ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbastl21c02
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1gb|AY532593.1| Triticum aestivum minichromosomal maintenance fac... 210 2e-51
2gb|AY532594.1| Triticum aestivum minichromosomal maintenance fac... 66 8e-08
3gb|AC142351.1| Pan troglodytes BAC clone RP43-21J15 from 7, comp... 40 4.3
4emb|AL365203.19| Human DNA sequence from clone RP11-479G22 on ch... 40 4.3
5gb|AC103949.6| Homo sapiens chromosome 18, clone RP11-671P2, com... 40 4.3
6gb|AC026839.7| Homo sapiens chromosome 5, clone RP11-186B13, com... 40 4.3
7gb|AC108022.3| Homo sapiens BAC clone RP11-9D8 from 4, complete ... 40 4.3
8dbj|AP000040.1| Homo sapiens genomic DNA, chromosome 21q22.1, se... 40 4.3
9gb|AC090059.9| Homo sapiens 12 BAC RP11-604C20 (Roswell Park Can... 40 4.3
10emb|AL954212.1| Pan troglodytes chromosome 22 clone RP43-043L10 ... 40 4.3
11dbj|AP001715.1| Homo sapiens genomic DNA, chromosome 21q, sectio... 40 4.3
12dbj|AP000281.1| Homo sapiens genomic DNA, chromosome 21q22.1, D2... 40 4.3
13dbj|AP000184.1| Homo sapiens genomic DNA, chromosome 21q22.1, D2... 40 4.3
14dbj|AP000108.1| Homo sapiens genomic DNA of 21q22.1, GART and AM... 40 4.3

>gb|AY532593.1| Triticum aestivum minichromosomal maintenance factor (MCM2) gene,
            exons 1 through 18 and complete sequence
          Length = 8809

 Score =  210 bits (106), Expect = 2e-51
 Identities = 161/178 (90%), Gaps = 1/178 (0%)
 Strand = Plus / Minus

                                                                        
Query: 72   gatggcgtcaggtgcatataacactgaattatgacatcaagaaggtacaaacatctctaa 131
            ||||||||||| | |||| ||||||||||||||| |||||||||||||| ||||||| ||
Sbjct: 8259 gatggcgtcagttccata-aacactgaattatgatatcaagaaggtacagacatctcgaa 8201

                                                                        
Query: 132  atgccactggaggcacaagggtttcagatagcaaacagtacaccaacaccagaattcccg 191
            ||||| ||| |||||||||||||||||||||||||||||||||||| | ||||| || | 
Sbjct: 8200 atgccgctgtaggcacaagggtttcagatagcaaacagtacaccaatatcagaactctca 8141

                                                                      
Query: 192  taaaacagacacgagcagtcattctgccaacttacactacaagtggacatttctagct 249
             ||||||||||| |||||||||| |||| |||||||||||||||||||||||||||||
Sbjct: 8140 caaaacagacacaagcagtcattttgccgacttacactacaagtggacatttctagct 8083



 Score = 77.8 bits (39), Expect = 2e-11
 Identities = 48/51 (94%)
 Strand = Plus / Minus

                                                               
Query: 279  ctgaggttgattgagttgttatgctgctactggatgcttgatgatcccacg 329
            |||| |||||||||||||||||||||| ||||||||| |||||||||||||
Sbjct: 8040 ctgatgttgattgagttgttatgctgcaactggatgcctgatgatcccacg 7990



to top

>gb|AY532594.1| Triticum aestivum minichromosomal maintenance factor (MCM2) mRNA,
            complete cds
          Length = 2923

 Score = 65.9 bits (33), Expect = 8e-08
 Identities = 45/49 (91%)
 Strand = Plus / Minus

                                                             
Query: 281  gaggttgattgagttgttatgctgctactggatgcttgatgatcccacg 329
            ||||| |||||||||||||||| || ||||||||| |||||||||||||
Sbjct: 2923 gaggtcgattgagttgttatgccgcaactggatgcctgatgatcccacg 2875



to top

>gb|AC142351.1| Pan troglodytes BAC clone RP43-21J15 from 7, complete sequence
          Length = 159635

 Score = 40.1 bits (20), Expect = 4.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 120    aaacatctctaaatgccact 139
              ||||||||||||||||||||
Sbjct: 104407 aaacatctctaaatgccact 104388



to top

>emb|AL365203.19| Human DNA sequence from clone RP11-479G22 on chromosome 10 Contains the
             3' end of a novel gene (FLJ13031) (FLJ40349), the ITGB1
             gene for integrin beta 1 (fibronectin receptor beta
             polypeptide antigen CD29 includes MDF2 MSK12), an
             adenylate kinase 3 like 1 (AK3L1) pseudogene, a novel
             gene, the 5' end of a novel gene, a NADH dehydrogenase
             subunit 4L (ND4L) pseudogene, a pseudogene similar to part
             of integrin beta 2 (antigen CD18 (p95) lymphocyte
             function-associated antigen 1; macrophage antigen 1
             (mac-1) beta subunit) (ITGB2) and a CpG island, complete
             sequence
          Length = 197973

