>emb|AL355986.7| Human DNA sequence from clone RP11-516G5 on chromosome 13, complete
             sequence
          Length = 87831

 Score = 42.1 bits (21), Expect = 0.27
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                          
Query: 22    cctttcaatgtggcaaaacaatactaaaa 50
             ||||||||||||||| ||||||| |||||
Sbjct: 72605 cctttcaatgtggcataacaatattaaaa 72577

>gb|AC016657.5| Homo sapiens chromosome 5 clone RP1-6C3, complete sequence
          Length = 128447

 Score = 40.1 bits (20), Expect = 1.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 14    gaacctctcctttcaatgtggcaa 37
             |||||||||||| |||||||||||
Sbjct: 26612 gaacctctccttgcaatgtggcaa 26589

>gb|AE017354.1| Legionella pneumophila subsp. pneumophila str. Philadelphia 1, complete
               genome
          Length = 3397754

 Score = 38.2 bits (19), Expect = 4.3
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                  
Query: 42      atactaaaagcgaatcatt 60
               |||||||||||||||||||
Sbjct: 1643357 atactaaaagcgaatcatt 1643375

>ref|XM_660552.1| Cryptosporidium hominis TU502 hypothetical protein (Chro.30403)
            partial mRNA
          Length = 4264

 Score = 38.2 bits (19), Expect = 4.3
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                   
Query: 23   ctttcaatgtggcaaaacaatac 45
            |||||||| ||||||||||||||
Sbjct: 3019 ctttcaatatggcaaaacaatac 3041

>emb|AL118511.25|HSDJ858B6 Human DNA sequence from clone RP5-858B6 on chromosome 1q42.13-43
             Contains two novel genes, the gene for a novel protein
             (FLJ14525) and a CpG island, complete sequence
          Length = 90175

 Score = 38.2 bits (19), Expect = 4.3
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                    
Query: 1     aatgggcagcactgaacctctcc 23
             |||||||||||||||| ||||||
Sbjct: 52716 aatgggcagcactgaatctctcc 52738

>gb|AC127734.4| Rattus norvegicus 18 BAC CH230-372C24 (Children's Hospital Oakland
              Research Institute) complete sequence
          Length = 166134

 Score = 38.2 bits (19), Expect = 4.3
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 10     cactgaacctctcctttca 28
              |||||||||||||||||||
Sbjct: 123952 cactgaacctctcctttca 123934

>emb|CR628337.1| Legionella pneumophila str. Lens complete genome
          Length = 3345687

 Score = 38.2 bits (19), Expect = 4.3
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                  
Query: 42      atactaaaagcgaatcatt 60
               |||||||||||||||||||
Sbjct: 1716730 atactaaaagcgaatcatt 1716712

>emb|CR628336.1| Legionella pneumophila str. Paris complete genome
          Length = 3503610

 Score = 38.2 bits (19), Expect = 4.3
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                  
Query: 42      atactaaaagcgaatcatt 60
               |||||||||||||||||||
Sbjct: 1607395 atactaaaagcgaatcatt 1607413

>gb|AC067747.7| Homo sapiens chromosome 10 clone RP11-406H21, complete sequence
          Length = 147280

 Score = 38.2 bits (19), Expect = 4.3
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 13    tgaacctctcctttcaatg 31
             |||||||||||||||||||
Sbjct: 50030 tgaacctctcctttcaatg 50012

>gb|AC010482.8| Homo sapiens chromosome 5 clone CTD-2318J2, complete sequence
          Length = 203278

 Score = 38.2 bits (19), Expect = 4.3
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 22     cctttcaatgtggcaaaac 40
              |||||||||||||||||||
Sbjct: 153679 cctttcaatgtggcaaaac 153697

>gb|AF243083.1|F243081S03 Homo sapiens intrinsic factor-vitamin B12 receptor (CUBN) gene,
           exons 5 and 6
          Length = 1728

 Score = 38.2 bits (19), Expect = 4.3
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 13  tgaacctctcctttcaatg 31
           |||||||||||||||||||
Sbjct: 440 tgaacctctcctttcaatg 422

>emb|BX511010.5| Zebrafish DNA sequence from clone CH211-79L20 in linkage group 16,
             complete sequence
          Length = 156317

 Score = 38.2 bits (19), Expect = 4.3
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 28    aatgtggcaaaacaatact 46
             |||||||||||||||||||
Sbjct: 54795 aatgtggcaaaacaatact 54813


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 781,472
Number of Sequences: 3902068
Number of extensions: 781472
Number of successful extensions: 53039
Number of sequences better than 10.0: 12
Number of HSP's better than 10.0 without gapping: 12
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 52976
Number of HSP's gapped (non-prelim): 63
length of query: 97
length of database: 17,233,045,268
effective HSP length: 21
effective length of query: 76
effective length of database: 17,151,101,840
effective search space: 1303483739840
effective search space used: 1303483739840
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 19 (38.2 bits)