>gb|AC051642.5| Homo sapiens chromosome 8, clone RP11-583M2, complete sequence
          Length = 174445

 Score = 46.1 bits (23), Expect = 0.072
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                    
Query: 75    atatgtgttatcaattttacata 97
             |||||||||||||||||||||||
Sbjct: 70850 atatgtgttatcaattttacata 70872

>gb|AC147918.2| Xenopus tropicalis clone CH216-8N16, complete sequence
          Length = 210128

 Score = 46.1 bits (23), Expect = 0.072
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                             
Query: 147    cacttcttctccacttacaacacaaaagctc 177
              |||||||||| ||||| ||||||||||||||
Sbjct: 127584 cacttcttctacacttgcaacacaaaagctc 127614

>gb|AC021539.10| Homo sapiens chromosome 4, clone RP11-460H9, complete sequence
          Length = 191158

 Score = 44.1 bits (22), Expect = 0.28
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                  
Query: 176  tcactgttaatgtcaacatgca 197
            ||||||||||||||||||||||
Sbjct: 5983 tcactgttaatgtcaacatgca 5962

>gb|AC096590.4| Homo sapiens BAC clone RP11-751A18 from 4, complete sequence
          Length = 182559

 Score = 44.1 bits (22), Expect = 0.28
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 176   tcactgttaatgtcaacatgca 197
             ||||||||||||||||||||||
Sbjct: 98308 tcactgttaatgtcaacatgca 98287

>gb|AC008600.7| Homo sapiens chromosome 5 clone CTB-105J5, complete sequence
          Length = 147114

 Score = 44.1 bits (22), Expect = 0.28
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 176   tcactgttaatgtcaacatgca 197
             ||||||||||||||||||||||
Sbjct: 73875 tcactgttaatgtcaacatgca 73854

>ref|XM_649138.1| Entamoeba histolytica HM-1:IMSS nucleolar protein Nop56, putative
           (59.t00019) partial mRNA
          Length = 1362

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 30/33 (90%)
 Strand = Plus / Plus

                                            
Query: 262 cttcattccaagatatcaacaattgcagctaat 294
           ||||||||||||||  ||||||||||| |||||
Sbjct: 835 cttcattccaagatgacaacaattgcacctaat 867

>emb|AL604063.4| Mouse DNA sequence from clone RP23-467J12 on chromosome 11, complete
              sequence
          Length = 146759

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 220    aaaagattcaggatagccaga 240
              |||||||||||||||||||||
Sbjct: 138650 aaaagattcaggatagccaga 138630

>dbj|AK037779.1| Mus musculus 16 days neonate thymus cDNA, RIKEN full-length enriched
            library, clone:A130049D24 product:unclassifiable, full
            insert sequence
          Length = 3278

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 220  aaaagattcaggatagccaga 240
            |||||||||||||||||||||
Sbjct: 3234 aaaagattcaggatagccaga 3254

>gb|AC079150.3| Homo sapiens BAC clone RP11-155F11 from 2, complete sequence
          Length = 174782

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 218    gcaaaagattcaggatagcca 238
              |||||||||||||||||||||
Sbjct: 165811 gcaaaagattcaggatagcca 165791

>emb|CR847548.8| Zebrafish DNA sequence from clone DKEY-185L9 in linkage group 8,
             complete sequence
          Length = 249728

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 247   ggcccagattgactgcttcattcc 270
             ||||||||||| ||||||||||||
Sbjct: 56989 ggcccagattgcctgcttcattcc 56966

>gb|AC024145.34| Homo sapiens 12 BAC RP11-513G19 (Roswell Park Cancer Institute Human
             BAC Library) complete sequence
          Length = 75771

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 145   ttcacttcttctccacttac 164
             ||||||||||||||||||||
Sbjct: 14249 ttcacttcttctccacttac 14230

>dbj|AP008214.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, complete
                sequence
          Length = 28434780

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                            
Query: 141      ccatttcacttcttctccacttacaaca 168
                ||||||||||| ||||||||||| ||||
Sbjct: 11867226 ccatttcacttgttctccacttaaaaca 11867253

>gb|AC117503.8| Homo sapiens 12 BAC RP11-338K17 (Roswell Park Cancer Institute Human BAC
              Library) complete sequence
          Length = 218476

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 261    gcttcattccaagatatcaa 280
              ||||||||||||||||||||
Sbjct: 157576 gcttcattccaagatatcaa 157557

>dbj|AP003918.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, BAC
              clone:OJ1705_A03
          Length = 168689

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                          
Query: 141    ccatttcacttcttctccacttacaaca 168
              ||||||||||| ||||||||||| ||||
Sbjct: 145511 ccatttcacttgttctccacttaaaaca 145538

>dbj|AP005487.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, BAC
             clone:OJ1212_C09
          Length = 120818

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                         
Query: 141   ccatttcacttcttctccacttacaaca 168
             ||||||||||| ||||||||||| ||||
Sbjct: 16371 ccatttcacttgttctccacttaaaaca 16398


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 3,000,816
Number of Sequences: 3902068
Number of extensions: 3000816
Number of successful extensions: 53979
Number of sequences better than 10.0: 15
Number of HSP's better than 10.0 without gapping: 15
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 53949
Number of HSP's gapped (non-prelim): 30
length of query: 334
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 312
effective length of database: 17,147,199,772
effective search space: 5349926328864
effective search space used: 5349926328864
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)