ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbastl20c10
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1ref|XM_467437.1| Oryza sativa (japonica cultivar-group), mRNA 68 2e-08
2dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic D... 68 2e-08
3dbj|AP003983.3| Oryza sativa (japonica cultivar-group) genomic D... 68 2e-08
4dbj|AK065045.1| Oryza sativa (japonica cultivar-group) cDNA clon... 68 2e-08
5emb|AL355984.11| Human DNA sequence from clone RP11-501K3 on chr... 46 0.081
6emb|CR382398.1| Plasmodium falciparum chromosome 6, complete seq... 46 0.081
7gb|AC116798.11| Mus musculus chromosome 1, clone RP24-329K22, co... 42 1.3
8gb|AY318871.1| Canarypox virus strain ATCC VR-111, complete genome 42 1.3
9emb|AM039952.1| Xanthomonas campestris pv. vesicatoria complete ... 42 1.3
10emb|CR847496.7| Zebrafish DNA sequence from clone CH211-203D1 in... 42 1.3
11gb|AC114553.6| Mus musculus chromosome 5, clone RP23-408M16, com... 42 1.3
12emb|AL713998.7| Human DNA sequence from clone RP11-301G19 on chr... 42 1.3
13gb|AC158753.8| Mus musculus chromosome 5, clone RP23-301E24, com... 42 1.3
14gb|AC023904.10| Homo sapiens chromosome 10 clone RP11-369L1, com... 42 1.3
15gb|AC131005.3| Homo sapiens 3 BAC RP11-88K11 (Roswell Park Cance... 42 1.3
16emb|AL954143.9| Zebrafish DNA sequence from clone CH211-206A7 in... 42 1.3
17emb|CR759813.6| Zebrafish DNA sequence from clone DKEY-150H10 in... 42 1.3
18gb|AC142502.3| Mus musculus BAC clone RP24-530L11 from 3, comple... 42 1.3
19ref|NM_012674.1| Rattus norvegicus serine protease inhibitor, Ka... 40 5.0
20gb|AC150162.1| Solanum demissum chromosome 5 clone PGEC160O2 map... 40 5.0
21gb|AC009394.5| Drosophila melanogaster clone BACR03J17, complete... 40 5.0
22gb|AC009462.7| Drosophila melanogaster clone BACR27G04, complete... 40 5.0
23gb|AC138330.4| Mus musculus BAC clone RP23-19L20 from chromosome... 40 5.0
24gb|AC132270.3| Mus musculus BAC clone RP24-338C23 from chromosom... 40 5.0
25ref|XM_801535.1| Trypanosoma cruzi strain CL Brener adenylosucci... 40 5.0
26gb|AC123840.4| Mus musculus BAC clone RP23-399K5 from chromosome... 40 5.0
27gb|AC122016.4| Mus musculus BAC clone RP24-359J23 from chromosom... 40 5.0
28gb|AC157800.9| Mus musculus chromosome 1, clone RP24-286C21, com... 40 5.0
29emb|AL513166.7| Human DNA sequence from clone RP11-261J10 on chr... 40 5.0
30gb|AC069504.7| Homo sapiens 3 BAC RP11-263A24 (Roswell Park Canc... 40 5.0
31gb|AC090671.5| Homo sapiens 12 BAC RP11-755O11 (Roswell Park Can... 40 5.0
32emb|CR382137.1| Debaryomyces hansenii chromosome E of strain CBS... 40 5.0
33gb|AC091096.7| Homo sapiens chromosome 8, clone RP11-587H10, com... 40 5.0
34gb|AC090506.7| Homo sapiens chromosome 18, clone RP11-675P14, co... 40 5.0
35emb|AL805942.5| Mouse DNA sequence from clone RP24-71G5 on chrom... 40 5.0
36gb|AY040765.1| Mus musculus histidine triad protein 3 gene, comp... 40 5.0
37gb|AY998454.1| Solanum pectinatum voucher Peeke 8512 IND tRNA-Se... 40 5.0
38gb|AC009709.7|AC009709 Homo sapiens chromosome 18, clone RP11-31... 40 5.0
39gb|AC022193.5|AC022193 Homo sapiens, clone RP11-23B3, complete s... 40 5.0
40gb|AC018878.8| Homo sapiens BAC clone RP11-297N12 from 2, comple... 40 5.0
41gb|AC007274.3|AC007274 Homo sapiens BAC clone RP11-105L10 from Y... 40 5.0
42gb|AC016240.23| Homo sapiens chromosome 8, clone RP11-27N21, com... 40 5.0
43gb|AC006195.1|AC006195 Homo sapiens clone RP11-350H1 from 7p14-1... 40 5.0
44dbj|BA000019.2| Nostoc sp. PCC 7120 DNA, complete genome 40 5.0
45gb|AC007911.8|AC007911 Homo sapiens chromosome 18, clone RP11-52... 40 5.0
46gb|AE003721.3| Drosophila melanogaster chromosome 3R, section 59... 40 5.0
47emb|AL732626.8| Mouse DNA sequence from clone RP23-191F22 on chr... 40 5.0
48gb|M35299.1|RATPSTIAA Rat pancreatic secretory trypsin inhibitor... 40 5.0

