ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbastl20h02
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1ref|NM_197633.1| Oryza sativa (japonica cultivar-group) hypothet... 76 1e-10
2gb|AC020666.8| Oryza sativa chromosome 10 BAC OSJNBa0082M15 geno... 76 1e-10
3dbj|AP008216.1| Oryza sativa (japonica cultivar-group) genomic D... 76 1e-10
4dbj|AK103617.1| Oryza sativa (japonica cultivar-group) cDNA clon... 76 1e-10
5dbj|AK066542.1| Oryza sativa (japonica cultivar-group) cDNA clon... 76 1e-10
6dbj|AK062557.1| Oryza sativa (japonica cultivar-group) cDNA clon... 76 1e-10
7gb|AE016959.3| Oryza sativa (japonica cultivar-group) chromosome... 76 1e-10
8ref|XM_801426.1| Trypanosoma cruzi strain CL Brener trans-sialid... 48 0.022
9ref|XM_803301.1| Trypanosoma cruzi strain CL Brener trans-sialid... 48 0.022
10ref|NM_101651.2| Arabidopsis thaliana transcription factor AT1G1... 46 0.088
11ref|XM_482127.1| Oryza sativa (japonica cultivar-group), mRNA 46 0.088
12emb|CR376789.4| Zebrafish DNA sequence from clone DKEYP-87A2 in ... 46 0.088
13gb|AF332407.1| Arabidopsis thaliana putative transcription facto... 46 0.088
14gb|AY079361.1| Arabidopsis thaliana putative transcription facto... 46 0.088
15gb|AY045793.1| Arabidopsis thaliana putative transcription facto... 46 0.088
16gb|AY057667.1| Arabidopsis thaliana At1g17880/F2H15_10 mRNA, com... 46 0.088
17dbj|AP008214.1| Oryza sativa (japonica cultivar-group) genomic D... 46 0.088
18gb|AY084522.1| Arabidopsis thaliana clone 1105 mRNA, complete se... 46 0.088
19gb|AC034106.4|F2H15 Sequence of BAC F2H15 from Arabidopsis thali... 46 0.088
20dbj|AP005489.3| Oryza sativa (japonica cultivar-group) genomic D... 46 0.088
21emb|AJ242970.1|ATH242970 Arabidopsis thaliana mRNA for BTF3b-lik... 46 0.088
22gb|L26049.2|CREODA11X Chlamydomonas reinhardtii dynein heavy cha... 46 0.088
23dbj|AP005795.3| Oryza sativa (japonica cultivar-group) genomic D... 46 0.088
24ref|NM_001036455.1| Arabidopsis thaliana GRF9; protein phosphory... 44 0.35
25ref|NM_129820.2| Arabidopsis thaliana GRF9; protein phosphorylat... 44 0.35
26gb|U60444.3|ATU60444 Arabidopsis thaliana 14-3-3 protein isoform... 44 0.35
27gb|AC119235.13| Mus musculus chromosome 1, clone RP24-212E3, com... 44 0.35
28ref|XM_515337.1| PREDICTED: Pan troglodytes LOC459077 (LOC459077... 44 0.35
29gb|AY548079.1| Symbiezidium transversale voucher Gradstein 9924 ... 44 0.35
30gb|AC096997.3| Takifugu rubripes clone 217A23, complete sequence 44 0.35
31ref|XM_322744.1| Neurospora crassa OR74A predicted protein (NCU0... 44 0.35
32ref|XM_950686.1| Neurospora crassa OR74A hypothetical protein (N... 44 0.35
33ref|NM_018263.3| Homo sapiens additional sex combs like 2 (Droso... 44 0.35
34gb|AC113084.12| Mus musculus chromosome 1, clone RP23-292F19, co... 44 0.35
35gb|BC042999.2| Homo sapiens additional sex combs like 2 (Drosoph... 44 0.35
36emb|AL669988.1|NCB23H20 Neurospora crassa DNA linkage group II B... 44 0.35
37emb|CR933613.1| Homo sapiens mRNA; cDNA DKFZp686C1968 (from clon... 44 0.35
38gb|AY128764.1| Arabidopsis thaliana 14-3-3 regulatory protein (A... 44 0.35
39gb|AC023712.5| Drosophila melanogaster X BAC RP98-1M22 (Roswell ... 44 0.35
40dbj|AB084281.1| Homo sapiens mRNA for chimeric MOZ-ASXH2 fusion ... 44 0.35
41gb|AC104604.7| Drosophila melanogaster X BAC RP98-18K5 (Roswell ... 44 0.35
42gb|AY119457.1| Drosophila melanogaster GH01258 full insert cDNA 44 0.35
43ref|NM_206631.1| Drosophila melanogaster small conductance calci... 44 0.35
44ref|NM_167032.1| Drosophila melanogaster small conductance calci... 44 0.35
45ref|NM_167031.1| Drosophila melanogaster small conductance calci... 44 0.35
46ref|NM_167029.1| Drosophila melanogaster small conductance calci... 44 0.35
47gb|AY093076.1| Arabidopsis thaliana 14-3-3 regulatory protein (A... 44 0.35
48dbj|AK033911.1| Mus musculus adult male diencephalon cDNA, RIKEN... 44 0.35
49dbj|AP008215.1| Oryza sativa (japonica cultivar-group) genomic D... 44 0.35
50dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic D... 44 0.35
51emb|BX820533.1|CNS0A9JA Arabidopsis thaliana Full-length cDNA Co... 44 0.35
52emb|BX818869.1|CNS0A9TI Arabidopsis thaliana Full-length cDNA Co... 44 0.35
53gb|AC093771.3| Homo sapiens BAC clone RP11-121I23 from 4, comple... 44 0.35
54gb|AC010150.3| Homo sapiens BAC clone RP11-404P12 from 2, comple... 44 0.35
55dbj|AB051472.2| Homo sapiens mRNA for KIAA1685 protein, partial cds 44 0.35
56gb|AF190405.1|AF190405 Drosophila virilis homeodomain transcript... 44 0.35
57gb|AY085927.1| Arabidopsis thaliana clone 19749 mRNA, complete s... 44 0.35
58dbj|AP004367.4| Oryza sativa (japonica cultivar-group) genomic D... 44 0.35
59dbj|AP005755.2| Oryza sativa (japonica cultivar-group) genomic D... 44 0.35
60emb|BX647527.1|HSM807673 Homo sapiens mRNA; cDNA DKFZp686F074 (f... 44 0.35
61emb|BX648218.1|HSM808366 Homo sapiens mRNA; cDNA DKFZp686L2369 (... 44 0.35
62dbj|AB084279.1| Homo sapiens ASXH2 mRNA for polycomb group prote... 44 0.35
63gb|AE003434.4| Drosophila melanogaster chromosome X, section 18 ... 44 0.35
64dbj|AB011545.1| Arabidopsis thaliana mRNA for GF14 mu, complete cds 44 0.35
65gb|AY494837.1| Fundulus heteroclitus brain aromatase CYP19A2 mRN... 42 1.4
66ref|NM_001036456.1| Arabidopsis thaliana GRF9; protein phosphory... 42 1.4
67gb|AC139128.6| Mus musculus chromosome 3, clone RP23-100B7, comp... 42 1.4
68gb|AC165289.2| Mus musculus BAC clone RP23-467L11 from chromosom... 42 1.4
69gb|AY461803.1| Oryza sativa (japonica cultivar-group) Dof28 mRNA... 42 1.4
70gb|AC165958.2| Mus musculus BAC clone RP23-417I20 from chromosom... 42 1.4
71ref|XM_474359.1| Oryza sativa (japonica cultivar-group), predic... 42 1.4
72gb|AC169508.1| Mus musculus BAC clone RP23-167I21 from chromosom... 42 1.4
73gb|AY548097.1| Drepanolejeunea biocellata voucher Gradstein 1005... 42 1.4
74gb|AY548096.1| Diplasiolejeunea involuta voucher Schaefer-Verwim... 42 1.4
75gb|AY548092.1| Cheilolejeunea lineata voucher Schaefer-Verwimp 2... 42 1.4
76gb|AY548083.1| Aureolejeunea fulva voucher Costa & Gradstein 384... 42 1.4
77gb|AY548072.1| Myriocolea irrorata voucher Gradstein et al. 1003... 42 1.4
78gb|AY548069.1| Marchesinia brachiata voucher Gradstein et al. 10... 42 1.4
79gb|AF091620.2| Trypanosoma cruzi Tulahuen surface antigen PHGST#... 42 1.4
80gb|AC113485.19| Mus musculus chromosome 19, clone RP23-346D12, c... 42 1.4
81ref|XM_877216.1| PREDICTED: Bos taurus similar to Anion exchange... 42 1.4
82ref|XM_877166.1| PREDICTED: Bos taurus similar to Anion exchange... 42 1.4
83ref|XM_615029.2| PREDICTED: Bos taurus similar to Anion exchange... 42 1.4
84gb|AC158951.5| Mus musculus chromosome 8, clone RP23-265B11, com... 42 1.4
85gb|AF092099.2| Trypanosoma cruzi CL Brener surface antigen PHGST... 42 1.4
86ref|XM_799237.1| Trypanosoma cruzi strain CL Brener trans-sialid... 42 1.4
87ref|XM_799802.1| Trypanosoma cruzi strain CL Brener trans-sialid... 42 1.4
88ref|XM_799975.1| Trypanosoma cruzi strain CL Brener trans-sialid... 42 1.4
89ref|XM_800266.1| Trypanosoma cruzi strain CL Brener trans-sialid... 42 1.4
90ref|XM_800804.1| Trypanosoma cruzi strain CL Brener trans-sialid... 42 1.4
91ref|XM_801039.1| Trypanosoma cruzi strain CL Brener trans-sialid... 42 1.4
92ref|XM_802356.1| Trypanosoma cruzi strain CL Brener trans-sialid... 42 1.4
93ref|XM_803072.1| Trypanosoma cruzi strain CL Brener trans-sialid... 42 1.4
94ref|XM_803469.1| Trypanosoma cruzi strain CL Brener trans-sialid... 42 1.4
95ref|XM_804626.1| Trypanosoma cruzi strain CL Brener trans-sialid... 42 1.4
96ref|XM_810613.1| Trypanosoma cruzi strain CL Brener trans-sialid... 42 1.4
97ref|XM_810614.1| Trypanosoma cruzi strain CL Brener trans-sialid... 42 1.4
98ref|XM_811278.1| Trypanosoma cruzi strain CL Brener trans-sialid... 42 1.4
99ref|XM_804731.1| Trypanosoma cruzi strain CL Brener trans-sialid... 42 1.4
100ref|XM_798248.1| Trypanosoma cruzi strain CL Brener trans-sialid... 42 1.4
101gb|AC131116.3| Mus musculus BAC clone RP24-344M21 from chromosom... 42 1.4
102emb|AL512601.18| Human DNA sequence from clone RP11-500B3 on chr... 42 1.4
103emb|AL445986.14| Human DNA sequence from clone RP11-310F24 on ch... 42 1.4
104emb|AL604029.12| Mouse DNA sequence from clone RP23-155J3 on chr... 42 1.4
105emb|AL606668.2|OSJN00083 Oryza sativa genomic DNA, chromosome 4,... 42 1.4
106gb|AC100322.8| Mus musculus chromosome 7, clone RP23-124O24, com... 42 1.4
107gb|U87077.1|LCU87077 Lunularia cruciata ribulose-1,5-bisphosphat... 42 1.4
108emb|BX324121.9| Zebrafish DNA sequence from clone DKEY-164J20 in... 42 1.4
109dbj|AK092650.1| Homo sapiens cDNA FLJ35331 fis, clone PROST2014659 42 1.4
110emb|CR605890.1| full-length cDNA clone CS0DA012YP15 of Neuroblas... 42 1.4
111gb|AC069544.9| Homo sapiens chromosome 10 clone RP11-398C13, com... 42 1.4
112ref|NM_142225.2| Drosophila melanogaster CG5404-RA (CG5404), mRNA 42 1.4
113gb|AC007087.7| Arabidopsis thaliana chromosome 2 clone F14N22 ma... 42 1.4
114gb|AY060780.1| Drosophila melanogaster GH25012 full length cDNA 42 1.4
115gb|AY054165.1| Arabidopsis thaliana At2g42590/F14N22.14 mRNA, co... 42 1.4
116gb|AC158130.7| Mus musculus chromosome 19, clone RP24-360F11, co... 42 1.4
117gb|AC154731.2| Mus musculus BAC clone RP23-121M22 from chromosom... 42 1.4
118gb|AC160137.2| Mus musculus BAC clone RP23-136A1 from chromosome... 42 1.4
119gb|AC002472.8| Homo sapiens Chromosome 22q11.2 PAC Clone p_n5 In... 42 1.4
120gb|AC002470.17| Homo sapiens Chromosome 22q11.2 BAC Clone b135h6... 42 1.4
121ref|NM_074465.1| Caenorhabditis elegans F21A3.5 (F21A3.5) mRNA, ... 42 1.4
122dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic D... 42 1.4
123dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic D... 42 1.4
124gb|BC092399.1| Mus musculus centromere protein J, mRNA (cDNA clo... 42 1.4
125gb|AC159150.5| Mus musculus BAC RP23-339M5 (Roswell Park Cancer... 42 1.4
126gb|AF133300.2|AF133300 Mus musculus MOR 3'Beta1, MOR 3'Beta2, MO... 42 1.4
127dbj|AP005009.3| Oryza sativa (japonica cultivar-group) genomic D... 42 1.4
128gb|AC117729.9| Mus musculus chromosome 8, clone RP24-126M11, com... 42 1.4
129dbj|AK107524.1| Oryza sativa (japonica cultivar-group) cDNA clon... 42 1.4
130gb|AC154837.2| Mus musculus BAC clone RP24-576O2 from 14, comple... 42 1.4
131gb|AF145301.1|AF145301 Arabidopsis thaliana 14-3-3 protein GF14 ... 42 1.4
132emb|AL732349.2| Oryza sativa genomic DNA, chromosome 4, BAC clon... 42 1.4
133emb|AL732353.1| Oryza sativa genomic DNA, chromosome 4, BAC clon... 42 1.4
134emb|Z81509.1|CEF21A3 Caenorhabditis elegans Cosmid F21A3, comple... 42 1.4
135gb|AC006414.6|AC006414 Drosophila melanogaster, chromosome 3R, r... 42 1.4
136gb|AE003710.2| Drosophila melanogaster chromosome 3R, section 48... 42 1.4
