>gb|CP000112.1| Desulfovibrio desulfuricans G20, complete genome
          Length = 3730232

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                    
Query: 217     cagtgagccagcaccgcaaca 237
               |||||||||||||||||||||
Sbjct: 1078300 cagtgagccagcaccgcaaca 1078280

>gb|AC073347.3| Homo sapiens BAC clone RP11-775L16 from 7, complete sequence
          Length = 197144

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 423   ttgagaaggctgctggggctg 443
             |||||||||||||||||||||
Sbjct: 12206 ttgagaaggctgctggggctg 12226

>gb|AC142291.1| Pan troglodytes BAC clone RP43-184P18 from 7, complete sequence
          Length = 152668

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 423   ttgagaaggctgctggggctg 443
             |||||||||||||||||||||
Sbjct: 23766 ttgagaaggctgctggggctg 23786

>dbj|BA000030.2| Streptomyces avermitilis MA-4680 genomic DNA, complete genome
          Length = 9025608

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                    
Query: 432     ctgctggggctgctgcgcctg 452
               |||||||||||||||||||||
Sbjct: 2094610 ctgctggggctgctgcgcctg 2094630



 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 429     aggctgctggggctgctgcg 448
               ||||||||||||||||||||
Sbjct: 3302995 aggctgctggggctgctgcg 3302976

>gb|AC135409.3| Rattus norvegicus 8 BAC CH230-416D7 (Children's Hospital Oakland
             Research Institute Rat (BN/SsNHsd/MCW) BAC library)
             complete sequence
          Length = 231716

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                         
Query: 161   cctctcctcagcgagccacaagctcagc 188
             |||||||||||| | |||||||||||||
Sbjct: 98437 cctctcctcagctacccacaagctcagc 98464

>gb|AC131129.4| Rattus norvegicus 17 BAC CH230-15O20 (Children's Hospital Oakland
            Research Institute) complete sequence
          Length = 232401

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 103  gacaacaccgacatgtgacacgca 126
            |||||||||||| |||||||||||
Sbjct: 1714 gacaacaccgacctgtgacacgca 1691

>ref|XM_676721.1| Aspergillus nidulans FGSC A4 hypothetical protein (AN8544.2), mRNA
          Length = 900

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 427 gaaggctgctggggctgctg 446
           ||||||||||||||||||||
Sbjct: 517 gaaggctgctggggctgctg 536



 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 427 gaaggctgctggggctgctg 446
           ||||||||||||||||||||
Sbjct: 265 gaaggctgctggggctgctg 284

>gb|AC121802.3| Mus musculus BAC clone RP23-434N18 from chromosome 18, complete
             sequence
          Length = 187787

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 428   aaggctgctggggctgctgc 447
             ||||||||||||||||||||
Sbjct: 59499 aaggctgctggggctgctgc 59518

>emb|Z82244.1|HS286B10 Human DNA sequence from clone CTA-286B10 on chromosome 22, complete
            sequence
          Length = 87869

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 425  gagaaggctgctggggctgc 444
            ||||||||||||||||||||
Sbjct: 7246 gagaaggctgctggggctgc 7265

>emb|AL732437.12| Human DNA sequence from clone RP11-116G8 on chromosome 10 Contains the
             NET1 gene for neuroepithelial cell transforming gene 1,
             the gene for calmodulin-like skin protein (CLSP), the
             CALML3 gene for calmodulin-like 3 (CLP) and four CpG
             islands, complete sequence
          Length = 183441

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 350   ggttctgagggtggtgctcc 369
             ||||||||||||||||||||
Sbjct: 84264 ggttctgagggtggtgctcc 84245

>gb|AC079223.11| Mus musculus chromosome 1, clone RP22-318M10, complete sequence
          Length = 137729

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 180   aagctcagctactctgagct 199
             ||||||||||||||||||||
Sbjct: 36948 aagctcagctactctgagct 36929

>gb|AC079383.17| Homo sapiens Xp BAC RP11-30A20 (Roswell Park Cancer Institute Human BAC
             Library) complete sequence
          Length = 151276

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 402   tgggtatccatggcccccat 421
             ||||||||||||||||||||
Sbjct: 82365 tgggtatccatggcccccat 82346

>dbj|AB118237.1| Rattus norvegicus rGGPS1 gene for geranylgeranyl diphosphate
            synthase1, complete cds, alternative splicing
          Length = 13601

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 103  gacaacaccgacatgtgacacgca 126
            |||||||||||| |||||||||||
Sbjct: 5463 gacaacaccgacctgtgacacgca 5486

>gb|AY107024.1| Zea mays PCO127729 mRNA sequence
          Length = 576

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 120 acacgcaacacgttaaaacgctct 143
           |||||||||| |||||||||||||
Sbjct: 445 acacgcaacatgttaaaacgctct 422

>gb|AC158559.7| Mus musculus chromosome 1, clone RP24-300L5, complete sequence
          Length = 169324

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 180   aagctcagctactctgagct 199
             ||||||||||||||||||||
Sbjct: 58041 aagctcagctactctgagct 58022


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 3,260,354
Number of Sequences: 3902068
Number of extensions: 3260354
Number of successful extensions: 53752
Number of sequences better than 10.0: 15
Number of HSP's better than 10.0 without gapping: 15
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 53662
Number of HSP's gapped (non-prelim): 90
length of query: 455
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 433
effective length of database: 17,147,199,772
effective search space: 7424737501276
effective search space used: 7424737501276
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)