>ref|XM_467437.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 3793

 Score = 67.9 bits (34), Expect = 2e-08
 Identities = 61/70 (87%)
 Strand = Plus / Minus

                                                                        
Query: 307  tgcaacgcttttattgttctcctcttacatgtgtcggtctccggttcaaaagtgagctcc 366
            ||||||||||||||| ||| |||||| ||||||   ||||| ||||||||  ||||||||
Sbjct: 3468 tgcaacgcttttattattcccctcttccatgtggaagtctctggttcaaacctgagctcc 3409

                      
Query: 367  caggtcggcc 376
            ||||||||||
Sbjct: 3408 caggtcggcc 3399



 Score = 40.1 bits (20), Expect = 5.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 119  aattatccacaggcaatgaa 138
            ||||||||||||||||||||
Sbjct: 3709 aattatccacaggcaatgaa 3690



to top

>dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, complete
                sequence
          Length = 35954743

 Score = 67.9 bits (34), Expect = 2e-08
 Identities = 61/70 (87%)
 Strand = Plus / Plus

                                                                            
Query: 307      tgcaacgcttttattgttctcctcttacatgtgtcggtctccggttcaaaagtgagctcc 366
                ||||||||||||||| ||| |||||| ||||||   ||||| ||||||||  ||||||||
Sbjct: 29502251 tgcaacgcttttattattcccctcttccatgtggaagtctctggttcaaacctgagctcc 29502310

                          
Query: 367      caggtcggcc 376
                ||||||||||
Sbjct: 29502311 caggtcggcc 29502320



 Score = 40.1 bits (20), Expect = 5.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                    
Query: 119      aattatccacaggcaatgaa 138
                ||||||||||||||||||||
Sbjct: 29502010 aattatccacaggcaatgaa 29502029



to top

>dbj|AP003983.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC
             clone:OJ1038_A06
          Length = 147836

 Score = 67.9 bits (34), Expect = 2e-08
 Identities = 61/70 (87%)
 Strand = Plus / Plus

                                                                         
Query: 307   tgcaacgcttttattgttctcctcttacatgtgtcggtctccggttcaaaagtgagctcc 366
             ||||||||||||||| ||| |||||| ||||||   ||||| ||||||||  ||||||||
Sbjct: 97281 tgcaacgcttttattattcccctcttccatgtggaagtctctggttcaaacctgagctcc 97340

                       
Query: 367   caggtcggcc 376
             ||||||||||
Sbjct: 97341 caggtcggcc 97350



 Score = 40.1 bits (20), Expect = 5.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 119   aattatccacaggcaatgaa 138
             ||||||||||||||||||||
Sbjct: 97040 aattatccacaggcaatgaa 97059



to top

>dbj|AK065045.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013001I02, full
            insert sequence
          Length = 3793

 Score = 67.9 bits (34), Expect = 2e-08
 Identities = 61/70 (87%)
 Strand = Plus / Minus

                                                                        
Query: 307  tgcaacgcttttattgttctcctcttacatgtgtcggtctccggttcaaaagtgagctcc 366
            ||||||||||||||| ||| |||||| ||||||   ||||| ||||||||  ||||||||
Sbjct: 3468 tgcaacgcttttattattcccctcttccatgtggaagtctctggttcaaacctgagctcc 3409

