ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbastl21e08
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1gb|AC008704.6| Homo sapiens chromosome 5 clone CTB-77C3, complet... 42 0.40
2gb|AC104455.2| Homo sapiens chromosome 1 clone RP4-682E18, compl... 40 1.6
3gb|AC013746.10| Homo sapiens chromosome 8, clone RP11-131P18, co... 40 1.6
4gb|AC067849.6| Homo sapiens chromosome 8, clone RP11-709L14, com... 40 1.6
5dbj|AB005245.2| Arabidopsis thaliana genomic DNA, chromosome 5, ... 40 1.6
6gb|AF114171.1| Sorghum bicolor BAC clone 25.M18, complete sequence 38 6.3
7gb|U41028.1| Caenorhabditis elegans cosmid C25G6, complete sequence 38 6.3
8gb|AC025161.18| Homo sapiens 12 BAC RP11-669B18 (Roswell Park Ca... 38 6.3
9emb|CR382138.1| Debaryomyces hansenii chromosome F of strain CBS... 38 6.3
10emb|AL606506.11| Mouse DNA sequence from clone RP23-11A24 on chr... 38 6.3
11gb|AC092491.6| Homo sapiens 12 BAC RP11-125G9 (Roswell Park Canc... 38 6.3
12emb|BX510928.5| Zebrafish DNA sequence from clone DKEY-190G11 in... 38 6.3
13gb|AC093917.3| Homo sapiens BAC clone RP11-800K23 from 4, comple... 38 6.3
14gb|DP000033.1| Carollia perspicillata target 116 genomic scaffold 38 6.3
15gb|AC149601.3| Medicago truncatula chromosome 7 BAC clone mth2-2... 38 6.3
16gb|AC021850.8|AC021850 Homo sapiens BAC clone RP11-389E17 from 4... 38 6.3
17gb|AC016902.4|AC016902 Homo sapiens BAC clone RP11-217B19 from 1... 38 6.3
18gb|AC106774.2| Homo sapiens chromosome 5 clone RP11-321E2, compl... 38 6.3
19dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic D... 38 6.3
20gb|AC079945.21| Homo sapiens 3 BAC RP11-689D3 (Roswell Park Canc... 38 6.3
21dbj|AP004223.2| Oryza sativa (japonica cultivar-group) genomic D... 38 6.3
22emb|BX005083.10| Zebrafish DNA sequence from clone CH211-220F13 ... 38 6.3
23dbj|AB025641.1| Arabidopsis thaliana genomic DNA, chromosome 5, ... 38 6.3
24emb|AJ242247.1|DDI242247 Daemonorops didymophylla 5S rRNa gene (... 38 6.3
25emb|AJ242246.1|DDI242246 Daemonorops didymophylla 5S rRNa gene (... 38 6.3
26emb|BX247873.15| Zebrafish DNA sequence from clone CH211-198O12 ... 38 6.3
27dbj|AP000802.5| Homo sapiens genomic DNA, chromosome 11 clone:RP... 38 6.3
28emb|AL954297.7| Mouse DNA sequence from clone RP23-53B14 on chro... 38 6.3
29emb|AL449215.3|HS352H24 Homo sapiens chromosome 3 sequence from ... 38 6.3
30dbj|AP003262.3| Oryza sativa (japonica cultivar-group) genomic D... 38 6.3

>gb|AC008704.6| Homo sapiens chromosome 5 clone CTB-77C3, complete sequence
          Length = 95906

 Score = 42.1 bits (21), Expect = 0.40
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 71    aaaattaaaattcactttcct 91
             |||||||||||||||||||||
Sbjct: 79209 aaaattaaaattcactttcct 79229



to top

>gb|AC104455.2| Homo sapiens chromosome 1 clone RP4-682E18, complete sequence
          Length = 125123

 Score = 40.1 bits (20), Expect = 1.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 76    taaaattcactttcctggat 95
             ||||||||||||||||||||
Sbjct: 96443 taaaattcactttcctggat 96462



to top

>gb|AC013746.10| Homo sapiens chromosome 8, clone RP11-131P18, complete sequence
          Length = 212337

 Score = 40.1 bits (20), Expect = 1.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 70     caaaattaaaattcactttc 89
              ||||||||||||||||||||
Sbjct: 149654 caaaattaaaattcactttc 149635



to top

>gb|AC067849.6| Homo sapiens chromosome 8, clone RP11-709L14, complete sequence
          Length = 169453

 Score = 40.1 bits (20), Expect = 1.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 63    acgggggcaaaattaaaatt 82
             ||||||||||||||||||||
Sbjct: 34926 acgggggcaaaattaaaatt 34907



to top

>dbj|AB005245.2| Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MUG13
          Length = 86630

