ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbastl20c12
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1gb|AC125223.3| Mus musculus BAC clone RP23-31C10 from 13, comple... 44 0.35
2gb|AC104542.10| Mus musculus chromosome 1, clone RP23-165D11, co... 42 1.4
3gb|AC004682.1|HUAC004682 Homo sapiens Chromosome 16 BAC clone CI... 42 1.4
4gb|AY661558.1| Hordeum vulgare subsp. vulgare eIF4E gene locus, ... 42 1.4
5gb|AY817668.1| Homo sapiens arsenic (+3 oxidation state) methylt... 40 5.4
6gb|AC157211.7| Mus musculus chromosome 1, clone RP23-204C6, comp... 40 5.4
7gb|AC161169.10| Mus musculus chromosome 5, clone RP24-102B13, co... 40 5.4
8emb|Z98255.2|HS279N11 Human DNA sequence from clone RP1-279N11 o... 40 5.4
9emb|AL358790.22| Human DNA sequence from clone RP11-753C18 on ch... 40 5.4
10gb|AC009144.5|AC009144 Homo sapiens chromosome 16 clone RP11-551... 40 5.4
11gb|AC007011.1|AC007011 Homo sapiens chromosome 16 clone 165E7, c... 40 5.4

>gb|AC125223.3| Mus musculus BAC clone RP23-31C10 from 13, complete sequence
          Length = 221903

 Score = 44.1 bits (22), Expect = 0.35
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 290   atcctattccagcttctccatc 311
             ||||||||||||||||||||||
Sbjct: 42307 atcctattccagcttctccatc 42328



 Score = 44.1 bits (22), Expect = 0.35
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 217   atcctattccagcttctccatc 238
             ||||||||||||||||||||||
Sbjct: 42307 atcctattccagcttctccatc 42328



to top

>gb|AC104542.10| Mus musculus chromosome 1, clone RP23-165D11, complete sequence
          Length = 211537

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 299    cagcttctccatctgtcaaat 319
              |||||||||||||||||||||
Sbjct: 206122 cagcttctccatctgtcaaat 206102



 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 226    cagcttctccatctgtcaaat 246
              |||||||||||||||||||||
Sbjct: 206122 cagcttctccatctgtcaaat 206102



to top

>gb|AC004682.1|HUAC004682 Homo sapiens Chromosome 16 BAC clone CIT987SK-A-259H10, complete
             sequence
          Length = 189134

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 7     tattattggtaaaagtgtaaa 27
             |||||||||||||||||||||
Sbjct: 97446 tattattggtaaaagtgtaaa 97426



to top

>gb|AY661558.1| Hordeum vulgare subsp. vulgare eIF4E gene locus, complete sequence
          Length = 439641

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 36/41 (87%)
 Strand = Plus / Plus

                                                       
Query: 169    tagttacagttccatatgaccctggtgcggattctgcttcc 209
              |||||||||||||||||| || ||  ||| |||||||||||
Sbjct: 107524 tagttacagttccatatggccttgccgcgaattctgcttcc 107564



 Score = 42.1 bits (21), Expect = 1.4
 Identities = 33/37 (89%)
 Strand = Plus / Plus

                                                   
Query: 4      aactattattggtaaaagtgtaaatgatcagtgatac 40
              |||| |||||||||||||||| |||||| || |||||
Sbjct: 107387 aactgttattggtaaaagtgtgaatgatgagcgatac 107423



to top

>gb|AY817668.1| Homo sapiens arsenic (+3 oxidation state) methyltransferase (AS3MT)
             gene, complete cds
          Length = 38888

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 231   tctccatctgtcaaatgaag 250
             ||||||||||||||||||||
Sbjct: 34294 tctccatctgtcaaatgaag 34275



 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 304   tctccatctgtcaaatgaag 323
             ||||||||||||||||||||
Sbjct: 34294 tctccatctgtcaaatgaag 34275



to top

>gb|AC157211.7| Mus musculus chromosome 1, clone RP23-204C6, complete sequence
          Length = 206840

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 230    ttctccatctgtcaaatgaa 249
              ||||||||||||||||||||
Sbjct: 139356 ttctccatctgtcaaatgaa 139337



 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 303    ttctccatctgtcaaatgaa 322
              ||||||||||||||||||||
Sbjct: 139356 ttctccatctgtcaaatgaa 139337



to top

>gb|AC161169.10| Mus musculus chromosome 5, clone RP24-102B13, complete sequence
          Length = 239061

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 41     ggtgtccatacaaggatctc 60
              ||||||||||||||||||||
Sbjct: 211105 ggtgtccatacaaggatctc 211124



to top

>emb|Z98255.2|HS279N11 Human DNA sequence from clone RP1-279N11 on chromosome Xq11.2-13.3
            Contain the 3' end of a novel gene, complete sequence
          Length = 169998

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 233  tccatctgtcaaatgaagtt 252
            ||||||||||||||||||||
Sbjct: 9226 tccatctgtcaaatgaagtt 9245



 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 306  tccatctgtcaaatgaagtt 325
            ||||||||||||||||||||
Sbjct: 9226 tccatctgtcaaatgaagtt 9245



to top

>emb|AL358790.22| Human DNA sequence from clone RP11-753C18 on chromosome 10 Contains three
              novel genes, the CYP17A1 gene for cytochrome P450 17A1, a
              profilin 1 (PFN1) pseudogene, the gene for
              methyltransferase cyt19, an unactive progesterone receptor
              23 kD (TEBP) pseudogene, a ribosomal protein L22 (RPL22)
              pseudogene and a CpG island, complete sequence
          Length = 131753

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 231    tctccatctgtcaaatgaag 250
              ||||||||||||||||||||
Sbjct: 125852 tctccatctgtcaaatgaag 125833



 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 304    tctccatctgtcaaatgaag 323
              ||||||||||||||||||||
Sbjct: 125852 tctccatctgtcaaatgaag 125833



to top

>gb|AC009144.5|AC009144 Homo sapiens chromosome 16 clone RP11-551E2, complete sequence
          Length = 173758

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 231    tctccatctgtcaaatgaag 250
              ||||||||||||||||||||
Sbjct: 109885 tctccatctgtcaaatgaag 109866



 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 304    tctccatctgtcaaatgaag 323
              ||||||||||||||||||||
Sbjct: 109885 tctccatctgtcaaatgaag 109866



to top

>gb|AC007011.1|AC007011 Homo sapiens chromosome 16 clone 165E7, complete sequence
          Length = 161264

 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 228    gcttctccatctgtcaaatg 247
              ||||||||||||||||||||
Sbjct: 104715 gcttctccatctgtcaaatg 104696



 Score = 40.1 bits (20), Expect = 5.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 301    gcttctccatctgtcaaatg 320
              ||||||||||||||||||||
Sbjct: 104715 gcttctccatctgtcaaatg 104696


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 3,886,796
Number of Sequences: 3902068
Number of extensions: 3886796
Number of successful extensions: 67711
Number of sequences better than 10.0: 11
Number of HSP's better than 10.0 without gapping: 11
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 67679
Number of HSP's gapped (non-prelim): 32
length of query: 407
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 385
effective length of database: 17,147,199,772
effective search space: 6601671912220
effective search space used: 6601671912220
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top