                      
Query: 367  caggtcggcc 376
            ||||||||||
Sbjct: 3408 caggtcggcc 3399



to top

>emb|AL355984.11| Human DNA sequence from clone RP11-501K3 on chromosome 13 Contains the
             GJB6 gene for gap junction protein, beta 6 (connexin 30)
             and 2 CpG islands, complete sequence
          Length = 160536

 Score = 46.1 bits (23), Expect = 0.081
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                        
Query: 76    aaaatatatgaaataggtacagaaaag 102
             ||||||||||||||| |||||||||||
Sbjct: 74740 aaaatatatgaaatatgtacagaaaag 74714



to top

>emb|CR382398.1| Plasmodium falciparum chromosome 6, complete sequence; segment 1/5
          Length = 349418

 Score = 46.1 bits (23), Expect = 0.081
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                     
Query: 70     ataataaaaatatatgaaatagg 92
              |||||||||||||||||||||||
Sbjct: 197399 ataataaaaatatatgaaatagg 197421



to top

>gb|AC116798.11| Mus musculus chromosome 1, clone RP24-329K22, complete sequence
          Length = 173479

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 221   ttcctcgcctctccatgcttg 241
             |||||||||||||||||||||
Sbjct: 93705 ttcctcgcctctccatgcttg 93685



to top

>gb|AY318871.1| Canarypox virus strain ATCC VR-111, complete genome
          Length = 359853

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                          
Query: 71    taataaaaatatatgaaataggtacagaa 99
             |||||||| || |||||||||||||||||
Sbjct: 28886 taataaaagtagatgaaataggtacagaa 28858



to top

>emb|AM039952.1| Xanthomonas campestris pv. vesicatoria complete genome
          Length = 5178466

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                    
Query: 206     gacagcatttcaaagttcctc 226
               |||||||||||||||||||||
Sbjct: 3090211 gacagcatttcaaagttcctc 3090191



to top

>emb|CR847496.7| Zebrafish DNA sequence from clone CH211-203D1 in linkage group 14,
             complete sequence
          Length = 157741

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 70    ataataaaaatatatgaaata 90
             |||||||||||||||||||||
Sbjct: 81427 ataataaaaatatatgaaata 81447



to top

>gb|AC114553.6| Mus musculus chromosome 5, clone RP23-408M16, complete sequence
          Length = 198281

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 30/33 (90%)
 Strand = Plus / Minus

                                               
Query: 59     gcttctacaggataataaaaatatatgaaatag 91
              ||||||||||||||||||||  | |||||||||
Sbjct: 181059 gcttctacaggataataaaataaaatgaaatag 181027



to top

>emb|AL713998.7| Human DNA sequence from clone RP11-301G19 on chromosome 6, complete
             sequence
          Length = 184887

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 63    ctacaggataataaaaatata 83
             |||||||||||||||||||||
Sbjct: 88035 ctacaggataataaaaatata 88015



to top

>gb|AC158753.8| Mus musculus chromosome 5, clone RP23-301E24, complete sequence
          Length = 190368

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 30/33 (90%)
 Strand = Plus / Minus

                                              
Query: 59    gcttctacaggataataaaaatatatgaaatag 91
             ||||||||||||||||||||  | |||||||||
Sbjct: 18421 gcttctacaggataataaaataaaatgaaatag 18389



to top

>gb|AC023904.10| Homo sapiens chromosome 10 clone RP11-369L1, complete sequence
          Length = 190712

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 70     ataataaaaatatatgaaata 90
              |||||||||||||||||||||
Sbjct: 107659 ataataaaaatatatgaaata 107679



to top

>gb|AC131005.3| Homo sapiens 3 BAC RP11-88K11 (Roswell Park Cancer Institute Human BAC
              Library) complete sequence
          Length = 191231

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                           
Query: 57     ttgcttctacaggataataaaaatatatg 85
              ||||||||||| || ||||||||||||||
Sbjct: 109828 ttgcttctacatgagaataaaaatatatg 109800



to top

>emb|AL954143.9| Zebrafish DNA sequence from clone CH211-206A7 in linkage group 19,
             complete sequence
          Length = 168515

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 70    ataataaaaatatatgaaata 90
             |||||||||||||||||||||
Sbjct: 66230 ataataaaaatatatgaaata 66250



to top

>emb|CR759813.6| Zebrafish DNA sequence from clone DKEY-150H10 in linkage group 18,
             complete sequence
          Length = 152902