137emb|AL953857.7| Zebrafish DNA sequence from clone CH211-127M7, c... 42 1.4
138emb|CT030702.11| Mouse DNA sequence from clone RP23-76I16 on chr... 42 1.4
139ref|NM_001014996.1| Mus musculus centromere protein J (Cenpj), mRNA 42 1.4
140gb|M92046.1|M92046 Trypanosoma cruzi CAI Tc13 surface antigen ge... 42 1.4
141gb|AC161435.7| Mus musculus chromosome 8, clone RP23-78L21, comp... 40 5.4
142ref|XM_525563.1| PREDICTED: Pan troglodytes similar to solute ca... 40 5.4
143ref|XM_476017.1| Oryza sativa (japonica cultivar-group), predic... 40 5.4
144ref|XM_466223.1| Oryza sativa (japonica cultivar-group), mRNA 40 5.4
145ref|XM_506827.1| PREDICTED Oryza sativa (japonica cultivar-group... 40 5.4
146gb|AC013255.5| Drosophila melanogaster clone BACR27A22, complete... 40 5.4
147gb|AC009843.9| Drosophila melanogaster clone BACR01G11, complete... 40 5.4
148gb|AY666071.1| Nephila pilipes clone NP-RTPD08 dragline silk spi... 40 5.4
149gb|AY666070.1| Nephila pilipes clone NP-RTPD03 dragline silk spi... 40 5.4
150gb|AY666069.1| Nephila pilipes clone NP-RTPD01 dragline silk spi... 40 5.4
151gb|AC120144.11| Mus musculus chromosome 8, clone RP24-427K8, com... 40 5.4
152gb|AC157598.4| Mus musculus BAC clone RP23-193D3 from chromosome... 40 5.4
153gb|AC118255.32| Mus musculus chromosome 8, clone RP24-89A4, comp... 40 5.4
154gb|AC135421.3| Oryza sativa (japonica cultivar-group) chromosome... 40 5.4
155gb|AC007818.8| Drosophila melanogaster clone BACR02M05, complete... 40 5.4
156gb|AC008225.4| Drosophila melanogaster clone BACR03E11, complete... 40 5.4
157gb|AC091499.2| Drosophila melanogaster clone BACR33L22, complete... 40 5.4
158ref|XM_456580.1| Debaryomyces hansenii CBS767 hypothetical prote... 40 5.4
159ref|XM_610880.2| PREDICTED: Bos taurus similar to ADAM metallope... 40 5.4
160ref|NM_001083.3| Homo sapiens phosphodiesterase 5A, cGMP-specifi... 40 5.4
161gb|AC130728.2| Oryza sativa (japonica cultivar-group) chromosome... 40 5.4
162gb|DQ379381.1| Latrodectus hesperus major ampullate spidroin 1 g... 40 5.4
163ref|NM_015023.2| Homo sapiens WD and tetratricopeptide repeats 1... 40 5.4
164ref|XM_797976.1| Trypanosoma cruzi strain CL Brener hypothetical... 40 5.4
165ref|XM_799449.1| Trypanosoma cruzi strain CL Brener trans-sialid... 40 5.4
166ref|XM_799724.1| Trypanosoma cruzi strain CL Brener trans-sialid... 40 5.4
167ref|XM_800617.1| Trypanosoma cruzi strain CL Brener trans-sialid... 40 5.4
168ref|XM_800788.1| Trypanosoma cruzi strain CL Brener trans-sialid... 40 5.4
169ref|XM_801334.1| Trypanosoma cruzi strain CL Brener trans-sialid... 40 5.4
170ref|XM_801836.1| Trypanosoma cruzi strain CL Brener trans-sialid... 40 5.4
171ref|XM_802226.1| Trypanosoma cruzi strain CL Brener trans-sialid... 40 5.4
172ref|XM_802448.1| Trypanosoma cruzi strain CL Brener trans-sialid... 40 5.4
173gb|AC122863.4| Mus musculus BAC clone RP23-142A14 from chromosom... 40 5.4
174ref|XM_805047.1| Trypanosoma cruzi strain CL Brener trans-sialid... 40 5.4
175ref|XM_805296.1| Trypanosoma cruzi strain CL Brener trans-sialid... 40 5.4
176ref|XM_805298.1| Trypanosoma cruzi strain CL Brener trans-sialid... 40 5.4
177ref|XM_807453.1| Trypanosoma cruzi strain CL Brener trans-sialid... 40 5.4
178ref|XM_807863.1| Trypanosoma cruzi strain CL Brener trans-sialid... 40 5.4
179ref|XM_810100.1| Trypanosoma cruzi strain CL Brener trans-sialid... 40 5.4
180ref|XM_811550.1| Trypanosoma cruzi strain CL Brener trans-sialid... 40 5.4
181ref|XM_811629.1| Trypanosoma cruzi strain CL Brener mucin-associ... 40 5.4
182ref|XM_812072.1| Trypanosoma cruzi strain CL Brener trans-sialid... 40 5.4
183gb|AC122537.4| Mus musculus BAC clone RP24-548A15 from chromosom... 40 5.4
184ref|XM_816676.1| Trypanosoma cruzi strain CL Brener trans-sialid... 40 5.4
185ref|XM_813870.1| Trypanosoma cruzi strain CL Brener trans-sialid... 40 5.4
186gb|AC125059.4| Mus musculus BAC clone RP23-404P13 from chromosom... 40 5.4
187ref|XM_798237.1| Trypanosoma cruzi strain CL Brener trans-sialid... 40 5.4
188ref|XM_799130.1| Trypanosoma cruzi strain CL Brener trans-sialid... 40 5.4
189ref|XM_800290.1| Trypanosoma cruzi strain CL Brener trans-sialid... 40 5.4
190gb|AC122254.4| Mus musculus BAC clone RP23-171M24 from 3, comple... 40 5.4
191ref|XM_801651.1| Trypanosoma cruzi strain CL Brener trans-sialid... 40 5.4
192gb|AC125408.3| Mus musculus BAC clone RP23-94M23 from 3, complet... 40 5.4
193ref|XM_730160.1| Plasmodium chabaudi chabaudi hypothetical prote... 40 5.4
194ref|XM_739294.1| Plasmodium chabaudi chabaudi hypothetical prote... 40 5.4
195emb|AL663123.1| Human DNA sequence from clone RP11-4K3 on chromo... 40 5.4
196emb|AL512426.9| Human DNA sequence from clone RP11-94K8 on chrom... 40 5.4
197ref|XM_503853.1| Yarrowia lipolytica CLIB122, YALI0E12199g predi... 40 5.4
198gb|AY953075.1| Latrodectus hesperus isolate LT57 major ampullate... 40 5.4
199emb|CR382133.1| Debaryomyces hansenii chromosome A of strain CBS... 40 5.4
200gb|AC159230.2| Mus musculus BAC clone RP24-378I19 from chromosom... 40 5.4
201gb|AC159330.9| Mus musculus 10 BAC RP23-91L18 (Roswell Park Canc... 40 5.4
202gb|BC032523.1| Homo sapiens WD and tetratricopeptide repeats 1, ... 40 5.4
203emb|CR388401.7| Zebrafish DNA sequence from clone DKEYP-64A2 in ... 40 5.4
204gb|AC127343.3| Mus musculus BAC clone RP23-194I18 from chromosom... 40 5.4
205gb|AF106962.2| Volvox carteri f. nagariensis RlsA (rlsA) gene, p... 40 5.4
206dbj|BA000038.2| Vibrio vulnificus YJ016 DNA, chromosome II, comp... 40 5.4
207dbj|AB028960.1| Homo sapiens mRNA for KIAA1037 protein, partial cds 40 5.4
208gb|AC091211.3| Drosophila melanogaster 3L BAC RP98-26E12 (Roswel... 40 5.4
209gb|AC091228.3| Drosophila melanogaster 3L BAC RP98-10L9 (Roswell... 40 5.4
210gb|AC104625.2| Drosophila melanogaster X BAC RP98-48G8 (Roswell ... 40 5.4
211dbj|AK091302.1| Homo sapiens cDNA FLJ33983 fis, clone DFNES2004684 40 5.4
212gb|AC023721.3| Drosophila melanogaster X BAC RP98-5L4 (Roswell P... 40 5.4
213dbj|AK023778.1| Homo sapiens cDNA FLJ13716 fis, clone PLACE20004... 40 5.4
214dbj|AK023101.1| Homo sapiens cDNA FLJ13039 fis, clone NT2RP30012... 40 5.4
215gb|DQ409058.1| Latrodectus hesperus major ampullate spidroin 2 (... 40 5.4
216ref|NM_206286.1| Drosophila melanogaster CG10107-RC, transcript ... 40 5.4
217ref|NM_170350.1| Drosophila melanogaster barentsz CG12878-RB, tr... 40 5.4
218dbj|AB001635.2| Homo sapiens PDE5 gene for cGMP-binding cGMP-spe... 40 5.4
219ref|NM_141446.1| Drosophila melanogaster CG10055-RA (CG10055), mRNA 40 5.4
220ref|NM_139799.3| Drosophila melanogaster CG10107-RA, transcript ... 40 5.4
221gb|AY016022.1| Mus musculus clone 33L10 alpha globin gene cluste... 40 5.4
222gb|AC080089.5| Homo sapiens BAC clone RP11-785J10 from 4, comple... 40 5.4
223emb|BX813317.11| Mouse DNA sequence from clone RP24-297H17 on ch... 40 5.4
224gb|AE003821.4| Drosophila melanogaster chromosome 2R, section 29... 40 5.4
225gb|AC114612.13| Mus musculus chromosome 7, clone RP24-80O23, com... 40 5.4
226dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic D... 40 5.4
227dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic D... 40 5.4
228gb|AC008217.5|AC008217 Drosophila melanogaster, chromosome 3R, r... 40 5.4
229gb|AC007084.7|AC007084 Drosophila melanogaster, chromosome 2R, r... 40 5.4
230gb|AC008029.3|AC008029 Drosophila melanogaster, chromosome 3R, r... 40 5.4
231gb|AC011253.4|AC011253 Drosophila melanogaster, chromosome 3R, r... 40 5.4
232gb|AF319172.1|AF319172 Homo sapiens cGMP-specific phosphodiester... 40 5.4
233gb|AC027688.5| Homo sapiens chromosome 16 clone RP11-883G14, com... 40 5.4
234ref|NM_001015470.1| Drosophila melanogaster CG40298-PA.3 (CG4029... 40 5.4
235gb|AF106963.1|AF106963 Volvox carteri f. nagariensis somatic reg... 40 5.4
236gb|AY857182.2| HIV-1 isolate 9762120 from Australia, partial genome 40 5.4
237dbj|AP003339.4| Oryza sativa (japonica cultivar-group) genomic D... 40 5.4
238dbj|AP001129.1| Oryza sativa (japonica cultivar-group) genomic D... 40 5.4
239dbj|AP005808.3| Oryza sativa (japonica cultivar-group) genomic D... 40 5.4
240gb|AF155192.1|AF155192 Homo sapiens cGMP-specific phosphodiester... 40 5.4
241gb|AF155195.1|AF155195 Homo sapiens cGMP-specific phosphodiester... 40 5.4
242ref|XM_313332.2| Anopheles gambiae str. PEST ENSANGP00000011295 ... 40 5.4
243gb|AF149233.1|CLRHII2 Columba livia RH2 opsin (rhs) gene, exons ... 40 5.4
244dbj|AK072154.1| Oryza sativa (japonica cultivar-group) cDNA clon... 40 5.4
245dbj|AK071331.1| Oryza sativa (japonica cultivar-group) cDNA clon... 40 5.4
246dbj|AK070645.1| Oryza sativa (japonica cultivar-group) cDNA clon... 40 5.4
247dbj|AK069453.1| Oryza sativa (japonica cultivar-group) cDNA clon... 40 5.4
248gb|AF111672.1|AF111672 Meleagris gallopavo clone TUCA952 microsa... 40 5.4
249gb|AC007453.1|AC007453 Drosophila melanogaster, chromosome 2R, r... 40 5.4
250gb|AE003762.4| Drosophila melanogaster chromosome 3R, section 10... 40 5.4
251gb|AE003672.4| Drosophila melanogaster chromosome 3R, section 12... 40 5.4
252gb|AE003671.4| Drosophila melanogaster chromosome 3R, section 13... 40 5.4
253gb|AE003839.4| Drosophila melanogaster chromosome 2R, section 11... 40 5.4
254gb|AE003561.3| Drosophila melanogaster chromosome 3L, section 24... 40 5.4
255gb|AE003489.2| Drosophila melanogaster chromosome X, section 41 ... 40 5.4
256gb|AE002665.5| Drosophila melanogaster chromosome 3L, section 83... 40 5.4
257gb|CP000102.1| Methanosphaera stadtmanae DSM 3091, complete genome 40 5.4
258gb|AE016796.1| Vibrio vulnificus CMCP6 chromosome II, complete s... 40 5.4
259gb|AF043731.1|AF043731 Homo sapiens cGMP-binding cGMP-specific 3... 40 5.4
260gb|AC174644.2| Mus musculus BAC clone RP23-432C18 from chromosom... 40 5.4
261gb|AY288492.1| Lepus granatensis immunoglobulin heavy chain vari... 40 5.4
262gb|AY288488.1| Lepus granatensis immunoglobulin heavy chain vari... 40 5.4
263emb|CT030156.9| Mouse DNA sequence from clone RP23-191J8 on chro... 40 5.4
264gb|AC126804.3| Mus musculus BAC clone RP23-3F1 from 9, complete ... 40 5.4
265emb|CR382131.1| Yarrowia lipolytica chromosome E of strain CLIB ... 40 5.4
266gb|DQ059134.1|DQ059133S2 Latrodectus geometricus major ampullate... 40 5.4
267emb|AJ004865.1|HSPDE5A1 Homo sapiens mRNA for cGMP-binding, cGMP... 40 5.4
268gb|M79333.1|MZEBT1A Zea mays brittle-1 protein (bt1) mRNA, compl... 40 5.4
269gb|M64836.1|TRB85KD Trypanosoma cruzi 85 kD surface antigen (gp8... 40 5.4
270dbj|AP000782.3| Homo sapiens genomic DNA, chromosome 8q23, clone... 40 5.4
271dbj|D89094.1| Homo sapiens mRNA for 3',5'-cyclic GMP phosphodies... 40 5.4
272dbj|AP001575.3| Homo sapiens genomic DNA, chromosome 8q23, clone... 40 5.4
273dbj|AB017581.1| Homo sapiens gene for cGMP-binding cGMP-specific... 40 5.4

