>ref|XM_460527.1| Debaryomyces hansenii CBS767 hypothetical protein (DEHA0F04092g)
           partial mRNA
          Length = 1416

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 100 tccaggatgggagtatatcaa 120
           |||||||||||||||||||||
Sbjct: 51  tccaggatgggagtatatcaa 71

>emb|CR382138.1| Debaryomyces hansenii chromosome F of strain CBS767 of Debaryomyces
              hansenii
          Length = 2336804

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 100    tccaggatgggagtatatcaa 120
              |||||||||||||||||||||
Sbjct: 336491 tccaggatgggagtatatcaa 336511

>emb|CR759746.6| Zebrafish DNA sequence from clone DKEY-253O14 in linkage group 5,
             complete sequence
          Length = 50823

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 49    cttcggagttaaacatgctcc 69
             |||||||||||||||||||||
Sbjct: 37078 cttcggagttaaacatgctcc 37058

>emb|BX000489.8| Zebrafish DNA sequence from clone CH211-215E19, complete sequence
          Length = 201748

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 29     tgaaacaagaaataaattctc 49
              |||||||||||||||||||||
Sbjct: 174095 tgaaacaagaaataaattctc 174075



 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 29     tgaaacaagaaataaattctc 49
              |||||||||||||||||||||
Sbjct: 142868 tgaaacaagaaataaattctc 142848

>emb|CR786570.9| Zebrafish DNA sequence from clone CH211-280H4 in linkage group 1,
             complete sequence
          Length = 74239

 Score = 40.1 bits (20), Expect = 4.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 17    gattattgatgctgaaacaa 36
             ||||||||||||||||||||
Sbjct: 41764 gattattgatgctgaaacaa 41745

>emb|BX511134.8| Zebrafish DNA sequence from clone CH211-134C9 in linkage group 1,
              complete sequence
          Length = 188290

 Score = 40.1 bits (20), Expect = 4.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 17     gattattgatgctgaaacaa 36
              ||||||||||||||||||||
Sbjct: 168542 gattattgatgctgaaacaa 168561

>emb|BX255961.5| Zebrafish DNA sequence from clone DKEY-261N6 in linkage group 9, complete
              sequence
          Length = 176428

 Score = 40.1 bits (20), Expect = 4.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 16     ggattattgatgctgaaaca 35
              ||||||||||||||||||||
Sbjct: 160203 ggattattgatgctgaaaca 160222

>gb|L42023.1| Haemophilus influenzae Rd KW20, complete genome
          Length = 1830138

 Score = 40.1 bits (20), Expect = 4.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 70      cggcacaacaggcatctact 89
               ||||||||||||||||||||
Sbjct: 1520032 cggcacaacaggcatctact 1520051

>emb|BX005212.7| Zebrafish DNA sequence from clone DKEY-221H2 in linkage group 1, complete
              sequence
          Length = 272535

 Score = 40.1 bits (20), Expect = 4.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 17     gattattgatgctgaaacaa 36
              ||||||||||||||||||||
Sbjct: 259536 gattattgatgctgaaacaa 259517

>emb|CT009565.10| M.truncatula DNA sequence from clone MTH2-173F9 on chromosome 3, complete
              sequence
          Length = 151325

 Score = 40.1 bits (20), Expect = 4.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 134    ataaaatatacatttccctt 153
              ||||||||||||||||||||
Sbjct: 137258 ataaaatatacatttccctt 137277


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 2,459,163
Number of Sequences: 3902068
Number of extensions: 2459163
Number of successful extensions: 46723
Number of sequences better than 10.0: 10
Number of HSP's better than 10.0 without gapping: 10
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 46698
Number of HSP's gapped (non-prelim): 25
length of query: 348
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 326
effective length of database: 17,147,199,772
effective search space: 5589987125672
effective search space used: 5589987125672
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)