Clone Name | rbastl21h11 |
---|---|
Clone Library Name | barley_pub |
>gb|AC165074.2| Mus musculus BAC clone RP24-501F1 from chromosome 12, complete sequence Length = 166016 Score = 46.1 bits (23), Expect = 0.025 Identities = 23/23 (100%) Strand = Plus / Minus Query: 42 agttgggaaagatcattgcatct 64 ||||||||||||||||||||||| Sbjct: 116206 agttgggaaagatcattgcatct 116184
>gb|AE006367.1| Lactococcus lactis subsp. lactis IL1403 section 129 of 218 of the complete genome Length = 11901 Score = 42.1 bits (21), Expect = 0.38 Identities = 21/21 (100%) Strand = Plus / Minus Query: 8 gttttttgtcaaaaaaggcct 28 ||||||||||||||||||||| Sbjct: 4932 gttttttgtcaaaaaaggcct 4912
>gb|AC087841.4| Mus musculus strain C57BL6/J chromosome 6 clone RP23-415I19, complete sequence Length = 198053 Score = 38.2 bits (19), Expect = 6.0 Identities = 19/19 (100%) Strand = Plus / Minus Query: 35 ggaagggagttgggaaaga 53 ||||||||||||||||||| Sbjct: 67883 ggaagggagttgggaaaga 67865
>gb|AC163353.3| Mus musculus BAC clone RP23-55G7 from chromosome 6, complete sequence Length = 264135 Score = 38.2 bits (19), Expect = 6.0 Identities = 19/19 (100%) Strand = Plus / Plus Query: 34 tggaagggagttgggaaag 52 ||||||||||||||||||| Sbjct: 125176 tggaagggagttgggaaag 125194
>gb|AC007255.4| Homo sapiens BAC clone RP11-550A18 from 7, complete sequence Length = 157092 Score = 38.2 bits (19), Expect = 6.0 Identities = 22/23 (95%) Strand = Plus / Minus Query: 12 tttgtcaaaaaaggcctcatcat 34 ||||||| ||||||||||||||| Sbjct: 125015 tttgtcagaaaaggcctcatcat 124993
>gb|AC123921.3| Mus musculus BAC clone RP24-180J14 from chromosome 8, complete sequence Length = 183936 Score = 38.2 bits (19), Expect = 6.0 Identities = 19/19 (100%) Strand = Plus / Minus Query: 35 ggaagggagttgggaaaga 53 ||||||||||||||||||| Sbjct: 169123 ggaagggagttgggaaaga 169105
>gb|AF271357.1| Oryza sativa (indica cultivar-group) phospholipase D (RPLD4) gene, complete cds Length = 4740 Score = 38.2 bits (19), Expect = 6.0 Identities = 19/19 (100%) Strand = Plus / Plus Query: 35 ggaagggagttgggaaaga 53 ||||||||||||||||||| Sbjct: 43 ggaagggagttgggaaaga 61
>emb|AL590708.18| Human DNA sequence from clone RP11-395P17 on chromosome 9 Contains the PCSCL gene for likely ortholog of rat peroxisomal Ca-dependent solute carrier-like protein (KIAA1896), the PTGES2 gene for prostaglandin E synthase 2 (GBF1, GBF-1, C9orf15, FLJ14038), the LCN2 gene for lipocalin 2 (oncogene 24p3) (NGAL), the C9orf16 gene for chromosome 9 open reading frame 16 (MGC4639, EST00098, FLJ12823), the CIZ1 gene for Cip1-interacting zinc finger protein (LSFR1), the DNM1 gene for dynamin 1 (DNM), the GOLGA2 gene for golgi autoantigen, golgin subfamily a, 2 (GM130, MGC20672), the gene for a novel protein and seven CpG islands, complete sequence Length = 194056 Score = 38.2 bits (19), Expect = 6.0 Identities = 19/19 (100%) Strand = Plus / Plus Query: 43 gttgggaaagatcattgca 61 ||||||||||||||||||| Sbjct: 73111 gttgggaaagatcattgca 73129