>ref|NM_197633.1| Oryza sativa (japonica cultivar-group) hypothetical protein
            (OSJNBa0082M15.22), mRNA
          Length = 3246

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 47/50 (94%)
 Strand = Plus / Minus

                                                              
Query: 285  tccagtacctggagcacgacgggttctggtgtatcgccctcagaagccac 334
            |||||||||| ||||||||||||||| ||||||||||||| |||||||||
Sbjct: 3217 tccagtacctagagcacgacgggttcaggtgtatcgccctgagaagccac 3168



to top

>gb|AC020666.8| Oryza sativa chromosome 10 BAC OSJNBa0082M15 genomic sequence, complete
              sequence
          Length = 158550

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 47/50 (94%)
 Strand = Plus / Minus

                                                                
Query: 285    tccagtacctggagcacgacgggttctggtgtatcgccctcagaagccac 334
              |||||||||| ||||||||||||||| ||||||||||||| |||||||||
Sbjct: 137342 tccagtacctagagcacgacgggttcaggtgtatcgccctgagaagccac 137293



to top

>dbj|AP008216.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 10, complete
                sequence
          Length = 22685906

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 47/50 (94%)
 Strand = Plus / Plus

                                                                  
Query: 285      tccagtacctggagcacgacgggttctggtgtatcgccctcagaagccac 334
                |||||||||| ||||||||||||||| ||||||||||||| |||||||||
Sbjct: 20927049 tccagtacctagagcacgacgggttcaggtgtatcgccctgagaagccac 20927098



to top

>dbj|AK103617.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033133L07, full
            insert sequence
          Length = 3864

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 47/50 (94%)
 Strand = Plus / Minus

                                                              
Query: 285  tccagtacctggagcacgacgggttctggtgtatcgccctcagaagccac 334
            |||||||||| ||||||||||||||| ||||||||||||| |||||||||
Sbjct: 3659 tccagtacctagagcacgacgggttcaggtgtatcgccctgagaagccac 3610



to top

>dbj|AK066542.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013069N05, full
            insert sequence
          Length = 2734

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 47/50 (94%)
 Strand = Plus / Minus

                                                              
Query: 285  tccagtacctggagcacgacgggttctggtgtatcgccctcagaagccac 334
            |||||||||| ||||||||||||||| ||||||||||||| |||||||||
Sbjct: 2564 tccagtacctagagcacgacgggttcaggtgtatcgccctgagaagccac 2515



to top

>dbj|AK062557.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-042-H02, full
            insert sequence
          Length = 2018

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 47/50 (94%)
 Strand = Plus / Minus

                                                              
Query: 285  tccagtacctggagcacgacgggttctggtgtatcgccctcagaagccac 334
            |||||||||| ||||||||||||||| ||||||||||||| |||||||||
Sbjct: 1673 tccagtacctagagcacgacgggttcaggtgtatcgccctgagaagccac 1624



to top

>gb|AE016959.3| Oryza sativa (japonica cultivar-group) chromosome 10, complete sequence
          Length = 22698374

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 47/50 (94%)
 Strand = Plus / Plus

                                                                  
Query: 285      tccagtacctggagcacgacgggttctggtgtatcgccctcagaagccac 334
                |||||||||| ||||||||||||||| ||||||||||||| |||||||||
Sbjct: 20938313 tccagtacctagagcacgacgggttcaggtgtatcgccctgagaagccac 20938362



to top

>ref|XM_801426.1| Trypanosoma cruzi strain CL Brener trans-sialidase
            (Tc00.1047053508481.10) partial mRNA
          Length = 2739

 Score = 48.1 bits (24), Expect = 0.022
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                    
Query: 364  ctgctgctgcttcttctgctgggg 387
            ||||||||||||||||||||||||
Sbjct: 2692 ctgctgctgcttcttctgctgggg 2715



to top

>ref|XM_803301.1| Trypanosoma cruzi strain CL Brener trans-sialidase
            (Tc00.1047053511547.20) partial mRNA
          Length = 2739

 Score = 48.1 bits (24), Expect = 0.022
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                    
Query: 364  ctgctgctgcttcttctgctgggg 387
            ||||||||||||||||||||||||
Sbjct: 2692 ctgctgctgcttcttctgctgggg 2715



to top

>ref|NM_101651.2| Arabidopsis thaliana transcription factor AT1G17880 mRNA, complete
           cds
          Length = 731

 Score = 46.1 bits (23), Expect = 0.088
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 358 caccagctgctgctgcttcttct 380
           |||||||||||||||||||||||
Sbjct: 561 caccagctgctgctgcttcttct 583



to top

>ref|XM_482127.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 387

 Score = 46.1 bits (23), Expect = 0.088
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 357 ccaccagctgctgctgcttcttc 379
           |||||||||||||||||||||||
Sbjct: 52  ccaccagctgctgctgcttcttc 30



to top

>emb|CR376789.4| Zebrafish DNA sequence from clone DKEYP-87A2 in linkage group 6,
             complete sequence
          Length = 190610

 Score = 46.1 bits (23), Expect = 0.088
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                    
Query: 99    tagagggaaatgttagaaagaaa 121
             |||||||||||||||||||||||
Sbjct: 47056 tagagggaaatgttagaaagaaa 47078



to top

>gb|AF332407.1| Arabidopsis thaliana putative transcription factor (At1g17880)
           mRNA, complete cds
          Length = 498

 Score = 46.1 bits (23), Expect = 0.088
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 358 caccagctgctgctgcttcttct 380
           |||||||||||||||||||||||
Sbjct: 473 caccagctgctgctgcttcttct 495



to top

>gb|AY079361.1| Arabidopsis thaliana putative transcription factor (At1g17880)
           mRNA, complete cds
          Length = 529

 Score = 46.1 bits (23), Expect = 0.088
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 358 caccagctgctgctgcttcttct 380
           |||||||||||||||||||||||
Sbjct: 473 caccagctgctgctgcttcttct 495



to top

>gb|AY045793.1| Arabidopsis thaliana putative transcription factor (At1g17880)
           mRNA, complete cds
          Length = 740

 Score = 46.1 bits (23), Expect = 0.088
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 358 caccagctgctgctgcttcttct 380
           |||||||||||||||||||||||
Sbjct: 559 caccagctgctgctgcttcttct 581



to top

>gb|AY057667.1| Arabidopsis thaliana At1g17880/F2H15_10 mRNA, complete cds
          Length = 728

 Score = 46.1 bits (23), Expect = 0.088
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 358 caccagctgctgctgcttcttct 380
           |||||||||||||||||||||||
Sbjct: 561 caccagctgctgctgcttcttct 583



to top

>dbj|AP008214.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, complete
                sequence
          Length = 28434780

 Score = 46.1 bits (23), Expect = 0.088
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                       
Query: 357      ccaccagctgctgctgcttcttc 379
                |||||||||||||||||||||||
Sbjct: 18018978 ccaccagctgctgctgcttcttc 18018956



to top

>gb|AY084522.1| Arabidopsis thaliana clone 1105 mRNA, complete sequence
          Length = 604

 Score = 46.1 bits (23), Expect = 0.088
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 358 caccagctgctgctgcttcttct 380
           |||||||||||||||||||||||
Sbjct: 561 caccagctgctgctgcttcttct 583



to top

>gb|AC034106.4|F2H15 Sequence of BAC F2H15 from Arabidopsis thaliana chromosome 1, complete
             sequence
          Length = 75133

 Score = 46.1 bits (23), Expect = 0.088
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                    
Query: 358   caccagctgctgctgcttcttct 380
             |||||||||||||||||||||||
Sbjct: 33608 caccagctgctgctgcttcttct 33586



to top

>dbj|AP005489.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, BAC
              clone:OSJNBa0013H03
          Length = 152998

 Score = 46.1 bits (23), Expect = 0.088
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                     
Query: 357    ccaccagctgctgctgcttcttc 379
              |||||||||||||||||||||||
Sbjct: 104013 ccaccagctgctgctgcttcttc 103991



to top

>emb|AJ242970.1|ATH242970 Arabidopsis thaliana mRNA for BTF3b-like factor
          Length = 630

 Score = 46.1 bits (23), Expect = 0.088
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 358 caccagctgctgctgcttcttct 380
           |||||||||||||||||||||||
Sbjct: 527 caccagctgctgctgcttcttct 549



to top

>gb|L26049.2|CREODA11X Chlamydomonas reinhardtii dynein heavy chain alpha (ODA11) gene,
            complete cds
          Length = 17941

 Score = 46.1 bits (23), Expect = 0.088
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                       
Query: 345  tctgcatcgtctccaccagctgctgct 371
            ||||||| |||||||||||||||||||
Sbjct: 2610 tctgcatggtctccaccagctgctgct 2636



to top

>dbj|AP005795.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, BAC
             clone:B1090H08
          Length = 200720

 Score = 46.1 bits (23), Expect = 0.088
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                    
Query: 357   ccaccagctgctgctgcttcttc 379
             |||||||||||||||||||||||
Sbjct: 22774 ccaccagctgctgctgcttcttc 22752



to top

>ref|NM_001036455.1| Arabidopsis thaliana GRF9; protein phosphorylated amino acid
           binding AT2G42590 (GRF9) transcript variant AT2G42590.2
           mRNA, complete cds
          Length = 1244

 Score = 44.1 bits (22), Expect = 0.35
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 343 actctgcatcgtctccaccagc 364
           ||||||||||||||||||||||
Sbjct: 979 actctgcatcgtctccaccagc 958



to top

>ref|NM_129820.2| Arabidopsis thaliana GRF9; protein phosphorylated amino acid
           binding AT2G42590 (GRF9) transcript variant AT2G42590.1
           mRNA, complete cds
          Length = 1247

 Score = 44.1 bits (22), Expect = 0.35
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 343 actctgcatcgtctccaccagc 364
           ||||||||||||||||||||||
Sbjct: 982 actctgcatcgtctccaccagc 961



to top

>gb|U60444.3|ATU60444 Arabidopsis thaliana 14-3-3 protein isoform GF14 mu mRNA, complete
           cds
          Length = 1103

 Score = 44.1 bits (22), Expect = 0.35
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 343 actctgcatcgtctccaccagc 364
           ||||||||||||||||||||||
Sbjct: 849 actctgcatcgtctccaccagc 828



to top

>gb|AC119235.13| Mus musculus chromosome 1, clone RP24-212E3, complete sequence
          Length = 181695

 Score = 44.1 bits (22), Expect = 0.35
 Identities = 28/30 (93%)
 Strand = Plus / Plus

                                            
Query: 355    ctccaccagctgctgctgcttcttctgctg 384
              ||||||| |||||||||||| |||||||||
Sbjct: 134302 ctccacctgctgctgctgctgcttctgctg 134331



to top

>ref|XM_515337.1| PREDICTED: Pan troglodytes LOC459077 (LOC459077), mRNA
          Length = 5421

 Score = 44.1 bits (22), Expect = 0.35
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                  
Query: 363  gctgctgctgcttcttctgctg 384
            ||||||||||||||||||||||
Sbjct: 1699 gctgctgctgcttcttctgctg 1678



to top

>gb|AY548079.1| Symbiezidium transversale voucher Gradstein 9924 (GOET) ribulose
           1,5-bisphosphate carboxylase/oxygenase large subunit
           (rbcL) gene, partial cds; chloroplast
          Length = 1309

 Score = 44.1 bits (22), Expect = 0.35
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                     
Query: 361 cagctgctgctgcttcttctgctggg 386
           |||||||| |||||||||||||||||
Sbjct: 118 cagctgctcctgcttcttctgctggg 93



to top

>gb|AC096997.3| Takifugu rubripes clone 217A23, complete sequence
          Length = 74841

 Score = 44.1 bits (22), Expect = 0.35
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 363   gctgctgctgcttcttctgctg 384
             ||||||||||||||||||||||
Sbjct: 55707 gctgctgctgcttcttctgctg 55686



 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 364   ctgctgctgcttcttctgctg 384
             |||||||||||||||||||||
Sbjct: 55736 ctgctgctgcttcttctgctg 55716



to top

>ref|XM_322744.1| Neurospora crassa OR74A predicted protein (NCU03487.1) partial mRNA
          Length = 132

 Score = 44.1 bits (22), Expect = 0.35
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                     
Query: 358 caccagctgctgctgcttcttctgct 383
           |||| |||||||||||||||||||||
Sbjct: 39  cacccgctgctgctgcttcttctgct 14



to top

>ref|XM_950686.1| Neurospora crassa OR74A hypothetical protein (NCU03487.1) partial
           mRNA
          Length = 132

 Score = 44.1 bits (22), Expect = 0.35
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                     
Query: 358 caccagctgctgctgcttcttctgct 383
           |||| |||||||||||||||||||||
Sbjct: 39  cacccgctgctgctgcttcttctgct 14



to top

>ref|NM_018263.3| Homo sapiens additional sex combs like 2 (Drosophila) (ASXL2), mRNA
          Length = 7231

 Score = 44.1 bits (22), Expect = 0.35
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 363 gctgctgctgcttcttctgctg 384
           ||||||||||||||||||||||
Sbjct: 806 gctgctgctgcttcttctgctg 785



to top

>gb|AC113084.12| Mus musculus chromosome 1, clone RP23-292F19, complete sequence
          Length = 247962

 Score = 44.1 bits (22), Expect = 0.35
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                            
Query: 355    ctccaccagctgctgctgcttcttctgctg 384
              ||||||| |||||||||||| |||||||||
Sbjct: 223509 ctccacctgctgctgctgctgcttctgctg 223480



to top

>gb|BC042999.2| Homo sapiens additional sex combs like 2 (Drosophila), mRNA (cDNA
           clone MGC:44431 IMAGE:5297392), complete cds
          Length = 3316

 Score = 44.1 bits (22), Expect = 0.35
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 363 gctgctgctgcttcttctgctg 384
           ||||||||||||||||||||||
Sbjct: 200 gctgctgctgcttcttctgctg 179



to top

>emb|AL669988.1|NCB23H20 Neurospora crassa DNA linkage group II BAC contig B23H20
          Length = 122151

 Score = 44.1 bits (22), Expect = 0.35
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                       
Query: 358   caccagctgctgctgcttcttctgct 383
             |||| |||||||||||||||||||||
Sbjct: 71996 cacccgctgctgctgcttcttctgct 72021



to top

>emb|CR933613.1| Homo sapiens mRNA; cDNA DKFZp686C1968 (from clone DKFZp686C1968)
          Length = 7231