 Score = 40.1 bits (20), Expect = 1.6
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 82    tcactttcctggatctaataatta 105
             |||||||||||||||| |||||||
Sbjct: 20634 tcactttcctggatcttataatta 20611



to top

>gb|AF114171.1| Sorghum bicolor BAC clone 25.M18, complete sequence
          Length = 183990

 Score = 38.2 bits (19), Expect = 6.3
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 60    taaacgggggcaaaattaa 78
             |||||||||||||||||||
Sbjct: 63867 taaacgggggcaaaattaa 63885



to top

>gb|U41028.1| Caenorhabditis elegans cosmid C25G6, complete sequence
          Length = 39643

 Score = 38.2 bits (19), Expect = 6.3
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 74    attaaaattcactttcctg 92
             |||||||||||||||||||
Sbjct: 18284 attaaaattcactttcctg 18302



to top

>gb|AC025161.18| Homo sapiens 12 BAC RP11-669B18 (Roswell Park Cancer Institute Human
             BAC Library) complete sequence
          Length = 83265

 Score = 38.2 bits (19), Expect = 6.3
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 67    gggcaaaattaaaattcac 85
             |||||||||||||||||||
Sbjct: 75932 gggcaaaattaaaattcac 75950



to top

>emb|CR382138.1| Debaryomyces hansenii chromosome F of strain CBS767 of Debaryomyces
               hansenii
          Length = 2336804

 Score = 38.2 bits (19), Expect = 6.3
 Identities = 25/27 (92%)
 Strand = Plus / Minus

                                          
Query: 13      taatctggaataaaactgctgaattga 39
               |||| |||||||||| |||||||||||
Sbjct: 1930609 taatgtggaataaaaatgctgaattga 1930583



to top

>emb|AL606506.11| Mouse DNA sequence from clone RP23-11A24 on chromosome 11 Contains a
              novel pseudogene and two CpG islands, complete sequence
          Length = 213971

 Score = 38.2 bits (19), Expect = 6.3
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 81     ttcactttcctggatctaa 99
              |||||||||||||||||||
Sbjct: 147088 ttcactttcctggatctaa 147070



to top

>gb|AC092491.6| Homo sapiens 12 BAC RP11-125G9 (Roswell Park Cancer Institute Human BAC
             Library) complete sequence
          Length = 103308

 Score = 38.2 bits (19), Expect = 6.3
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 71    aaaattaaaattcactttc 89
             |||||||||||||||||||
Sbjct: 25844 aaaattaaaattcactttc 25826



to top

>emb|BX510928.5| Zebrafish DNA sequence from clone DKEY-190G11 in linkage group 8,
             complete sequence
          Length = 197947

 Score = 38.2 bits (19), Expect = 6.3
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 45    tagcttaaaaatatctaaa 63
             |||||||||||||||||||
Sbjct: 52026 tagcttaaaaatatctaaa 52008



to top

>gb|AC093917.3| Homo sapiens BAC clone RP11-800K23 from 4, complete sequence
          Length = 207691

 Score = 38.2 bits (19), Expect = 6.3
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 77    aaaattcactttcctggat 95
             |||||||||||||||||||
Sbjct: 44425 aaaattcactttcctggat 44407



to top

>gb|DP000033.1| Carollia perspicillata target 116 genomic scaffold
          Length = 347743

 Score = 38.2 bits (19), Expect = 6.3
 Identities = 25/27 (92%)
 Strand = Plus / Minus

                                         
Query: 35     attgattaactagcttaaaaatatcta 61
              |||||| || |||||||||||||||||
Sbjct: 316317 attgataaaatagcttaaaaatatcta 316291



to top

>gb|AC149601.3| Medicago truncatula chromosome 7 BAC clone mth2-28b24, complete
             sequence
          Length = 112486

 Score = 38.2 bits (19), Expect = 6.3
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 71    aaaattaaaattcactttc 89
             |||||||||||||||||||
Sbjct: 11437 aaaattaaaattcactttc 11419



to top

>gb|AC021850.8|AC021850 Homo sapiens BAC clone RP11-389E17 from 4, complete sequence
          Length = 206966

 Score = 38.2 bits (19), Expect = 6.3
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 71    aaaattaaaattcactttc 89
             |||||||||||||||||||
Sbjct: 72050 aaaattaaaattcactttc 72032



to top

>gb|AC016902.4|AC016902 Homo sapiens BAC clone RP11-217B19 from 11, complete sequence
          Length = 184841

 Score = 38.2 bits (19), Expect = 6.3
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 68     ggcaaaattaaaattcact 86
              |||||||||||||||||||
Sbjct: 128885 ggcaaaattaaaattcact 128903



to top

>gb|AC106774.2| Homo sapiens chromosome 5 clone RP11-321E2, complete sequence
          Length = 165958

 Score = 38.2 bits (19), Expect = 6.3
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 39    attaactagcttaaaaata 57
             |||||||||||||||||||
Sbjct: 29433 attaactagcttaaaaata 29451



to top

>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete
                sequence
          Length = 43261740