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 70    ataataaaaatatatgaaata 90
             |||||||||||||||||||||
Sbjct: 47337 ataataaaaatatatgaaata 47317



to top

>gb|AC142502.3| Mus musculus BAC clone RP24-530L11 from 3, complete sequence
          Length = 160259

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 231    ctccatgcttggccttcctaa 251
              |||||||||||||||||||||
Sbjct: 124107 ctccatgcttggccttcctaa 124087



to top

>ref|NM_012674.1| Rattus norvegicus serine protease inhibitor, Kazal type 1 (Spink1),
            mRNA
          Length = 2338

 Score = 40.1 bits (20), Expect = 5.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 70   ataataaaaatatatgaaat 89
            ||||||||||||||||||||
Sbjct: 2301 ataataaaaatatatgaaat 2320



to top

>gb|AC150162.1| Solanum demissum chromosome 5 clone PGEC160O2 map MAP_LOC, complete
             sequence
          Length = 125813

 Score = 40.1 bits (20), Expect = 5.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 71    taataaaaatatatgaaata 90
             ||||||||||||||||||||
Sbjct: 65736 taataaaaatatatgaaata 65717



to top

>gb|AC009394.5| Drosophila melanogaster clone BACR03J17, complete sequence
          Length = 199043

 Score = 40.1 bits (20), Expect = 5.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 73    ataaaaatatatgaaatagg 92
             ||||||||||||||||||||
Sbjct: 26393 ataaaaatatatgaaatagg 26412



to top

>gb|AC009462.7| Drosophila melanogaster clone BACR27G04, complete sequence
          Length = 151609

 Score = 40.1 bits (20), Expect = 5.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 73     ataaaaatatatgaaatagg 92
              ||||||||||||||||||||
Sbjct: 106463 ataaaaatatatgaaatagg 106482



to top

>gb|AC138330.4| Mus musculus BAC clone RP23-19L20 from chromosome 13, complete sequence
          Length = 190901

 Score = 40.1 bits (20), Expect = 5.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 69     gataataaaaatatatgaaa 88
              ||||||||||||||||||||
Sbjct: 173690 gataataaaaatatatgaaa 173671



to top

>gb|AC132270.3| Mus musculus BAC clone RP24-338C23 from chromosome 5, complete sequence
          Length = 145471

 Score = 40.1 bits (20), Expect = 5.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 70    ataataaaaatatatgaaat 89
             ||||||||||||||||||||
Sbjct: 15740 ataataaaaatatatgaaat 15721



to top

>ref|XM_801535.1| Trypanosoma cruzi strain CL Brener adenylosuccinate synthetase
            (Tc00.1047053508731.60) partial mRNA
          Length = 1851

 Score = 40.1 bits (20), Expect = 5.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 6    accttttgcggaaaaatagt 25
            ||||||||||||||||||||
Sbjct: 1197 accttttgcggaaaaatagt 1178



to top

>gb|AC123840.4| Mus musculus BAC clone RP23-399K5 from chromosome 13, complete sequence
          Length = 191185

 Score = 40.1 bits (20), Expect = 5.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 69    gataataaaaatatatgaaa 88
             ||||||||||||||||||||
Sbjct: 30797 gataataaaaatatatgaaa 30778



to top

>gb|AC122016.4| Mus musculus BAC clone RP24-359J23 from chromosome 16, complete
             sequence
          Length = 163943

 Score = 40.1 bits (20), Expect = 5.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 65    acaggataataaaaatatat 84
             ||||||||||||||||||||
Sbjct: 88449 acaggataataaaaatatat 88430



to top

>gb|AC157800.9| Mus musculus chromosome 1, clone RP24-286C21, complete sequence
          Length = 164708

 Score = 40.1 bits (20), Expect = 5.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 70    ataataaaaatatatgaaat 89
             ||||||||||||||||||||
Sbjct: 29776 ataataaaaatatatgaaat 29795



to top

>emb|AL513166.7| Human DNA sequence from clone RP11-261J10 on chromosome 1, complete
             sequence
          Length = 170817

 Score = 40.1 bits (20), Expect = 5.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 240   tggccttcctaaagaaggcc 259
             ||||||||||||||||||||
Sbjct: 13243 tggccttcctaaagaaggcc 13262



to top

>gb|AC069504.7| Homo sapiens 3 BAC RP11-263A24 (Roswell Park Cancer Institute Human BAC
             Library) complete sequence
          Length = 39624