 Score = 44.1 bits (22), Expect = 0.35
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 363 gctgctgctgcttcttctgctg 384
           ||||||||||||||||||||||
Sbjct: 806 gctgctgctgcttcttctgctg 785



to top

>gb|AY128764.1| Arabidopsis thaliana 14-3-3 regulatory protein (At2g42590) mRNA,
           complete cds
          Length = 968

 Score = 44.1 bits (22), Expect = 0.35
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 343 actctgcatcgtctccaccagc 364
           ||||||||||||||||||||||
Sbjct: 790 actctgcatcgtctccaccagc 769



to top

>gb|AC023712.5| Drosophila melanogaster X BAC RP98-1M22 (Roswell Park Cancer Institute
              Drosophila BAC Library) complete sequence
          Length = 170129

 Score = 44.1 bits (22), Expect = 0.35
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 363    gctgctgctgcttcttctgctg 384
              ||||||||||||||||||||||
Sbjct: 160972 gctgctgctgcttcttctgctg 160951



to top

>dbj|AB084281.1| Homo sapiens mRNA for chimeric MOZ-ASXH2 fusion protein, complete cds
          Length = 9718

 Score = 44.1 bits (22), Expect = 0.35
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                  
Query: 363  gctgctgctgcttcttctgctg 384
            ||||||||||||||||||||||
Sbjct: 3313 gctgctgctgcttcttctgctg 3292



to top

>gb|AC104604.7| Drosophila melanogaster X BAC RP98-18K5 (Roswell Park Cancer Institute
              Drosophila BAC Library) complete sequence
          Length = 167902

 Score = 44.1 bits (22), Expect = 0.35
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 363    gctgctgctgcttcttctgctg 384
              ||||||||||||||||||||||
Sbjct: 154841 gctgctgctgcttcttctgctg 154862



to top

>gb|AY119457.1| Drosophila melanogaster GH01258 full insert cDNA
          Length = 5671

 Score = 44.1 bits (22), Expect = 0.35
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 363 gctgctgctgcttcttctgctg 384
           ||||||||||||||||||||||
Sbjct: 240 gctgctgctgcttcttctgctg 219



to top

>ref|NM_206631.1| Drosophila melanogaster small conductance calcium-activated
           potassium channel CG10706-RF, transcript variant F (SK),
           mRNA
          Length = 4821

 Score = 44.1 bits (22), Expect = 0.35
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 363 gctgctgctgcttcttctgctg 384
           ||||||||||||||||||||||
Sbjct: 251 gctgctgctgcttcttctgctg 230



to top

>ref|NM_167032.1| Drosophila melanogaster small conductance calcium-activated
           potassium channel CG10706-RB, transcript variant B (SK),
           mRNA
          Length = 3554

 Score = 44.1 bits (22), Expect = 0.35
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 363 gctgctgctgcttcttctgctg 384
           ||||||||||||||||||||||
Sbjct: 240 gctgctgctgcttcttctgctg 219



to top

>ref|NM_167031.1| Drosophila melanogaster small conductance calcium-activated
           potassium channel CG10706-RA, transcript variant A (SK),
           mRNA
          Length = 3565

 Score = 44.1 bits (22), Expect = 0.35
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 363 gctgctgctgcttcttctgctg 384
           ||||||||||||||||||||||
Sbjct: 251 gctgctgctgcttcttctgctg 230



to top

>ref|NM_167029.1| Drosophila melanogaster small conductance calcium-activated
           potassium channel CG10706-RC, transcript variant C (SK),
           mRNA
          Length = 4821

 Score = 44.1 bits (22), Expect = 0.35
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 363 gctgctgctgcttcttctgctg 384
           ||||||||||||||||||||||
Sbjct: 251 gctgctgctgcttcttctgctg 230



to top

>gb|AY093076.1| Arabidopsis thaliana 14-3-3 regulatory protein (At2g42590) mRNA,
           complete cds
          Length = 1189

 Score = 44.1 bits (22), Expect = 0.35
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 343 actctgcatcgtctccaccagc 364
           ||||||||||||||||||||||
Sbjct: 980 actctgcatcgtctccaccagc 959



to top

>dbj|AK033911.1| Mus musculus adult male diencephalon cDNA, RIKEN full-length
           enriched library, clone:9330115A01 product:weakly
           similar to CORNICHON [Boltenia villosa], full insert
           sequence
          Length = 2668

 Score = 44.1 bits (22), Expect = 0.35
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                         
Query: 355 ctccaccagctgctgctgcttcttctgctg 384
           ||||||| |||||||||||| |||||||||
Sbjct: 53  ctccacctgctgctgctgctgcttctgctg 24



to top

>dbj|AP008215.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, complete
                sequence
          Length = 22696651

 Score = 44.1 bits (22), Expect = 0.35
 Identities = 28/30 (93%)
 Strand = Plus / Plus

                                              
Query: 355      ctccaccagctgctgctgcttcttctgctg 384
                |||||||||||||||||||| || ||||||
Sbjct: 17534515 ctccaccagctgctgctgctgctgctgctg 17534544



to top

>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete
                sequence
          Length = 43261740

 Score = 44.1 bits (22), Expect = 0.35
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                          
Query: 359      accagctgctgctgcttcttctgctg 384
                |||||||||||||||| |||||||||
Sbjct: 25505112 accagctgctgctgctgcttctgctg 25505087



 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 102     agggaaatgttagaaagaaa 121
               ||||||||||||||||||||
Sbjct: 3567612 agggaaatgttagaaagaaa 3567631



to top

>emb|BX820533.1|CNS0A9JA Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH45ZD06 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 1071

 Score = 44.1 bits (22), Expect = 0.35
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 343 actctgcatcgtctccaccagc 364
           ||||||||||||||||||||||
Sbjct: 879 actctgcatcgtctccaccagc 858



to top

>emb|BX818869.1|CNS0A9TI Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB21ZD02 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 1178

 Score = 44.1 bits (22), Expect = 0.35
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 343 actctgcatcgtctccaccagc 364
           ||||||||||||||||||||||
Sbjct: 960 actctgcatcgtctccaccagc 939



to top

>gb|AC093771.3| Homo sapiens BAC clone RP11-121I23 from 4, complete sequence
          Length = 165420

 Score = 44.1 bits (22), Expect = 0.35
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 363   gctgctgctgcttcttctgctg 384
             ||||||||||||||||||||||
Sbjct: 16286 gctgctgctgcttcttctgctg 16307



to top

>gb|AC010150.3| Homo sapiens BAC clone RP11-404P12 from 2, complete sequence
          Length = 173893

 Score = 44.1 bits (22), Expect = 0.35
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 363   gctgctgctgcttcttctgctg 384
             ||||||||||||||||||||||
Sbjct: 25655 gctgctgctgcttcttctgctg 25634



to top

>dbj|AB051472.2| Homo sapiens mRNA for KIAA1685 protein, partial cds
          Length = 7174

 Score = 44.1 bits (22), Expect = 0.35
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 363 gctgctgctgcttcttctgctg 384
           ||||||||||||||||||||||
Sbjct: 762 gctgctgctgcttcttctgctg 741



to top

>gb|AF190405.1|AF190405 Drosophila virilis homeodomain transcription factor Prospero (pros)
            gene, complete cds
          Length = 11422

 Score = 44.1 bits (22), Expect = 0.35
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                  
Query: 361  cagctgctgctgcttcttctgc 382
            ||||||||||||||||||||||
Sbjct: 8800 cagctgctgctgcttcttctgc 8779



to top

>gb|AY085927.1| Arabidopsis thaliana clone 19749 mRNA, complete sequence
          Length = 1214

 Score = 44.1 bits (22), Expect = 0.35
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 343 actctgcatcgtctccaccagc 364
           ||||||||||||||||||||||
Sbjct: 982 actctgcatcgtctccaccagc 961



to top

>dbj|AP004367.4| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC
             clone:P0696E01
          Length = 194056

 Score = 44.1 bits (22), Expect = 0.35
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                       
Query: 359   accagctgctgctgcttcttctgctg 384
             |||||||||||||||| |||||||||
Sbjct: 32715 accagctgctgctgctgcttctgctg 32690



to top

>dbj|AP005755.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, BAC
             clone:OSJNBb0019B14
          Length = 127570

 Score = 44.1 bits (22), Expect = 0.35
 Identities = 28/30 (93%)
 Strand = Plus / Plus

                                           
Query: 355   ctccaccagctgctgctgcttcttctgctg 384
             |||||||||||||||||||| || ||||||
Sbjct: 98693 ctccaccagctgctgctgctgctgctgctg 98722



to top

>emb|BX647527.1|HSM807673 Homo sapiens mRNA; cDNA DKFZp686F074 (from clone DKFZp686F074)
          Length = 7264

 Score = 44.1 bits (22), Expect = 0.35
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 363 gctgctgctgcttcttctgctg 384
           ||||||||||||||||||||||
Sbjct: 835 gctgctgctgcttcttctgctg 814



to top

>emb|BX648218.1|HSM808366 Homo sapiens mRNA; cDNA DKFZp686L2369 (from clone DKFZp686L2369)
          Length = 8910

 Score = 44.1 bits (22), Expect = 0.35
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 363 gctgctgctgcttcttctgctg 384
           ||||||||||||||||||||||
Sbjct: 787 gctgctgctgcttcttctgctg 766



to top

>dbj|AB084279.1| Homo sapiens ASXH2 mRNA for polycomb group protein, complete cds
          Length = 7030

 Score = 44.1 bits (22), Expect = 0.35
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 363 gctgctgctgcttcttctgctg 384
           ||||||||||||||||||||||
Sbjct: 625 gctgctgctgcttcttctgctg 604



to top

>gb|AE003434.4| Drosophila melanogaster chromosome X, section 18 of 74 of the complete
             sequence
          Length = 303928

 Score = 44.1 bits (22), Expect = 0.35
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 363   gctgctgctgcttcttctgctg 384
             ||||||||||||||||||||||
Sbjct: 18131 gctgctgctgcttcttctgctg 18110



to top

>dbj|AB011545.1| Arabidopsis thaliana mRNA for GF14 mu, complete cds
          Length = 1120

 Score = 44.1 bits (22), Expect = 0.35
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 343 actctgcatcgtctccaccagc 364
           ||||||||||||||||||||||
Sbjct: 883 actctgcatcgtctccaccagc 862



to top

>gb|AY494837.1| Fundulus heteroclitus brain aromatase CYP19A2 mRNA, complete cds
          Length = 1503

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 363 gctgctgctgcttcttctgct 383
           |||||||||||||||||||||
Sbjct: 72  gctgctgctgcttcttctgct 92



to top

>ref|NM_001036456.1| Arabidopsis thaliana GRF9; protein phosphorylated amino acid
           binding AT2G42590 (GRF9) transcript variant AT2G42590.3
           mRNA, complete cds
          Length = 1332

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 344 ctctgcatcgtctccaccagc 364
           |||||||||||||||||||||
Sbjct: 981 ctctgcatcgtctccaccagc 961



to top

>gb|AC139128.6| Mus musculus chromosome 3, clone RP23-100B7, complete sequence
          Length = 239600

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 363    gctgctgctgcttcttctgct 383
              |||||||||||||||||||||
Sbjct: 224299 gctgctgctgcttcttctgct 224279



to top

>gb|AC165289.2| Mus musculus BAC clone RP23-467L11 from chromosome 17, complete sequence
          Length = 193418

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 363    gctgctgctgcttcttctgct 383
              |||||||||||||||||||||
Sbjct: 122397 gctgctgctgcttcttctgct 122377



to top

>gb|AY461803.1| Oryza sativa (japonica cultivar-group) Dof28 mRNA, complete cds
          Length = 879

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 360 ccagctgctgctgcttcttct 380
           |||||||||||||||||||||
Sbjct: 175 ccagctgctgctgcttcttct 155



to top

>gb|AC165958.2| Mus musculus BAC clone RP23-417I20 from chromosome 16, complete
             sequence
          Length = 186202

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 363   gctgctgctgcttcttctgct 383
             |||||||||||||||||||||
Sbjct: 51217 gctgctgctgcttcttctgct 51197



to top

>ref|XM_474359.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 621

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 360 ccagctgctgctgcttcttct 380
           |||||||||||||||||||||
Sbjct: 148 ccagctgctgctgcttcttct 128



to top

>gb|AC169508.1| Mus musculus BAC clone RP23-167I21 from chromosome 16, complete
            sequence
          Length = 211870

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 363  gctgctgctgcttcttctgct 383
            |||||||||||||||||||||
Sbjct: 3739 gctgctgctgcttcttctgct 3719



to top

>gb|AY548097.1| Drepanolejeunea biocellata voucher Gradstein 10053 (GOET) ribulose
           1,5-bisphosphate carboxylase/oxygenase large subunit
           (rbcL) gene, partial cds; chloroplast
          Length = 1309

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 361 cagctgctgctgcttcttctgctgg 385
           |||||||| ||||||||||||||||
Sbjct: 118 cagctgctcctgcttcttctgctgg 94



to top

>gb|AY548096.1| Diplasiolejeunea involuta voucher Schaefer-Verwimp 23508 (GOET)
           ribulose 1,5-bisphosphate carboxylase/oxygenase large
           subunit (rbcL) gene, partial cds; chloroplast
          Length = 1309

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 361 cagctgctgctgcttcttctgctgg 385
           |||||||| ||||||||||||||||
Sbjct: 118 cagctgctcctgcttcttctgctgg 94



to top

>gb|AY548092.1| Cheilolejeunea lineata voucher Schaefer-Verwimp 22183 ribulose
           1,5-bisphosphate carboxylase/oxygenase large subunit
           (rbcL) gene, partial cds; chloroplast
          Length = 1309

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 361 cagctgctgctgcttcttctgctgg 385
           |||||||| ||||||||||||||||
Sbjct: 118 cagctgctcctgcttcttctgctgg 94



to top

>gb|AY548083.1| Aureolejeunea fulva voucher Costa & Gradstein 3849 (GOET) ribulose
           1,5-bisphosphate carboxylase/oxygenase large subunit
           (rbcL) gene, partial cds; chloroplast
          Length = 1309