>emb|AL158212.15| Human DNA sequence from clone RP11-57H14 on chromosome 10 Contains the 5' end of the TCF7L2 gene for transcription factor 7-like 2 (T-cell specific, HMG-box), two novel genes and two CpG islands, complete sequence Length = 166464 Score = 38.2 bits (19), Expect = 6.0 Identities = 22/23 (95%) Strand = Plus / Plus Query: 57 ttgcatctcccaaggacactagt 79 ||||||||||||||||| ||||| Sbjct: 84490 ttgcatctcccaaggaccctagt 84512
>emb|AL117340.3|HSBA192P3 Human DNA sequence from clone RP11-192P3 on chromosome 10 Contains a novel gene, the 5' end of the TCF8 gene for transcription factor 8 (represses interleukin 2 expression) (BZP,ZEB,ZEB1,AREB6,ZFHEP,NIL-2A,ZFHX1A,NIL-2-A), a pseudogene similar to part of serine palmitoyltransferase, long chain base subunit 1 (SPTLC1) (HSAN, HSN1, LBC1, LCB1, SPT1, SPTI) and two CpG islands, complete sequence Length = 187517 Score = 38.2 bits (19), Expect = 6.0 Identities = 19/19 (100%) Strand = Plus / Plus Query: 97 tctcaagactgacttcctt 115 ||||||||||||||||||| Sbjct: 146276 tctcaagactgacttcctt 146294
>gb|AC007367.3| Homo sapiens BAC clone RP11-518G12 from 2, complete sequence Length = 197278 Score = 38.2 bits (19), Expect = 6.0 Identities = 19/19 (100%) Strand = Plus / Minus Query: 41 gagttgggaaagatcattg 59 ||||||||||||||||||| Sbjct: 57366 gagttgggaaagatcattg 57348
>gb|AF225898.1|AF225898 Homo sapiens BAC clone 13d21, complete sequence Length = 198084 Score = 38.2 bits (19), Expect = 6.0 Identities = 19/19 (100%) Strand = Plus / Plus Query: 97 tctcaagactgacttcctt 115 ||||||||||||||||||| Sbjct: 28688 tctcaagactgacttcctt 28706
>gb|AC103352.8| Mus musculus chromosome 8, clone RP23-418G1, complete sequence Length = 207330 Score = 38.2 bits (19), Expect = 6.0 Identities = 19/19 (100%) Strand = Plus / Minus Query: 35 ggaagggagttgggaaaga 53 ||||||||||||||||||| Sbjct: 39909 ggaagggagttgggaaaga 39891
>emb|AL845318.8| Mouse DNA sequence from clone RP23-326F22 on chromosome 2, complete sequence Length = 202162 Score = 38.2 bits (19), Expect = 6.0 Identities = 19/19 (100%) Strand = Plus / Plus Query: 32 catggaagggagttgggaa 50 ||||||||||||||||||| Sbjct: 79494 catggaagggagttgggaa 79512
>gb|AC132228.3| Mus musculus BAC clone RP24-480G11 from 6, complete sequence Length = 180203 Score = 38.2 bits (19), Expect = 6.0 Identities = 19/19 (100%) Strand = Plus / Plus Query: 34 tggaagggagttgggaaag 52 ||||||||||||||||||| Sbjct: 104076 tggaagggagttgggaaag 104094 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 1,137,075 Number of Sequences: 3902068 Number of extensions: 1137075 Number of successful extensions: 87198 Number of sequences better than 10.0: 15 Number of HSP's better than 10.0 without gapping: 15 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 87171 Number of HSP's gapped (non-prelim): 27 length of query: 128 length of database: 17,233,045,268 effective HSP length: 21 effective length of query: 107 effective length of database: 17,151,101,840 effective search space: 1835167896880 effective search space used: 1835167896880 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 19 (38.2 bits)