>gb|AC010168.6| Homo sapiens 12p12-31.7-32.2 BAC RP11-174G6 (Rosewell Park Cancer
            Institute Human Bac Library) complete sequence
          Length = 104926

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 82   tgaagaccatgggtccccaaa 102
            |||||||||||||||||||||
Sbjct: 7589 tgaagaccatgggtccccaaa 7609

>emb|CR390310.1| Gallus gallus finished cDNA, clone ChEST234p17
          Length = 1645

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 222 gtatgaaaacagccattcctt 242
           |||||||||||||||||||||
Sbjct: 495 gtatgaaaacagccattcctt 475

>gb|AC101684.13| Mus musculus chromosome 1, clone RP23-187I13, complete sequence
          Length = 227440

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 354    tgctcacccacatgctcatc 373
              ||||||||||||||||||||
Sbjct: 100132 tgctcacccacatgctcatc 100113

>gb|AE017354.1| Legionella pneumophila subsp. pneumophila str. Philadelphia 1, complete
               genome
          Length = 3397754

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 290     cataaaatctcctcaaatcg 309
               ||||||||||||||||||||
Sbjct: 2242391 cataaaatctcctcaaatcg 2242410

>emb|CR628337.1| Legionella pneumophila str. Lens complete genome
          Length = 3345687

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 290     cataaaatctcctcaaatcg 309
               ||||||||||||||||||||
Sbjct: 2219850 cataaaatctcctcaaatcg 2219869

>emb|CR628336.1| Legionella pneumophila str. Paris complete genome
          Length = 3503610

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 290     cataaaatctcctcaaatcg 309
               ||||||||||||||||||||
Sbjct: 2246357 cataaaatctcctcaaatcg 2246376

>gb|AC121334.5| Homo sapiens 12 BAC RP11-242C24 (Roswell Park Cancer Institute Human BAC
              Library) complete sequence
          Length = 185847

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 26     ggccaccgtaaataaaaatt 45
              ||||||||||||||||||||
Sbjct: 163574 ggccaccgtaaataaaaatt 163593

>gb|AY941322.1| Glarea lozoyensis polyketide syntase 2 (pks2) gene, complete cds
          Length = 9951

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 383  gtcgctagctggttcagcaa 402
            ||||||||||||||||||||
Sbjct: 4397 gtcgctagctggttcagcaa 4378

>gb|AC079171.22| Homo sapiens X BAC RP11-791M20 (Roswell Park Cancer Institute Human BAC
              Library) complete sequence
          Length = 147895

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 340    tatcggtgtccatttgctca 359
              ||||||||||||||||||||
Sbjct: 144817 tatcggtgtccatttgctca 144836

>emb|BX322614.3| Zebrafish DNA sequence from clone CH211-215G1 in linkage group 16,
              complete sequence
          Length = 199783

 Score = 40.1 bits (20), Expect = 5.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 179    aacactgcaaaaactctcca 198
              ||||||||||||||||||||
Sbjct: 150402 aacactgcaaaaactctcca 150383


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 3,527,588
Number of Sequences: 3902068
Number of extensions: 3527588
Number of successful extensions: 55462
Number of sequences better than 10.0: 10
Number of HSP's better than 10.0 without gapping: 10
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 55400
Number of HSP's gapped (non-prelim): 62
length of query: 413
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 391
effective length of database: 17,147,199,772
effective search space: 6704555110852
effective search space used: 6704555110852
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)