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 361 cagctgctgctgcttcttctgctgg 385
           |||||||| ||||||||||||||||
Sbjct: 118 cagctgctcctgcttcttctgctgg 94



to top

>gb|AY548072.1| Myriocolea irrorata voucher Gradstein et al. 10033A (GOET) ribulose
           1,5-bisphosphate carboxylase/oxygenase large subunit
           (rbcL) gene, partial cds; chloroplast
          Length = 1309

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 361 cagctgctgctgcttcttctgctgg 385
           |||||||| ||||||||||||||||
Sbjct: 118 cagctgctcctgcttcttctgctgg 94



to top

>gb|AY548069.1| Marchesinia brachiata voucher Gradstein et al. 10052 (GOET)
           ribulose 1,5-bisphosphate carboxylase/oxygenase large
           subunit (rbcL) gene, partial cds; chloroplast
          Length = 1309

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 361 cagctgctgctgcttcttctgctgg 385
           |||||||| ||||||||||||||||
Sbjct: 118 cagctgctcctgcttcttctgctgg 94



to top

>gb|AF091620.2| Trypanosoma cruzi Tulahuen surface antigen PHGST#5 gene, partial cds
          Length = 2657

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                     
Query: 363  gctgctgctgcttcttctgctgggg 387
            ||||| |||||||||||||||||||
Sbjct: 2446 gctgccgctgcttcttctgctgggg 2470



to top

>gb|AC113485.19| Mus musculus chromosome 19, clone RP23-346D12, complete sequence
          Length = 190974

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 363   gctgctgctgcttcttctgct 383
             |||||||||||||||||||||
Sbjct: 57913 gctgctgctgcttcttctgct 57933



to top

>ref|XM_877216.1| PREDICTED: Bos taurus similar to Anion exchange protein 3 (Neuronal
            band 3-like protein) (Solute carrier family 4 member 3)
            (Cardiac/brain band 3-like protein) (CAE3/BAE3),
            transcript variant 9 (LOC535049), mRNA
          Length = 4106

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 360  ccagctgctgctgcttcttct 380
            |||||||||||||||||||||
Sbjct: 1181 ccagctgctgctgcttcttct 1161



to top

>ref|XM_877166.1| PREDICTED: Bos taurus similar to Anion exchange protein 3 (Neuronal
           band 3-like protein) (Solute carrier family 4 member 3)
           (Cardiac/brain band 3-like protein) (CAE3/BAE3),
           transcript variant 8 (LOC535049), mRNA
          Length = 3274

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 360 ccagctgctgctgcttcttct 380
           |||||||||||||||||||||
Sbjct: 349 ccagctgctgctgcttcttct 329



to top

>ref|XM_615029.2| PREDICTED: Bos taurus similar to Anion exchange protein 3 (Neuronal
            band 3-like protein) (Solute carrier family 4 member 3)
            (Cardiac/brain band 3-like protein) (CAE3/BAE3),
            transcript variant 5 (LOC535049), mRNA
          Length = 4007

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 360  ccagctgctgctgcttcttct 380
            |||||||||||||||||||||
Sbjct: 1082 ccagctgctgctgcttcttct 1062



to top

>gb|AC158951.5| Mus musculus chromosome 8, clone RP23-265B11, complete sequence
          Length = 191700

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 363    gctgctgctgcttcttctgct 383
              |||||||||||||||||||||
Sbjct: 118907 gctgctgctgcttcttctgct 118927



to top

>gb|AF092099.2| Trypanosoma cruzi CL Brener surface antigen PHGST#5 gene, complete
            cds
          Length = 3300

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                     
Query: 363  gctgctgctgcttcttctgctgggg 387
            ||||| |||||||||||||||||||
Sbjct: 3048 gctgccgctgcttcttctgctgggg 3072



to top

>ref|XM_799237.1| Trypanosoma cruzi strain CL Brener trans-sialidase
            (Tc00.1047053508935.10) partial mRNA
          Length = 2733

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                     
Query: 363  gctgctgctgcttcttctgctgggg 387
            ||||| |||||||||||||||||||
Sbjct: 2685 gctgccgctgcttcttctgctgggg 2709



to top

>ref|XM_799802.1| Trypanosoma cruzi strain CL Brener trans-sialidase
            (Tc00.1047053509185.30) partial mRNA
          Length = 2364

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                     
Query: 363  gctgctgctgcttcttctgctgggg 387
            ||||| |||||||||||||||||||
Sbjct: 2316 gctgccgctgcttcttctgctgggg 2340



to top

>ref|XM_799975.1| Trypanosoma cruzi strain CL Brener trans-sialidase
            (Tc00.1047053509513.10) partial mRNA
          Length = 2265

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                     
Query: 363  gctgctgctgcttcttctgctgggg 387
            ||||| |||||||||||||||||||
Sbjct: 2217 gctgccgctgcttcttctgctgggg 2241



to top

>ref|XM_800266.1| Trypanosoma cruzi strain CL Brener trans-sialidase
            (Tc00.1047053507125.10) partial mRNA
          Length = 2367

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                     
Query: 363  gctgctgctgcttcttctgctgggg 387
            ||||| |||||||||||||||||||
Sbjct: 2319 gctgccgctgcttcttctgctgggg 2343



to top

>ref|XM_800804.1| Trypanosoma cruzi strain CL Brener trans-sialidase
            (Tc00.1047053509187.10) partial mRNA
          Length = 2268

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                     
Query: 363  gctgctgctgcttcttctgctgggg 387
            ||||| |||||||||||||||||||
Sbjct: 2220 gctgccgctgcttcttctgctgggg 2244



to top

>ref|XM_801039.1| Trypanosoma cruzi strain CL Brener trans-sialidase
            (Tc00.1047053508485.10) partial mRNA
          Length = 2265

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                     
Query: 363  gctgctgctgcttcttctgctgggg 387
            ||||| |||||||||||||||||||
Sbjct: 2217 gctgccgctgcttcttctgctgggg 2241



to top

>ref|XM_802356.1| Trypanosoma cruzi strain CL Brener trans-sialidase
            (Tc00.1047053508581.40) partial mRNA
          Length = 2103

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                     
Query: 363  gctgctgctgcttcttctgctgggg 387
            ||||| |||||||||||||||||||
Sbjct: 2055 gctgccgctgcttcttctgctgggg 2079



to top

>ref|XM_803072.1| Trypanosoma cruzi strain CL Brener trans-sialidase
            (Tc00.1047053504533.40) partial mRNA
          Length = 2757

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                     
Query: 363  gctgctgctgcttcttctgctgggg 387
            ||||| |||||||||||||||||||
Sbjct: 2709 gctgccgctgcttcttctgctgggg 2733



to top

>ref|XM_803469.1| Trypanosoma cruzi strain CL Brener trans-sialidase
            (Tc00.1047053505609.10) partial mRNA
          Length = 2268

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                     
Query: 363  gctgctgctgcttcttctgctgggg 387
            ||||| |||||||||||||||||||
Sbjct: 2220 gctgccgctgcttcttctgctgggg 2244



to top

>ref|XM_804626.1| Trypanosoma cruzi strain CL Brener trans-sialidase
            (Tc00.1047053507997.30) partial mRNA
          Length = 2535

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                     
Query: 363  gctgctgctgcttcttctgctgggg 387
            ||||| |||||||||||||||||||
Sbjct: 2487 gctgccgctgcttcttctgctgggg 2511



to top

>ref|XM_810613.1| Trypanosoma cruzi strain CL Brener trans-sialidase
            (Tc00.1047053508593.10) partial mRNA
          Length = 2724

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                     
Query: 363  gctgctgctgcttcttctgctgggg 387
            ||||| |||||||||||||||||||
Sbjct: 2676 gctgccgctgcttcttctgctgggg 2700



to top

>ref|XM_810614.1| Trypanosoma cruzi strain CL Brener trans-sialidase
            (Tc00.1047053508593.20) partial mRNA
          Length = 2724

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                     
Query: 363  gctgctgctgcttcttctgctgggg 387
            ||||| |||||||||||||||||||
Sbjct: 2676 gctgccgctgcttcttctgctgggg 2700



to top

>ref|XM_811278.1| Trypanosoma cruzi strain CL Brener trans-sialidase
            (Tc00.1047053507047.40) partial mRNA
          Length = 2274

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                     
Query: 363  gctgctgctgcttcttctgctgggg 387
            ||||| |||||||||||||||||||
Sbjct: 2226 gctgccgctgcttcttctgctgggg 2250



to top

>ref|XM_804731.1| Trypanosoma cruzi strain CL Brener trans-sialidase
            (Tc00.1047053507907.10) partial mRNA
          Length = 1095

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                     
Query: 363  gctgctgctgcttcttctgctgggg 387
            ||||| |||||||||||||||||||
Sbjct: 1047 gctgccgctgcttcttctgctgggg 1071



to top

>ref|XM_798248.1| Trypanosoma cruzi strain CL Brener trans-sialidase
           (Tc00.1047053507995.20) partial mRNA
          Length = 909

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                    
Query: 363 gctgctgctgcttcttctgctgggg 387
           ||||| |||||||||||||||||||
Sbjct: 861 gctgccgctgcttcttctgctgggg 885



to top

>gb|AC131116.3| Mus musculus BAC clone RP24-344M21 from chromosome 7, complete sequence
          Length = 190325

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 160    tcatgggctcatagcaaagag 180
              |||||||||||||||||||||
Sbjct: 119632 tcatgggctcatagcaaagag 119612



to top

>emb|AL512601.18| Human DNA sequence from clone RP11-500B3 on chromosome 9 Contains the
            5' end of a novel gene, complete sequence
          Length = 165517

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 364  ctgctgctgcttcttctgctg 384
            |||||||||||||||||||||
Sbjct: 9380 ctgctgctgcttcttctgctg 9400



 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 364  ctgctgctgcttcttctgctg 384
            |||||||||||||||||||||
Sbjct: 9365 ctgctgctgcttcttctgctg 9385



 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 364  ctgctgctgcttcttctgctg 384
            |||||||||||||||||||||
Sbjct: 9224 ctgctgctgcttcttctgctg 9244



to top

>emb|AL445986.14| Human DNA sequence from clone RP11-310F24 on chromosome 9 Contains a
             CpG island, complete sequence
          Length = 120873

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                          
Query: 357   ccaccagctgctgctgcttcttctgctgg 385
             |||||||||||||||||| ||| ||||||
Sbjct: 13391 ccaccagctgctgctgctgcttttgctgg 13419



to top

>emb|AL604029.12| Mouse DNA sequence from clone RP23-155J3 on chromosome 11 Contains an H3
              histone family 3A (H3f3a) pseudogene, the Zfp179 gene for
              zinc finger protein 179, the gene for the possible ortholog
              of H. sapiens microfibrillar-associated protein 4 (MFAP4)
              (1110007F23Rik), the Mapk7 gene for mitogen-activated
              kinase 7, a novel gene (3110043A19Rik), the Eppb9 gene for
              endothelial precursor protein B9, the Epn2 gene for epsin
              2, a novel gene and three CpG islands, complete sequence
          Length = 204653

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 360    ccagctgctgctgcttcttct 380
              |||||||||||||||||||||
Sbjct: 189090 ccagctgctgctgcttcttct 189110



to top

>emb|AL606668.2|OSJN00083 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBa0064G10,
              complete sequence
          Length = 150206

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 360    ccagctgctgctgcttcttct 380
              |||||||||||||||||||||
Sbjct: 145381 ccagctgctgctgcttcttct 145401



to top

>gb|AC100322.8| Mus musculus chromosome 7, clone RP23-124O24, complete sequence
          Length = 219314

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 363    gctgctgctgcttcttctgct 383
              |||||||||||||||||||||
Sbjct: 121381 gctgctgctgcttcttctgct 121401



to top

>gb|U87077.1|LCU87077 Lunularia cruciata ribulose-1,5-bisphosphate carboxylase/oxygenase
           large subunit (rbcL) gene, chloroplast gene encoding
           chloroplast protein, partial cds
          Length = 1347

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 361 cagctgctgctgcttcttctgctgg 385
           |||||||| ||||||||||||||||
Sbjct: 136 cagctgctcctgcttcttctgctgg 112



to top

>emb|BX324121.9| Zebrafish DNA sequence from clone DKEY-164J20 in linkage group 25,
              complete sequence
          Length = 181165

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                       
Query: 113    agaaagaaactatgtttacaacaac 137
              ||||||||||||||||| |||||||
Sbjct: 133438 agaaagaaactatgtttgcaacaac 133462



to top

>dbj|AK092650.1| Homo sapiens cDNA FLJ35331 fis, clone PROST2014659
          Length = 3194

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 351  tcgtctccaccagctgctgct 371
            |||||||||||||||||||||
Sbjct: 1819 tcgtctccaccagctgctgct 1839



to top

>emb|CR605890.1| full-length cDNA clone CS0DA012YP15 of Neuroblastoma of Homo sapiens
            (human)
          Length = 1941

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 269  agctgcagcaaggccttccag 289
            |||||||||||||||||||||
Sbjct: 1896 agctgcagcaaggccttccag 1876



to top

>gb|AC069544.9| Homo sapiens chromosome 10 clone RP11-398C13, complete sequence
          Length = 214866

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 363    gctgctgctgcttcttctgct 383
              |||||||||||||||||||||
Sbjct: 139647 gctgctgctgcttcttctgct 139627



to top

>ref|NM_142225.2| Drosophila melanogaster CG5404-RA (CG5404), mRNA
          Length = 2743

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                     
Query: 360  ccagctgctgctgcttcttctgctg 384
            |||||||||||||||||| ||||||
Sbjct: 2271 ccagctgctgctgcttctgctgctg 2247



to top

>gb|AC007087.7| Arabidopsis thaliana chromosome 2 clone F14N22 map mi551, complete
             sequence
          Length = 96685

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 344   ctctgcatcgtctccaccagc 364
             |||||||||||||||||||||
Sbjct: 53620 ctctgcatcgtctccaccagc 53600



to top

>gb|AY060780.1| Drosophila melanogaster GH25012 full length cDNA
          Length = 2761

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                     
Query: 360  ccagctgctgctgcttcttctgctg 384
            |||||||||||||||||| ||||||
Sbjct: 2271 ccagctgctgctgcttctgctgctg 2247



to top

>gb|AY054165.1| Arabidopsis thaliana At2g42590/F14N22.14 mRNA, complete cds
          Length = 1548

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 344  ctctgcatcgtctccaccagc 364
            |||||||||||||||||||||
Sbjct: 1248 ctctgcatcgtctccaccagc 1228



to top

>gb|AC158130.7| Mus musculus chromosome 19, clone RP24-360F11, complete sequence
          Length = 206879

