ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbastl22c12
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1gb|AC110171.29| Mus musculus chromosome 12, clone RP23-400A5, co... 44 0.090
2emb|AL133451.1| Human DNA sequence from clone LL22NC03-120B6 on ... 42 0.35
3emb|AL050347.1|HSN120B6 Human DNA sequence from clone N120B6 on ... 42 0.35
4gb|AC146594.3| Mus musculus BAC clone RP24-155O13 from chromosom... 40 1.4
5emb|AL592549.7| Human DNA sequence from clone RP11-374B16 on chr... 40 1.4
6gb|AC006952.6|AC006952 Homo sapiens chromosome 9, clone hRPK.374... 40 1.4
7emb|AL845364.4| Mouse DNA sequence from clone RP23-301M3 on chro... 40 1.4
8emb|AL583891.15| Mouse DNA sequence from clone RP23-292L2 on chr... 40 1.4
9ref|NM_198871.1| Danio rerio zgc:63569 (zgc:63569), mRNA 38 5.5
10gb|BC054915.1| Danio rerio zgc:63569, mRNA (cDNA clone MGC:63569... 38 5.5
11gb|AC134906.3| Mus musculus BAC clone RP23-361K7 from chromosome... 38 5.5
12gb|AC121940.3| Mus musculus BAC clone RP24-209B21 from chromosom... 38 5.5
13gb|AC151666.15| Medicago truncatula clone mth2-30n15, complete s... 38 5.5
14gb|AC157534.12| Medicago truncatula clone mth2-50p19, complete s... 38 5.5
15emb|AL139080.11| Human DNA sequence from clone RP11-173N17 on ch... 38 5.5
16emb|BX000436.5| Mouse DNA sequence from clone RP23-182F17 on chr... 38 5.5
17ref|NM_143388.1| Drosophila melanogaster CG14527-RA (CG14527), mRNA 38 5.5
18gb|AF281340.1| Oncorhynchus mykiss putative complement factor Bf... 38 5.5
19gb|AC154122.7| Mus musculus chromosome 15, clone RP24-62G16, com... 38 5.5
20gb|AC006170.11|AC006170 Drosophila melanogaster, chromosome 3R, ... 38 5.5
21gb|AC007854.4|AC007854 Drosophila melanogaster, chromosome 3R, r... 38 5.5
22gb|AC156630.6| Mus musculus BAC clone RP24-556B7 from chromosome... 38 5.5
23emb|CR392343.29| Zebrafish DNA sequence from clone CH211-195G6 i... 38 5.5
24gb|AE003767.2| Drosophila melanogaster chromosome 3R, section 10... 38 5.5
25gb|AF089860.1|AF089860 Oncorhynchus mykiss complement factor Bf-... 38 5.5
26gb|U00089.2| Mycoplasma pneumoniae M129, complete genome 38 5.5

>gb|AC110171.29| Mus musculus chromosome 12, clone RP23-400A5, complete sequence
          Length = 188590

 Score = 44.1 bits (22), Expect = 0.090
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 81    acaacaacaaacacctgaagat 102
             ||||||||||||||||||||||
Sbjct: 49894 acaacaacaaacacctgaagat 49915



to top

>emb|AL133451.1| Human DNA sequence from clone LL22NC03-120B6 on chromosome 22 Contains
             GSSs, complete sequence
          Length = 37036

 Score = 42.1 bits (21), Expect = 0.35
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 81    acaacaacaaacacctgaaga 101
             |||||||||||||||||||||
Sbjct: 35911 acaacaacaaacacctgaaga 35931



to top

>emb|AL050347.1|HSN120B6 Human DNA sequence from clone N120B6 on chromosome 22, complete
             sequence
          Length = 37036

 Score = 42.1 bits (21), Expect = 0.35
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 81    acaacaacaaacacctgaaga 101
             |||||||||||||||||||||
Sbjct: 35911 acaacaacaaacacctgaaga 35931



to top

>gb|AC146594.3| Mus musculus BAC clone RP24-155O13 from chromosome 14, complete
             sequence
          Length = 172361

 Score = 40.1 bits (20), Expect = 1.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 81    acaacaacaaacacctgaag 100
             ||||||||||||||||||||
Sbjct: 41720 acaacaacaaacacctgaag 41739



to top

>emb|AL592549.7| Human DNA sequence from clone RP11-374B16 on chromosome 9, complete
              sequence
          Length = 128613