 Score = 38.2 bits (19), Expect = 6.3
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                       
Query: 28       ctgctgaattgattaactagctt 50
                |||||||||||||||| ||||||
Sbjct: 40521520 ctgctgaattgattaattagctt 40521542



to top

>gb|AC079945.21| Homo sapiens 3 BAC RP11-689D3 (Roswell Park Cancer Institute Human BAC
             Library) complete sequence
          Length = 149249

 Score = 38.2 bits (19), Expect = 6.3
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 64    cgggggcaaaattaaaatt 82
             |||||||||||||||||||
Sbjct: 28457 cgggggcaaaattaaaatt 28475



to top

>dbj|AP004223.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, BAC
             clone:B1033B05
          Length = 138882

 Score = 38.2 bits (19), Expect = 6.3
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                    
Query: 28    ctgctgaattgattaactagctt 50
             |||||||||||||||| ||||||
Sbjct: 83144 ctgctgaattgattaattagctt 83166



to top

>emb|BX005083.10| Zebrafish DNA sequence from clone CH211-220F13 in linkage group 2,
             complete sequence
          Length = 212081

 Score = 38.2 bits (19), Expect = 6.3
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 91    tggatctaataattaatac 109
             |||||||||||||||||||
Sbjct: 89285 tggatctaataattaatac 89267



to top

>dbj|AB025641.1| Arabidopsis thaliana genomic DNA, chromosome 5, BAC clone:T31K7
          Length = 23476

 Score = 38.2 bits (19), Expect = 6.3
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 66    ggggcaaaattaaaattca 84
             |||||||||||||||||||
Sbjct: 18699 ggggcaaaattaaaattca 18717



to top

>emb|AJ242247.1|DDI242247 Daemonorops didymophylla 5S rRNa gene (partial) including
          non-transcribed spacer, clone 3
          Length = 443

 Score = 38.2 bits (19), Expect = 6.3
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                             
Query: 62 aacgggggcaaaattaaaa 80
          |||||||||||||||||||
Sbjct: 68 aacgggggcaaaattaaaa 50



to top

>emb|AJ242246.1|DDI242246 Daemonorops didymophylla 5S rRNa gene (partial) including
          non-transcribed spacer, clone 2
          Length = 443

 Score = 38.2 bits (19), Expect = 6.3
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                             
Query: 62 aacgggggcaaaattaaaa 80
          |||||||||||||||||||
Sbjct: 68 aacgggggcaaaattaaaa 50



to top

>emb|BX247873.15| Zebrafish DNA sequence from clone CH211-198O12 in linkage group 8,
             complete sequence
          Length = 139803

 Score = 38.2 bits (19), Expect = 6.3
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 24    aaaactgctgaattgatta 42
             |||||||||||||||||||
Sbjct: 49102 aaaactgctgaattgatta 49120



to top

>dbj|AP000802.5| Homo sapiens genomic DNA, chromosome 11 clone:RP11-629G13, complete
             sequence
          Length = 183165

 Score = 38.2 bits (19), Expect = 6.3
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 68    ggcaaaattaaaattcact 86
             |||||||||||||||||||
Sbjct: 34492 ggcaaaattaaaattcact 34510



to top

>emb|AL954297.7| Mouse DNA sequence from clone RP23-53B14 on chromosome X, complete
             sequence
          Length = 47163

 Score = 38.2 bits (19), Expect = 6.3
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 71    aaaattaaaattcactttc 89
             |||||||||||||||||||
Sbjct: 29350 aaaattaaaattcactttc 29332



to top

>emb|AL449215.3|HS352H24 Homo sapiens chromosome 3 sequence from BAC 352H24 map 3q21 region
             D3S3607-D3S1587, complete sequence
          Length = 134296

 Score = 38.2 bits (19), Expect = 6.3
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 64    cgggggcaaaattaaaatt 82
             |||||||||||||||||||
Sbjct: 71629 cgggggcaaaattaaaatt 71611



to top

>dbj|AP003262.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC
            clone:P0482D04
          Length = 144583

 Score = 38.2 bits (19), Expect = 6.3
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                   
Query: 28   ctgctgaattgattaactagctt 50
            |||||||||||||||| ||||||
Sbjct: 1535 ctgctgaattgattaattagctt 1557


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 1,888,983
Number of Sequences: 3902068
Number of extensions: 1888983
Number of successful extensions: 126994
Number of sequences better than 10.0: 30
Number of HSP's better than 10.0 without gapping: 30
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 126876
Number of HSP's gapped (non-prelim): 118
length of query: 133
length of database: 17,233,045,268
effective HSP length: 21
effective length of query: 112
effective length of database: 17,151,101,840
effective search space: 1920923406080
effective search space used: 1920923406080
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 19 (38.2 bits)
to top