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 363   gctgctgctgcttcttctgct 383
             |||||||||||||||||||||
Sbjct: 79394 gctgctgctgcttcttctgct 79374



to top

>gb|AC154731.2| Mus musculus BAC clone RP23-121M22 from chromosome 14, complete sequence
          Length = 215346

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                       
Query: 361    cagctgctgctgcttcttctgctgg 385
              |||||||| ||||||||||||||||
Sbjct: 189759 cagctgctcctgcttcttctgctgg 189735



to top

>gb|AC160137.2| Mus musculus BAC clone RP23-136A1 from chromosome 9, complete sequence
          Length = 241917

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 360   ccagctgctgctgcttcttct 380
             |||||||||||||||||||||
Sbjct: 22877 ccagctgctgctgcttcttct 22857



to top

>gb|AC002472.8| Homo sapiens Chromosome 22q11.2 PAC Clone p_n5 In BCRL2-GGT Region,
             complete sequence
          Length = 147086

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 269   agctgcagcaaggccttccag 289
             |||||||||||||||||||||
Sbjct: 43298 agctgcagcaaggccttccag 43318



to top

>gb|AC002470.17| Homo sapiens Chromosome 22q11.2 BAC Clone b135h6 In BCRL2-GGT Region,
              complete sequence
          Length = 235395

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 269    agctgcagcaaggccttccag 289
              |||||||||||||||||||||
Sbjct: 234827 agctgcagcaaggccttccag 234847



to top

>ref|NM_074465.1| Caenorhabditis elegans F21A3.5 (F21A3.5) mRNA, complete cds
          Length = 1599

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                     
Query: 361  cagctgctgctgcttcttctgctgg 385
            |||||||||||||||||||| ||||
Sbjct: 1366 cagctgctgctgcttcttcttctgg 1342



to top

>dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 4, complete
                sequence
          Length = 35498469

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                     
Query: 360      ccagctgctgctgcttcttct 380
                |||||||||||||||||||||
Sbjct: 34691260 ccagctgctgctgcttcttct 34691280



to top

>dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, complete
                sequence
          Length = 35954743

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                     
Query: 364      ctgctgctgcttcttctgctg 384
                |||||||||||||||||||||
Sbjct: 11865089 ctgctgctgcttcttctgctg 11865069



 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                    
Query: 365      tgctgctgcttcttctgctg 384
                ||||||||||||||||||||
Sbjct: 21150648 tgctgctgcttcttctgctg 21150629



to top

>gb|BC092399.1| Mus musculus centromere protein J, mRNA (cDNA clone MGC:102215
           IMAGE:30549055), complete cds
          Length = 4371

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 361 cagctgctgctgcttcttctgctgg 385
           |||||||| ||||||||||||||||
Sbjct: 630 cagctgctcctgcttcttctgctgg 606



to top

>gb|AC159150.5| Mus musculus  BAC RP23-339M5 (Roswell Park Cancer Institute (C57BL/6J
             Female) Mouse BAC Library) complete sequence
          Length = 205775

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 363   gctgctgctgcttcttctgct 383
             |||||||||||||||||||||
Sbjct: 64383 gctgctgctgcttcttctgct 64403



to top

>gb|AF133300.2|AF133300 Mus musculus MOR 3'Beta1, MOR 3'Beta2, MOR 3'Beta3, and MOR 3'Beta4
           genes, complete cds; Cbx3 pseudogene, complete sequence;
           and MOR 3'Beta5 and MOR 3'Beta6 genes, complete cds
          Length = 92000

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 160 tcatgggctcatagcaaagag 180
           |||||||||||||||||||||
Sbjct: 7   tcatgggctcatagcaaagag 27



to top

>dbj|AP005009.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, PAC
             clone:P0572A04
          Length = 132018

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 364   ctgctgctgcttcttctgctg 384
             |||||||||||||||||||||
Sbjct: 62862 ctgctgctgcttcttctgctg 62842



to top

>gb|AC117729.9| Mus musculus chromosome 8, clone RP24-126M11, complete sequence
          Length = 193119

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 363    gctgctgctgcttcttctgct 383
              |||||||||||||||||||||
Sbjct: 156843 gctgctgctgcttcttctgct 156823



to top

>dbj|AK107524.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-129-F12, full
           insert sequence
          Length = 1096

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 360 ccagctgctgctgcttcttct 380
           |||||||||||||||||||||
Sbjct: 285 ccagctgctgctgcttcttct 265



to top

>gb|AC154837.2| Mus musculus BAC clone RP24-576O2 from 14, complete sequence
          Length = 134124

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                       
Query: 361    cagctgctgctgcttcttctgctgg 385
              |||||||| ||||||||||||||||
Sbjct: 113469 cagctgctcctgcttcttctgctgg 113493



to top

>gb|AF145301.1|AF145301 Arabidopsis thaliana 14-3-3 protein GF14 mu (GRF9) gene, complete cds
          Length = 3604

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 344  ctctgcatcgtctccaccagc 364
            |||||||||||||||||||||
Sbjct: 2577 ctctgcatcgtctccaccagc 2557



to top

>emb|AL732349.2| Oryza sativa genomic DNA, chromosome 4, BAC clone: H0402C08, complete
             sequence
          Length = 100836

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 360   ccagctgctgctgcttcttct 380
             |||||||||||||||||||||
Sbjct: 89488 ccagctgctgctgcttcttct 89508



to top

>emb|AL732353.1| Oryza sativa genomic DNA, chromosome 4, BAC clone: H0801D08, complete
             sequence
          Length = 103264

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 360   ccagctgctgctgcttcttct 380
             |||||||||||||||||||||
Sbjct: 34584 ccagctgctgctgcttcttct 34604



to top

>emb|Z81509.1|CEF21A3 Caenorhabditis elegans Cosmid F21A3, complete sequence
          Length = 32096

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 361   cagctgctgctgcttcttctgctgg 385
             |||||||||||||||||||| ||||
Sbjct: 27277 cagctgctgctgcttcttcttctgg 27253



to top

>gb|AC006414.6|AC006414 Drosophila melanogaster, chromosome 3R, region 89A1-89A5, BAC clone
             BACR48G17, complete sequence
          Length = 179122

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 360   ccagctgctgctgcttcttctgctg 384
             |||||||||||||||||| ||||||
Sbjct: 63151 ccagctgctgctgcttctgctgctg 63127



to top

>gb|AE003710.2| Drosophila melanogaster chromosome 3R, section 48 of 118 of the
             complete sequence
          Length = 224071

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 360   ccagctgctgctgcttcttctgctg 384
             |||||||||||||||||| ||||||
Sbjct: 52381 ccagctgctgctgcttctgctgctg 52357



to top

>emb|AL953857.7| Zebrafish DNA sequence from clone CH211-127M7, complete sequence
          Length = 175586

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                       
Query: 113    agaaagaaactatgtttacaacaac 137
              ||||||||||||||||| |||||||
Sbjct: 171350 agaaagaaactatgtttgcaacaac 171374



to top

>emb|CT030702.11| Mouse DNA sequence from clone RP23-76I16 on chromosome 17, complete
             sequence
          Length = 222733

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 363   gctgctgctgcttcttctgct 383
             |||||||||||||||||||||
Sbjct: 34183 gctgctgctgcttcttctgct 34163



to top

>ref|NM_001014996.1| Mus musculus centromere protein J (Cenpj), mRNA
          Length = 4371

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 361 cagctgctgctgcttcttctgctgg 385
           |||||||| ||||||||||||||||
Sbjct: 630 cagctgctcctgcttcttctgctgg 606



to top

>gb|M92046.1|M92046 Trypanosoma cruzi CAI Tc13 surface antigen gene, partial cds
          Length = 2167

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                     
Query: 363  gctgctgctgcttcttctgctgggg 387
            ||||| |||||||||||||||||||
Sbjct: 1230 gctgccgctgcttcttctgctgggg 1254



to top

>gb|AC161435.7| Mus musculus chromosome 8, clone RP23-78L21, complete sequence
          Length = 219937

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 361   cagctgctgctgcttcttct 380
             ||||||||||||||||||||
Sbjct: 73018 cagctgctgctgcttcttct 72999



to top

>ref|XM_525563.1| PREDICTED: Pan troglodytes similar to solute carrier family 35,
           member E4 (LOC470179), mRNA
          Length = 1440

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 357 ccaccagctgctgctgcttcttctgctg 384
           |||||||||||||||||| |||| ||||
Sbjct: 416 ccaccagctgctgctgctacttcagctg 389



to top

>ref|XM_476017.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 945

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 361 cagctgctgctgcttcttct 380
           ||||||||||||||||||||
Sbjct: 504 cagctgctgctgcttcttct 485



to top

>ref|XM_466223.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 1412

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 365 tgctgctgcttcttctgctg 384
           ||||||||||||||||||||
Sbjct: 90  tgctgctgcttcttctgctg 109



to top

>ref|XM_506827.1| PREDICTED Oryza sativa (japonica cultivar-group), OSJNBb0038F20.11
           mRNA
          Length = 1666

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 365 tgctgctgcttcttctgctg 384
           ||||||||||||||||||||
Sbjct: 118 tgctgctgcttcttctgctg 137



to top

>gb|AC013255.5| Drosophila melanogaster clone BACR27A22, complete sequence
          Length = 148414

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 114   gaaagaaactatgtttacaa 133
             ||||||||||||||||||||
Sbjct: 15140 gaaagaaactatgtttacaa 15159



to top

>gb|AC009843.9| Drosophila melanogaster clone BACR01G11, complete sequence
          Length = 192819

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 114   gaaagaaactatgtttacaa 133
             ||||||||||||||||||||
Sbjct: 34994 gaaagaaactatgtttacaa 34975



to top

>gb|AY666071.1| Nephila pilipes clone NP-RTPD08 dragline silk spidroin 1 mRNA,
           partial cds
          Length = 819

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 355 ctccaccagctgctgctgct 374
           ||||||||||||||||||||
Sbjct: 301 ctccaccagctgctgctgct 282



to top

>gb|AY666070.1| Nephila pilipes clone NP-RTPD03 dragline silk spidroin 1 mRNA,
           partial cds
          Length = 731

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 355 ctccaccagctgctgctgct 374
           ||||||||||||||||||||
Sbjct: 229 ctccaccagctgctgctgct 210



to top

>gb|AY666069.1| Nephila pilipes clone NP-RTPD01 dragline silk spidroin 1 mRNA,
           partial cds
          Length = 728

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 355 ctccaccagctgctgctgct 374
           ||||||||||||||||||||
Sbjct: 229 ctccaccagctgctgctgct 210



to top

>gb|AC120144.11| Mus musculus chromosome 8, clone RP24-427K8, complete sequence
          Length = 210003

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 361    cagctgctgctgcttcttct 380
              ||||||||||||||||||||
Sbjct: 171347 cagctgctgctgcttcttct 171328



to top

>gb|AC157598.4| Mus musculus BAC clone RP23-193D3 from chromosome 17, complete sequence
          Length = 222399

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 361    cagctgctgctgcttcttct 380
              ||||||||||||||||||||
Sbjct: 129379 cagctgctgctgcttcttct 129360



to top

>gb|AC118255.32| Mus musculus chromosome 8, clone RP24-89A4, complete sequence
          Length = 200858

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 361   cagctgctgctgcttcttct 380
             ||||||||||||||||||||
Sbjct: 87720 cagctgctgctgcttcttct 87701



to top

>gb|AC135421.3| Oryza sativa (japonica cultivar-group) chromosome 5 clone
             OSJNBb0012G21, complete sequence
          Length = 135750

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 357   ccaccagctgctgctgcttcttct 380
             |||||||||||||||||| |||||
Sbjct: 72781 ccaccagctgctgctgctgcttct 72804



to top

>gb|AC007818.8| Drosophila melanogaster clone BACR02M05, complete sequence
          Length = 188549

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 363   gctgctgctgcttcttctgc 382
             ||||||||||||||||||||
Sbjct: 67186 gctgctgctgcttcttctgc 67167



to top

>gb|AC008225.4| Drosophila melanogaster clone BACR03E11, complete sequence
          Length = 174123

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 361   cagctgctgctgcttcttct 380
             ||||||||||||||||||||
Sbjct: 26438 cagctgctgctgcttcttct 26457



to top

>gb|AC091499.2| Drosophila melanogaster clone BACR33L22, complete sequence
          Length = 182105

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 366   gctgctgcttcttctgctgg 385
             ||||||||||||||||||||
Sbjct: 62086 gctgctgcttcttctgctgg 62067



to top

>ref|XM_456580.1| Debaryomyces hansenii CBS767 hypothetical protein (DEHA0A05962g)
            partial mRNA
          Length = 2298

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 364  ctgctgctgcttcttctgct 383
            ||||||||||||||||||||
Sbjct: 1630 ctgctgctgcttcttctgct 1611



to top

>ref|XM_610880.2| PREDICTED: Bos taurus similar to ADAM metallopeptidase domain 21
           preproprotein (LOC532366), mRNA
          Length = 2157

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 121 actatgtttacaacaacaaataca 144
           |||||||| |||||||||||||||
Sbjct: 719 actatgttgacaacaacaaataca 696



to top

>ref|NM_001083.3| Homo sapiens phosphodiesterase 5A, cGMP-specific (PDE5A),
           transcript variant 1, mRNA
          Length = 7005

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 364 ctgctgctgcttcttctgctgggg 387
           |||||||||||||| |||||||||
Sbjct: 227 ctgctgctgcttctgctgctgggg 204



to top

>gb|AC130728.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone P0663C08,
             complete sequence
          Length = 142196

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 361   cagctgctgctgcttcttct 380
             ||||||||||||||||||||
Sbjct: 53595 cagctgctgctgcttcttct 53576



to top

>gb|DQ379381.1| Latrodectus hesperus major ampullate spidroin 1 gene, partial cds
          Length = 705

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 355 ctccaccagctgctgctgct 374
           ||||||||||||||||||||
Sbjct: 568 ctccaccagctgctgctgct 549



to top

>ref|NM_015023.2| Homo sapiens WD and tetratricopeptide repeats 1 (WDTC1), mRNA
          Length = 4305

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 361  cagctgctgctgcttcttctgctg 384
            ||||||||||||||||| ||||||
Sbjct: 3933 cagctgctgctgcttctcctgctg 3956



to top

>ref|XM_797976.1| Trypanosoma cruzi strain CL Brener hypothetical protein
            (Tc00.1047053504209.10) partial mRNA
          Length = 2781