 Score = 40.1 bits (20), Expect = 1.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 25     gagagatcaatgtccagttg 44
              ||||||||||||||||||||
Sbjct: 100226 gagagatcaatgtccagttg 100207



to top

>gb|AC006952.6|AC006952 Homo sapiens chromosome 9, clone hRPK.374_B_16, complete sequence
          Length = 219345

 Score = 40.1 bits (20), Expect = 1.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 25     gagagatcaatgtccagttg 44
              ||||||||||||||||||||
Sbjct: 151551 gagagatcaatgtccagttg 151532



to top

>emb|AL845364.4| Mouse DNA sequence from clone RP23-301M3 on chromosome 4, complete
              sequence
          Length = 205273

 Score = 40.1 bits (20), Expect = 1.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 81     acaacaacaaacacctgaag 100
              ||||||||||||||||||||
Sbjct: 118520 acaacaacaaacacctgaag 118539



to top

>emb|AL583891.15| Mouse DNA sequence from clone RP23-292L2 on chromosome 15, complete
             sequence
          Length = 170132

 Score = 40.1 bits (20), Expect = 1.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 31    tcaatgtccagttgaatcaa 50
             ||||||||||||||||||||
Sbjct: 25135 tcaatgtccagttgaatcaa 25116



to top

>ref|NM_198871.1| Danio rerio zgc:63569 (zgc:63569), mRNA
          Length = 4134

 Score = 38.2 bits (19), Expect = 5.5
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                               
Query: 49   aagatgtcttggctttaat 67
            |||||||||||||||||||
Sbjct: 4004 aagatgtcttggctttaat 4022



to top

>gb|BC054915.1| Danio rerio zgc:63569, mRNA (cDNA clone MGC:63569 IMAGE:3819712),
            complete cds
          Length = 4134

 Score = 38.2 bits (19), Expect = 5.5
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                               
Query: 49   aagatgtcttggctttaat 67
            |||||||||||||||||||
Sbjct: 4004 aagatgtcttggctttaat 4022



to top

>gb|AC134906.3| Mus musculus BAC clone RP23-361K7 from chromosome 19, complete
            sequence
          Length = 192484

 Score = 38.2 bits (19), Expect = 5.5
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                               
Query: 75   cttggtacaacaacaaaca 93
            |||||||||||||||||||
Sbjct: 6116 cttggtacaacaacaaaca 6134



to top

>gb|AC121940.3| Mus musculus BAC clone RP24-209B21 from chromosome 19, complete
             sequence
          Length = 203390

 Score = 38.2 bits (19), Expect = 5.5
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 75    cttggtacaacaacaaaca 93
             |||||||||||||||||||
Sbjct: 94930 cttggtacaacaacaaaca 94948



to top

>gb|AC151666.15| Medicago truncatula clone mth2-30n15, complete sequence
          Length = 116410

 Score = 38.2 bits (19), Expect = 5.5
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 73    tacttggtacaacaacaaa 91
             |||||||||||||||||||
Sbjct: 58314 tacttggtacaacaacaaa 58296



to top

>gb|AC157534.12| Medicago truncatula clone mth2-50p19, complete sequence
          Length = 116410

 Score = 38.2 bits (19), Expect = 5.5
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 73    tacttggtacaacaacaaa 91
             |||||||||||||||||||
Sbjct: 58314 tacttggtacaacaacaaa 58296



to top

>emb|AL139080.11| Human DNA sequence from clone RP11-173N17 on chromosome 13q12.11-12.3
             Contains the 3' end of the MIPEP gene for intermediate
             mitochondrial peptidase and a pseudogene similar to part
             of cytochrome c oxidase III (MTCO3), complete sequence
          Length = 81764

 Score = 38.2 bits (19), Expect = 5.5
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                    
Query: 86    aacaaacacctgaagatgtcttg 108
             |||||||||| ||||||||||||
Sbjct: 18078 aacaaacaccagaagatgtcttg 18100



to top

>emb|BX000436.5| Mouse DNA sequence from clone RP23-182F17 on chromosome 11, complete
             sequence
          Length = 64667

