: 17,151,101,840
effective search space: 823252888320
effective search space used: 823252888320
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 19 (38.2 bits)