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                        
Query: 365  tgctgctgcttcttctgctgggggcctg 392
            |||||||||||||||||  |||||||||
Sbjct: 2682 tgctgctgcttcttctggcgggggcctg 2709



to top

>ref|XM_799449.1| Trypanosoma cruzi strain CL Brener trans-sialidase
            (Tc00.1047053472357.10) partial mRNA
          Length = 2442

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 363  gctgctgctgcttcttctgctggg 386
            ||||||||||||||||||| ||||
Sbjct: 2394 gctgctgctgcttcttctgttggg 2417



to top

>ref|XM_799724.1| Trypanosoma cruzi strain CL Brener trans-sialidase
            (Tc00.1047053505231.20) partial mRNA
          Length = 2310

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 363  gctgctgctgcttcttctgctggg 386
            ||||| ||||||||||||||||||
Sbjct: 2262 gctgccgctgcttcttctgctggg 2285



to top

>ref|XM_800617.1| Trypanosoma cruzi strain CL Brener trans-sialidase
            (Tc00.1047053506455.30) partial mRNA
          Length = 2262

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 363  gctgctgctgcttcttctgctggg 386
            ||||| ||||||||||||||||||
Sbjct: 2214 gctgccgctgcttcttctgctggg 2237



to top

>ref|XM_800788.1| Trypanosoma cruzi strain CL Brener trans-sialidase
            (Tc00.1047053503759.10) partial mRNA
          Length = 2274

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 363  gctgctgctgcttcttctgctggg 386
            ||||| ||||||||||||||||||
Sbjct: 2226 gctgccgctgcttcttctgctggg 2249



to top

>ref|XM_801334.1| Trypanosoma cruzi strain CL Brener trans-sialidase
            (Tc00.1047053508455.20) partial mRNA
          Length = 2661

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 363  gctgctgctgcttcttctgctggg 386
            ||||||||||||||||||| ||||
Sbjct: 2613 gctgctgctgcttcttctgttggg 2636



to top

>ref|XM_801836.1| Trypanosoma cruzi strain CL Brener trans-sialidase
            (Tc00.1047053507839.40) partial mRNA
          Length = 2262

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 363  gctgctgctgcttcttctgctggg 386
            ||||| ||||||||||||||||||
Sbjct: 2214 gctgccgctgcttcttctgctggg 2237



to top

>ref|XM_802226.1| Trypanosoma cruzi strain CL Brener trans-sialidase
            (Tc00.1047053506341.50) partial mRNA
          Length = 3126

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 368  tgctgcttcttctgctgggg 387
            ||||||||||||||||||||
Sbjct: 3083 tgctgcttcttctgctgggg 3102



to top

>ref|XM_802448.1| Trypanosoma cruzi strain CL Brener trans-sialidase
            (Tc00.1047053507773.10) partial mRNA
          Length = 2763

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 363  gctgctgctgcttcttctgctggg 386
            ||||| ||||||||||||||||||
Sbjct: 2715 gctgccgctgcttcttctgctggg 2738



to top

>gb|AC122863.4| Mus musculus BAC clone RP23-142A14 from chromosome 7, complete sequence
          Length = 226601

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 361    cagctgctgctgcttcttct 380
              ||||||||||||||||||||
Sbjct: 201006 cagctgctgctgcttcttct 201025



to top

>ref|XM_805047.1| Trypanosoma cruzi strain CL Brener trans-sialidase
            (Tc00.1047053506053.50) partial mRNA
          Length = 2772

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 363  gctgctgctgcttcttctgctggg 386
            ||||| ||||||||||||||||||
Sbjct: 2724 gctgccgctgcttcttctgctggg 2747



to top

>ref|XM_805296.1| Trypanosoma cruzi strain CL Brener trans-sialidase
            (Tc00.1047053503447.20) partial mRNA
          Length = 2265

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 363  gctgctgctgcttcttctgctggg 386
            ||||| ||||||||||||||||||
Sbjct: 2217 gctgccgctgcttcttctgctggg 2240



to top

>ref|XM_805298.1| Trypanosoma cruzi strain CL Brener trans-sialidase
            (Tc00.1047053503447.50) partial mRNA
          Length = 2658

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 363  gctgctgctgcttcttctgctggg 386
            ||||| ||||||||||||||||||
Sbjct: 2610 gctgccgctgcttcttctgctggg 2633



to top

>ref|XM_807453.1| Trypanosoma cruzi strain CL Brener trans-sialidase
            (Tc00.1047053506751.50) partial mRNA
          Length = 2193

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 363  gctgctgctgcttcttctgctggg 386
            ||||| ||||||||||||||||||
Sbjct: 2145 gctgccgctgcttcttctgctggg 2168



to top

>ref|XM_807863.1| Trypanosoma cruzi strain CL Brener trans-sialidase
            (Tc00.1047053510847.10) partial mRNA
          Length = 3018

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 368  tgctgcttcttctgctgggg 387
            ||||||||||||||||||||
Sbjct: 2975 tgctgcttcttctgctgggg 2994



to top

>ref|XM_810100.1| Trypanosoma cruzi strain CL Brener trans-sialidase
            (Tc00.1047053511311.30) partial mRNA
          Length = 2109

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 363  gctgctgctgcttcttctgctggg 386
            ||||| ||||||||||||||||||
Sbjct: 2061 gctgccgctgcttcttctgctggg 2084



to top

>ref|XM_811550.1| Trypanosoma cruzi strain CL Brener trans-sialidase
            (Tc00.1047053507723.50) partial mRNA
          Length = 2715

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 363  gctgctgctgcttcttctgctggg 386
            ||||| ||||||||||||||||||
Sbjct: 2667 gctgccgctgcttcttctgctggg 2690



to top

>ref|XM_811629.1| Trypanosoma cruzi strain CL Brener mucin-associated surface protein
           (MASP) (Tc00.1047053508871.40) partial mRNA
          Length = 1131

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 364 ctgctgctgcttcttctgct 383
           ||||||||||||||||||||
Sbjct: 592 ctgctgctgcttcttctgct 573



to top

>ref|XM_812072.1| Trypanosoma cruzi strain CL Brener trans-sialidase
            (Tc00.1047053507949.210) partial mRNA
          Length = 2253

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 363  gctgctgctgcttcttctgctggg 386
            ||||| ||||||||||||||||||
Sbjct: 2205 gctgccgctgcttcttctgctggg 2228



to top

>gb|AC122537.4| Mus musculus BAC clone RP24-548A15 from chromosome 7, complete sequence
          Length = 195987

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 361   cagctgctgctgcttcttct 380
             ||||||||||||||||||||
Sbjct: 35341 cagctgctgctgcttcttct 35360



to top

>ref|XM_816676.1| Trypanosoma cruzi strain CL Brener trans-sialidase
            (Tc00.1047053510359.610) partial mRNA
          Length = 2193

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 363  gctgctgctgcttcttctgctggg 386
            ||||| ||||||||||||||||||
Sbjct: 2145 gctgccgctgcttcttctgctggg 2168



to top

>ref|XM_813870.1| Trypanosoma cruzi strain CL Brener trans-sialidase
            (Tc00.1047053506717.80) partial mRNA
          Length = 3168

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 368  tgctgcttcttctgctgggg 387
            ||||||||||||||||||||
Sbjct: 3125 tgctgcttcttctgctgggg 3144



to top

>gb|AC125059.4| Mus musculus BAC clone RP23-404P13 from chromosome 19, complete
             sequence
          Length = 189613

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 108   atgttagaaagaaactatgt 127
             ||||||||||||||||||||
Sbjct: 75553 atgttagaaagaaactatgt 75572



to top

>ref|XM_798237.1| Trypanosoma cruzi strain CL Brener trans-sialidase
           (Tc00.1047053509841.10) partial mRNA
          Length = 696

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 368 tgctgcttcttctgctgggg 387
           ||||||||||||||||||||
Sbjct: 653 tgctgcttcttctgctgggg 672



to top

>ref|XM_799130.1| Trypanosoma cruzi strain CL Brener trans-sialidase
            (Tc00.1047053510981.20) partial mRNA
          Length = 2242

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 368  tgctgcttcttctgctgggg 387
            ||||||||||||||||||||
Sbjct: 2199 tgctgcttcttctgctgggg 2218



to top

>ref|XM_800290.1| Trypanosoma cruzi strain CL Brener trans-sialidase
            (Tc00.1047053506157.40) partial mRNA
          Length = 1245

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 363  gctgctgctgcttcttctgctggg 386
            ||||| ||||||||||||||||||
Sbjct: 1197 gctgccgctgcttcttctgctggg 1220



to top

>gb|AC122254.4| Mus musculus BAC clone RP23-171M24 from 3, complete sequence
          Length = 198281

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 364   ctgctgctgcttcttctgct 383
             ||||||||||||||||||||
Sbjct: 76369 ctgctgctgcttcttctgct 76350



to top

>ref|XM_801651.1| Trypanosoma cruzi strain CL Brener trans-sialidase
            (Tc00.1047053511105.60) partial mRNA
          Length = 2370

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 368  tgctgcttcttctgctgggg 387
            ||||||||||||||||||||
Sbjct: 2327 tgctgcttcttctgctgggg 2346



to top

>gb|AC125408.3| Mus musculus BAC clone RP23-94M23 from 3, complete sequence
          Length = 210519

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 364   ctgctgctgcttcttctgct 383
             ||||||||||||||||||||
Sbjct: 32209 ctgctgctgcttcttctgct 32228



to top

>ref|XM_730160.1| Plasmodium chabaudi chabaudi hypothetical protein (PC301604.00.0)
           partial mRNA
          Length = 480

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 366 gctgctgcttcttctgctgg 385
           ||||||||||||||||||||
Sbjct: 467 gctgctgcttcttctgctgg 448



to top

>ref|XM_739294.1| Plasmodium chabaudi chabaudi hypothetical protein (PC000291.05.0)
           partial mRNA
          Length = 522

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 364 ctgctgctgcttcttctgctgggg 387
           |||||||||||||||| |||||||
Sbjct: 496 ctgctgctgcttcttcagctgggg 473



 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 366 gctgctgcttcttctgctgg 385
           ||||||||||||||||||||
Sbjct: 467 gctgctgcttcttctgctgg 448



to top

>emb|AL663123.1| Human DNA sequence from clone RP11-4K3 on chromosome 1 Contains the 3'
             end of a novel gene (KIAA1037), a novel gene, a SMT3
             suppressor of mif two 3 homolog 2 (yeast) (SMT3H2)
             pseudogene, a novel gene (DKFZP564D0478), an  actin, beta
             (ACTB) pseudogene, the gene for  NADPH oxidase-related, C2
             domain-containing protein (JFC1), the MAP3K6 gene for
             mitogen-activated protein kinase kinase kinase 6, the FCN3
             gene for ficolin (collagen/fibrinogen domain containing) 3
             (Hakata antigen) and a CpG island, complete sequence
          Length = 81740

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 361   cagctgctgctgcttcttctgctg 384
             ||||||||||||||||| ||||||
Sbjct: 70358 cagctgctgctgcttctcctgctg 70335



to top

>emb|AL512426.9| Human DNA sequence from clone RP11-94K8 on chromosome 6 Contains the 3'
             end of a novel gene, complete sequence
          Length = 55224

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 364   ctgctgctgcttcttctgct 383
             ||||||||||||||||||||
Sbjct: 21097 ctgctgctgcttcttctgct 21078



to top

>ref|XM_503853.1| Yarrowia lipolytica CLIB122, YALI0E12199g predicted mRNA
          Length = 1749

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 373 cttcttctgctgggggcctg 392
           ||||||||||||||||||||
Sbjct: 121 cttcttctgctgggggcctg 140



to top

>gb|AY953075.1| Latrodectus hesperus isolate LT57 major ampullate spidroin 2 mRNA,
           partial cds
          Length = 1687

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 356 tccaccagctgctgctgcttcttctgct 383
           ||||||||||||||||||| || |||||
Sbjct: 625 tccaccagctgctgctgctgctgctgct 598



to top

>emb|CR382133.1| Debaryomyces hansenii chromosome A of strain CBS767 of Debaryomyces
              hansenii
          Length = 1249565

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 364    ctgctgctgcttcttctgct 383
              ||||||||||||||||||||
Sbjct: 482554 ctgctgctgcttcttctgct 482535



to top

>gb|AC159230.2| Mus musculus BAC clone RP24-378I19 from chromosome 13, complete
             sequence
          Length = 190521

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 106   aaatgttagaaagaaactat 125
             ||||||||||||||||||||
Sbjct: 73636 aaatgttagaaagaaactat 73655



to top

>gb|AC159330.9| Mus musculus 10 BAC RP23-91L18 (Roswell Park Cancer Institute (C57BL/6J
              Female) Mouse BAC Library) complete sequence
          Length = 224664

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 364    ctgctgctgcttcttctgct 383
              ||||||||||||||||||||
Sbjct: 110381 ctgctgctgcttcttctgct 110362



to top

>gb|BC032523.1| Homo sapiens WD and tetratricopeptide repeats 1, mRNA (cDNA clone
            MGC:44910 IMAGE:5500384), complete cds
          Length = 4305

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 361  cagctgctgctgcttcttctgctg 384
            ||||||||||||||||| ||||||
Sbjct: 3933 cagctgctgctgcttctcctgctg 3956



to top

>emb|CR388401.7| Zebrafish DNA sequence from clone DKEYP-64A2 in linkage group 17,
             complete sequence
          Length = 184932

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 32    agacgaaatgtcaaacaggt 51
             ||||||||||||||||||||
Sbjct: 87601 agacgaaatgtcaaacaggt 87582



to top

>gb|AC127343.3| Mus musculus BAC clone RP23-194I18 from chromosome 10, complete
             sequence
          Length = 198624

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 364   ctgctgctgcttcttctgct 383
             ||||||||||||||||||||
Sbjct: 23444 ctgctgctgcttcttctgct 23425



to top

>gb|AF106962.2| Volvox carteri f. nagariensis RlsA (rlsA) gene, partial cds; and
             somatic regenerator RegA (regA) gene, complete cds
          Length = 22280

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                         
Query: 363   gctgctgctgcttcttctgctgggggcc 390
             |||||||||||| || ||||||||||||
Sbjct: 15707 gctgctgctgctgctactgctgggggcc 15734



to top

>dbj|BA000038.2| Vibrio vulnificus YJ016 DNA, chromosome II, complete sequence
          Length = 1857073