 Score = 38.2 bits (19), Expect = 5.5
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 83    aacaacaaacacctgaaga 101
             |||||||||||||||||||
Sbjct: 46437 aacaacaaacacctgaaga 46455



to top

>ref|NM_143388.1| Drosophila melanogaster CG14527-RA (CG14527), mRNA
          Length = 2103

 Score = 38.2 bits (19), Expect = 5.5
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                              
Query: 81  acaacaacaaacacctgaa 99
           |||||||||||||||||||
Sbjct: 785 acaacaacaaacacctgaa 803



to top

>gb|AF281340.1| Oncorhynchus mykiss putative complement factor Bf-2 mRNA, partial
           cds
          Length = 462

 Score = 38.2 bits (19), Expect = 5.5
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                  
Query: 89  aaacacctgaagatgtcttggct 111
           |||||| ||||||||||||||||
Sbjct: 86  aaacacttgaagatgtcttggct 108



to top

>gb|AC154122.7| Mus musculus chromosome 15, clone RP24-62G16, complete sequence
          Length = 215079

 Score = 38.2 bits (19), Expect = 5.5
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 81     acaacaacaaacacctgaa 99
              |||||||||||||||||||
Sbjct: 121580 acaacaacaaacacctgaa 121562



to top

>gb|AC006170.11|AC006170 Drosophila melanogaster, chromosome 3R, region 98E2-98F2, BAC clone
             BACR48K07, complete sequence
          Length = 168471

 Score = 38.2 bits (19), Expect = 5.5
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 81    acaacaacaaacacctgaa 99
             |||||||||||||||||||
Sbjct: 97278 acaacaacaaacacctgaa 97296



to top

>gb|AC007854.4|AC007854 Drosophila melanogaster, chromosome 3R, region 98F-98F, BAC clone
             BACR13H19, complete sequence
          Length = 155666

 Score = 38.2 bits (19), Expect = 5.5
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 81    acaacaacaaacacctgaa 99
             |||||||||||||||||||
Sbjct: 33109 acaacaacaaacacctgaa 33127



to top

>gb|AC156630.6| Mus musculus BAC clone RP24-556B7 from chromosome 7, complete sequence
          Length = 205753

 Score = 38.2 bits (19), Expect = 5.5
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 61    ctttaattcccatacttgg 79
             |||||||||||||||||||
Sbjct: 65779 ctttaattcccatacttgg 65761



to top

>emb|CR392343.29| Zebrafish DNA sequence from clone CH211-195G6 in linkage group 22,
              complete sequence
          Length = 194465

 Score = 38.2 bits (19), Expect = 5.5
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 42     ttgaatcaagatgtcttgg 60
              |||||||||||||||||||
Sbjct: 169507 ttgaatcaagatgtcttgg 169525



to top

>gb|AE003767.2| Drosophila melanogaster chromosome 3R, section 105 of 118 of the
             complete sequence
          Length = 231562

 Score = 38.2 bits (19), Expect = 5.5
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 81    acaacaacaaacacctgaa 99
             |||||||||||||||||||
Sbjct: 80379 acaacaacaaacacctgaa 80397



to top

>gb|AF089860.1|AF089860 Oncorhynchus mykiss complement factor Bf-2 mRNA, partial cds
          Length = 2388

 Score = 38.2 bits (19), Expect = 5.5
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                  
Query: 89  aaacacctgaagatgtcttggct 111
           |||||| ||||||||||||||||
Sbjct: 906 aaacacttgaagatgtcttggct 928



to top

>gb|U00089.2| Mycoplasma pneumoniae M129, complete genome
          Length = 816394

 Score = 38.2 bits (19), Expect = 5.5
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                    
Query: 78    ggtacaacaacaaacacctgaag 100
             |||||||||||||||||| ||||
Sbjct: 43775 ggtacaacaacaaacaccagaag 43797


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 1,297,209
Number of Sequences: 3902068
Number of extensions: 1297209
Number of successful extensions: 81299
Number of sequences better than 10.0: 26
Number of HSP's better than 10.0 without gapping: 26
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 81247
Number of HSP's gapped (non-prelim): 52
length of query: 120
length of database: 17,233,045,268
effective HSP length: 21
effective length of query: 99
effective length of database: 17,151,101,840
effective search space: 1697959082160
effective search space used: 1697959082160
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 19 (38.2 bits)
to top