 Score = 40.1 bits (20), Expect = 4.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 140   ggaggcacaagggtttcaga 159
             ||||||||||||||||||||
Sbjct: 92711 ggaggcacaagggtttcaga 92692



to top

>gb|AC103949.6| Homo sapiens chromosome 18, clone RP11-671P2, complete sequence
          Length = 177301

 Score = 40.1 bits (20), Expect = 4.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 120    aaacatctctaaatgccact 139
              ||||||||||||||||||||
Sbjct: 117250 aaacatctctaaatgccact 117231



to top

>gb|AC026839.7| Homo sapiens chromosome 5, clone RP11-186B13, complete sequence
          Length = 156721

 Score = 40.1 bits (20), Expect = 4.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 120   aaacatctctaaatgccact 139
             ||||||||||||||||||||
Sbjct: 25257 aaacatctctaaatgccact 25276



to top

>gb|AC108022.3| Homo sapiens BAC clone RP11-9D8 from 4, complete sequence
          Length = 162609

 Score = 40.1 bits (20), Expect = 4.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 79    tcaggtgcatataacactga 98
             ||||||||||||||||||||
Sbjct: 18559 tcaggtgcatataacactga 18578



to top

>dbj|AP000040.1| Homo sapiens genomic DNA, chromosome 21q22.1, segment 11/28, complete
             sequence
          Length = 100000

 Score = 40.1 bits (20), Expect = 4.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 300   tgctgctactggatgcttga 319
             ||||||||||||||||||||
Sbjct: 14249 tgctgctactggatgcttga 14268



to top

>gb|AC090059.9| Homo sapiens 12 BAC RP11-604C20 (Roswell Park Cancer Institute Human
             BAC Library) complete sequence
          Length = 130125

 Score = 40.1 bits (20), Expect = 4.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 22    ataatgattgtcccaaaagt 41
             ||||||||||||||||||||
Sbjct: 45587 ataatgattgtcccaaaagt 45606



to top

>emb|AL954212.1| Pan troglodytes chromosome 22 clone RP43-043L10 map 22q22.11, complete
             sequence
          Length = 192328

 Score = 40.1 bits (20), Expect = 4.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 300   tgctgctactggatgcttga 319
             ||||||||||||||||||||
Sbjct: 50412 tgctgctactggatgcttga 50431



to top

>dbj|AP001715.1| Homo sapiens genomic DNA, chromosome 21q, section 59/105
          Length = 340000

 Score = 40.1 bits (20), Expect = 4.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 300    tgctgctactggatgcttga 319
              ||||||||||||||||||||
Sbjct: 179399 tgctgctactggatgcttga 179418



to top

>dbj|AP000281.1| Homo sapiens genomic DNA, chromosome 21q22.1, D21S226-AML region,
             clone:T1588, complete sequence
          Length = 66129

 Score = 40.1 bits (20), Expect = 4.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 300   tgctgctactggatgcttga 319
             ||||||||||||||||||||
Sbjct: 58308 tgctgctactggatgcttga 58327



to top

>dbj|AP000184.1| Homo sapiens genomic DNA, chromosome 21q22.1, D21S226-AML region, clone
             Q78C10-f32E9, segment 11/21, complete sequence
          Length = 100000

 Score = 40.1 bits (20), Expect = 4.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 300   tgctgctactggatgcttga 319
             ||||||||||||||||||||
Sbjct: 20225 tgctgctactggatgcttga 20244



to top

>dbj|AP000108.1| Homo sapiens genomic DNA of 21q22.1, GART and AML related,
             Q78C10-149C3 region, segment 11/20
          Length = 100000

 Score = 40.1 bits (20), Expect = 4.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 300   tgctgctactggatgcttga 319
             ||||||||||||||||||||
Sbjct: 20225 tgctgctactggatgcttga 20244


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 2,423,778
Number of Sequences: 3902068
Number of extensions: 2423778
Number of successful extensions: 46673
Number of sequences better than 10.0: 14
Number of HSP's better than 10.0 without gapping: 14
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 46655
Number of HSP's gapped (non-prelim): 18
length of query: 329
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 307
effective length of database: 17,147,199,772
effective search space: 5264190330004
effective search space used: 5264190330004
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top