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                       
Query: 354     tctccaccagctgctgctgcttct 377
               ||||||||| ||||||||||||||
Sbjct: 1351101 tctccaccatctgctgctgcttct 1351124



 Score = 40.1 bits (20), Expect = 5.4
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                       
Query: 121     actatgtttacaacaacaaataca 144
               ||||||||| ||||||||||||||
Sbjct: 1191266 actatgttttcaacaacaaataca 1191289



to top

>dbj|AB028960.1| Homo sapiens mRNA for KIAA1037 protein, partial cds
          Length = 5091

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 361  cagctgctgctgcttcttctgctg 384
            ||||||||||||||||| ||||||
Sbjct: 4416 cagctgctgctgcttctcctgctg 4439



to top

>gb|AC091211.3| Drosophila melanogaster 3L BAC RP98-26E12 (Roswell Park Cancer Institute
              Drosophila BAC Library) complete sequence
          Length = 194589

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 365    tgctgctgcttcttctgctg 384
              ||||||||||||||||||||
Sbjct: 173562 tgctgctgcttcttctgctg 173581



to top

>gb|AC091228.3| Drosophila melanogaster 3L BAC RP98-10L9 (Roswell Park Cancer Institute
             Drosophila BAC Library) complete sequence
          Length = 156142

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 365   tgctgctgcttcttctgctg 384
             ||||||||||||||||||||
Sbjct: 70823 tgctgctgcttcttctgctg 70804



to top

>gb|AC104625.2| Drosophila melanogaster X BAC RP98-48G8 (Roswell Park Cancer Institute
              Drosophila BAC Library) complete sequence
          Length = 172105

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 360    ccagctgctgctgcttcttctgct 383
              ||||||| ||||||||||||||||
Sbjct: 167503 ccagctgatgctgcttcttctgct 167480



to top

>dbj|AK091302.1| Homo sapiens cDNA FLJ33983 fis, clone DFNES2004684
          Length = 2961

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 364 ctgctgctgcttcttctgctgggg 387
           |||||||||||||| |||||||||
Sbjct: 811 ctgctgctgcttctgctgctgggg 834



to top

>gb|AC023721.3| Drosophila melanogaster X BAC RP98-5L4 (Roswell Park Cancer Institute
              Drosophila BAC Library) complete sequence
          Length = 166902

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 360    ccagctgctgctgcttcttctgct 383
              ||||||| ||||||||||||||||
Sbjct: 144803 ccagctgatgctgcttcttctgct 144826



to top

>dbj|AK023778.1| Homo sapiens cDNA FLJ13716 fis, clone PLACE2000411, highly similar to
            Homo sapiens epsin 2b mRNA
          Length = 3267

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 361  cagctgctgctgcttcttctgctg 384
            ||||||||||||||||| ||||||
Sbjct: 2652 cagctgctgctgcttctcctgctg 2675



to top

>dbj|AK023101.1| Homo sapiens cDNA FLJ13039 fis, clone NT2RP3001274, highly similar to
            Homo sapiens mRNA for KIAA1037 protein
          Length = 2966

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 361  cagctgctgctgcttcttctgctg 384
            ||||||||||||||||| ||||||
Sbjct: 2612 cagctgctgctgcttctcctgctg 2635



to top

>gb|DQ409058.1| Latrodectus hesperus major ampullate spidroin 2 (MaSp2) mRNA,
           partial cds
          Length = 3696

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 356 tccaccagctgctgctgcttcttctgct 383
           ||||||||||||||||||| || |||||
Sbjct: 667 tccaccagctgctgctgctgctgctgct 640



to top

>ref|NM_206286.1| Drosophila melanogaster CG10107-RC, transcript variant C (CG10107),
           mRNA
          Length = 5867

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 365 tgctgctgcttcttctgctg 384
           ||||||||||||||||||||
Sbjct: 730 tgctgctgcttcttctgctg 711



to top

>ref|NM_170350.1| Drosophila melanogaster barentsz CG12878-RB, transcript variant B
           (btz), mRNA
          Length = 3028

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 363 gctgctgctgcttcttctgc 382
           ||||||||||||||||||||
Sbjct: 190 gctgctgctgcttcttctgc 171



to top

>dbj|AB001635.2| Homo sapiens PDE5 gene for cGMP-binding cGMP-specific
            phosphodiesterase, complete cds
          Length = 23974

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 364  ctgctgctgcttcttctgctgggg 387
            |||||||||||||| |||||||||
Sbjct: 3900 ctgctgctgcttctgctgctgggg 3877



to top

>ref|NM_141446.1| Drosophila melanogaster CG10055-RA (CG10055), mRNA
          Length = 2402

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 361 cagctgctgctgcttcttct 380
           ||||||||||||||||||||
Sbjct: 189 cagctgctgctgcttcttct 208



to top

>ref|NM_139799.3| Drosophila melanogaster CG10107-RA, transcript variant A (CG10107),
           mRNA
          Length = 5852

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 365 tgctgctgcttcttctgctg 384
           ||||||||||||||||||||
Sbjct: 715 tgctgctgcttcttctgctg 696



to top

>gb|AY016022.1| Mus musculus clone 33L10 alpha globin gene cluster, complete sequence
          Length = 65871

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 361   cagctgctgctgcttcttct 380
             ||||||||||||||||||||
Sbjct: 55520 cagctgctgctgcttcttct 55539



to top

>gb|AC080089.5| Homo sapiens BAC clone RP11-785J10 from 4, complete sequence
          Length = 174023

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 364    ctgctgctgcttcttctgctgggg 387
              |||||||||||||| |||||||||
Sbjct: 101127 ctgctgctgcttctgctgctgggg 101150



to top

>emb|BX813317.11| Mouse DNA sequence from clone RP24-297H17 on chromosome 2, complete
            sequence
          Length = 157571

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 361  cagctgctgctgcttcttctgctg 384
            |||||||||||||| |||||||||
Sbjct: 3200 cagctgctgctgctgcttctgctg 3223



to top

>gb|AE003821.4| Drosophila melanogaster chromosome 2R, section 29 of 73 of the complete
              sequence
          Length = 294168

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 366    gctgctgcttcttctgctgg 385
              ||||||||||||||||||||
Sbjct: 277169 gctgctgcttcttctgctgg 277150



to top

>gb|AC114612.13| Mus musculus chromosome 7, clone RP24-80O23, complete sequence
          Length = 189471

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 361   cagctgctgctgcttcttct 380
             ||||||||||||||||||||
Sbjct: 90522 cagctgctgctgcttcttct 90541



to top

>dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6,
              complete sequence
          Length = 30731886

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 112    tagaaagaaactatgtttacaaca 135
              ||||||||||||||||||| ||||
Sbjct: 352492 tagaaagaaactatgtttaaaaca 352515



to top

>dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 5, complete
                sequence
          Length = 29737217

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                    
Query: 361      cagctgctgctgcttcttct 380
                ||||||||||||||||||||
Sbjct: 29274938 cagctgctgctgcttcttct 29274919



 Score = 40.1 bits (20), Expect = 5.4
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                        
Query: 357      ccaccagctgctgctgcttcttct 380
                |||||||||||||||||| |||||
Sbjct: 21820372 ccaccagctgctgctgctgcttct 21820395



to top

>gb|AC008217.5|AC008217 Drosophila melanogaster, chromosome 3R, region 98B-98B, BAC clone
            BACR10J03, complete sequence
          Length = 193245

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 363  gctgctgctgcttcttctgc 382
            ||||||||||||||||||||
Sbjct: 9909 gctgctgctgcttcttctgc 9890



to top

>gb|AC007084.7|AC007084 Drosophila melanogaster, chromosome 2R, region 43F-44A, BAC clone
             BACR26A16, complete sequence
          Length = 139410

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 362   agctgctgctgcttcttctgctgg 385
             ||||||||||||| ||||||||||
Sbjct: 78323 agctgctgctgctgcttctgctgg 78346



to top

>gb|AC008029.3|AC008029 Drosophila melanogaster, chromosome 3R, region 84D-84D, BAC clone
             BACR01C11, complete sequence
          Length = 176991

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 361   cagctgctgctgcttcttct 380
             ||||||||||||||||||||
Sbjct: 48792 cagctgctgctgcttcttct 48773



to top

>gb|AC011253.4|AC011253 Drosophila melanogaster, chromosome 3R, region 84D-84D, BAC clone
              BACR37K05, complete sequence
          Length = 197597

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 361    cagctgctgctgcttcttctgctg 384
              |||||||||||||| |||||||||
Sbjct: 117341 cagctgctgctgctgcttctgctg 117318



to top

>gb|AF319172.1|AF319172 Homo sapiens cGMP-specific phosphodiesterase type 5A (PDE5A) gene,
            partial cds
          Length = 3954

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 364  ctgctgctgcttcttctgctgggg 387
            |||||||||||||| |||||||||
Sbjct: 3874 ctgctgctgcttctgctgctgggg 3851



to top

>gb|AC027688.5| Homo sapiens chromosome 16 clone RP11-883G14, complete sequence
          Length = 177147

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 360    ccagctgctgctgcttcttctgct 383
              ||||||||||||||| ||||||||
Sbjct: 151691 ccagctgctgctgctgcttctgct 151668



to top

>ref|NM_001015470.1| Drosophila melanogaster CG40298-PA.3 (CG40298), mRNA
          Length = 1080

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 114 gaaagaaactatgtttacaa 133
           ||||||||||||||||||||
Sbjct: 274 gaaagaaactatgtttacaa 293



to top

>gb|AF106963.1|AF106963 Volvox carteri f. nagariensis somatic regenerator RegA (regA) mRNA,
            complete cds
          Length = 6725

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                        
Query: 363  gctgctgctgcttcttctgctgggggcc 390
            |||||||||||| || ||||||||||||
Sbjct: 2927 gctgctgctgctgctactgctgggggcc 2954



to top

>gb|AY857182.2| HIV-1 isolate 9762120 from Australia, partial genome
          Length = 8415

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 367  ctgctgcttcttctgctggg 386
            ||||||||||||||||||||
Sbjct: 1016 ctgctgcttcttctgctggg 997



to top

>dbj|AP003339.4| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, BAC
              clone:OJ1276_B06
          Length = 175174

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 102    agggaaatgttagaaagaaa 121
              ||||||||||||||||||||
Sbjct: 135680 agggaaatgttagaaagaaa 135699



to top

>dbj|AP001129.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC
             clone:P0644B06
          Length = 194509

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 112   tagaaagaaactatgtttacaaca 135
             ||||||||||||||||||| ||||
Sbjct: 62445 tagaaagaaactatgtttaaaaca 62468



to top

>dbj|AP005808.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC
             clone:OSJNBb0038F20
          Length = 129595

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 365   tgctgctgcttcttctgctg 384
             ||||||||||||||||||||
Sbjct: 57364 tgctgctgcttcttctgctg 57345



to top

>gb|AF155192.1|AF155192 Homo sapiens cGMP-specific phosphodiesterase PDE5A1 (PDE5A) mRNA,
           partial cds
          Length = 283

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 364 ctgctgctgcttcttctgctgggg 387
           |||||||||||||| |||||||||
Sbjct: 186 ctgctgctgcttctgctgctgggg 163



to top

>gb|AF155195.1|AF155195 Homo sapiens cGMP-specific phosphodiesterase (PDE5A) gene,
           alternative first exons and partial cds
          Length = 1853

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 364 ctgctgctgcttcttctgctgggg 387
           |||||||||||||| |||||||||
Sbjct: 163 ctgctgctgcttctgctgctgggg 140



to top

>ref|XM_313332.2| Anopheles gambiae str. PEST ENSANGP00000011295 (ENSANGG00000008806),
            partial mRNA
          Length = 5529

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 355  ctccaccagctgctgctgct 374
            ||||||||||||||||||||
Sbjct: 1728 ctccaccagctgctgctgct 1709



to top

>gb|AF149233.1|CLRHII2 Columba livia RH2 opsin (rhs) gene, exons 2 through 5 and complete
            cds
          Length = 1819

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 381  gctgggggcctgccagcaccgcag 404
            |||||||| |||||||||||||||
Sbjct: 1450 gctggggggctgccagcaccgcag 1473



to top

>dbj|AK072154.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013129M13, full
           insert sequence
          Length = 2100

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 357 ccaccagctgctgctgcttcttct 380
           |||||||||||||||||| |||||
Sbjct: 489 ccaccagctgctgctgctgcttct 466



to top

>dbj|AK071331.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023089C14, full
           insert sequence
          Length = 1594

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 357 ccaccagctgctgctgcttcttct 380
           |||||||||||||||||| |||||
Sbjct: 471 ccaccagctgctgctgctgcttct 448



to top

>dbj|AK070645.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023061L14, full
           insert sequence
          Length = 1666

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 365 tgctgctgcttcttctgctg 384
           ||||||||||||||||||||
Sbjct: 118 tgctgctgcttcttctgctg 137



to top

>dbj|AK069453.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023020J18, full
           insert sequence
          Length = 1412

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 365 tgctgctgcttcttctgctg 384
           ||||||||||||||||||||
Sbjct: 90  tgctgctgcttcttctgctg 109



to top

>gb|AF111672.1|AF111672 Meleagris gallopavo clone TUCA952 microsatellite sequence
          Length = 329

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 358 caccagctgctgctgcttct 377
           ||||||||||||||||||||
Sbjct: 211 caccagctgctgctgcttct 192



to top

>gb|AC007453.1|AC007453 Drosophila melanogaster, chromosome 2R, region 49C1-49D3, P1 clones
             DS04499, DS06146, and DS00455, complete sequence
          Length = 145055

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 366   gctgctgcttcttctgctgg 385
             ||||||||||||||||||||
Sbjct: 98849 gctgctgcttcttctgctgg 98830



to top

>gb|AE003762.4| Drosophila melanogaster chromosome 3R, section 100 of 118 of the
             complete sequence
          Length = 231486

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 363   gctgctgctgcttcttctgc 382
             ||||||||||||||||||||
Sbjct: 39587 gctgctgctgcttcttctgc 39568


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 3,986,302
Number of Sequences: 3902068
Number of extensions: 3986302
Number of successful extensions: 135492
Number of sequences better than 10.0: 273
Number of HSP's better than 10.0 without gapping: 276
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 134316
Number of HSP's gapped (non-prelim): 1153
length of query: 405
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 383
effective length of database: 17,147,199,772
effective search space: 6567377512676
effective search space used: 6567377512676
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top