 Score = 40.1 bits (20), Expect = 5.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 73    ataaaaatatatgaaatagg 92
             ||||||||||||||||||||
Sbjct: 30433 ataaaaatatatgaaatagg 30452



to top

>gb|AC090671.5| Homo sapiens 12 BAC RP11-755O11 (Roswell Park Cancer Institute Human
             BAC Library) complete sequence
          Length = 186298

 Score = 40.1 bits (20), Expect = 5.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 75    aaaaatatatgaaataggta 94
             ||||||||||||||||||||
Sbjct: 16813 aaaaatatatgaaataggta 16832



to top

>emb|CR382137.1| Debaryomyces hansenii chromosome E of strain CBS767 of Debaryomyces
               hansenii
          Length = 2037969

 Score = 40.1 bits (20), Expect = 5.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 71      taataaaaatatatgaaata 90
               ||||||||||||||||||||
Sbjct: 1475497 taataaaaatatatgaaata 1475478



to top

>gb|AC091096.7| Homo sapiens chromosome 8, clone RP11-587H10, complete sequence
          Length = 207630

 Score = 40.1 bits (20), Expect = 5.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 257    gcccactgaaaatatcacaa 276
              ||||||||||||||||||||
Sbjct: 185838 gcccactgaaaatatcacaa 185819



to top

>gb|AC090506.7| Homo sapiens chromosome 18, clone RP11-675P14, complete sequence
          Length = 188609

 Score = 40.1 bits (20), Expect = 5.0
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 59    gcttctacaggataataaaaatat 82
             ||||||||||||||||| ||||||
Sbjct: 82368 gcttctacaggataatacaaatat 82345



to top

>emb|AL805942.5| Mouse DNA sequence from clone RP24-71G5 on chromosome 2, complete
             sequence
          Length = 81209

 Score = 40.1 bits (20), Expect = 5.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 71    taataaaaatatatgaaata 90
             ||||||||||||||||||||
Sbjct: 79111 taataaaaatatatgaaata 79130



to top

>gb|AY040765.1| Mus musculus histidine triad protein 3 gene, complete cds
          Length = 2916

 Score = 40.1 bits (20), Expect = 5.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 73   ataaaaatatatgaaatagg 92
            ||||||||||||||||||||
Sbjct: 2901 ataaaaatatatgaaatagg 2882



to top

>gb|AY998454.1| Solanum pectinatum voucher Peeke 8512 IND tRNA-Ser (trnS) gene,
           partial sequence; trnS-trnG intergenic spacer, complete
           sequence; and tRNA-Gly (trnG) gene, partial sequence;
           chloroplast
          Length = 688

 Score = 40.1 bits (20), Expect = 5.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 72  aataaaaatatatgaaatag 91
           ||||||||||||||||||||
Sbjct: 431 aataaaaatatatgaaatag 450



to top

>gb|AC009709.7|AC009709 Homo sapiens chromosome 18, clone RP11-319O9, complete sequence
          Length = 187615

 Score = 40.1 bits (20), Expect = 5.0
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 55    tattgcttctacaggataataaaa 78
             ||||||||| ||||||||||||||
Sbjct: 66177 tattgcttccacaggataataaaa 66200



to top

>gb|AC022193.5|AC022193 Homo sapiens, clone RP11-23B3, complete sequence
          Length = 184228

 Score = 40.1 bits (20), Expect = 5.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 257    gcccactgaaaatatcacaa 276
              ||||||||||||||||||||
Sbjct: 106215 gcccactgaaaatatcacaa 106234



to top

>gb|AC018878.8| Homo sapiens BAC clone RP11-297N12 from 2, complete sequence
          Length = 170801

 Score = 40.1 bits (20), Expect = 5.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 71     taataaaaatatatgaaata 90
              ||||||||||||||||||||
Sbjct: 127695 taataaaaatatatgaaata 127714



to top

>gb|AC007274.3|AC007274 Homo sapiens BAC clone RP11-105L10 from Y, complete sequence
          Length = 117309

 Score = 40.1 bits (20), Expect = 5.0
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                         
Query: 147   gtcatctattgaattacactatatccta 174
             ||||| ||||||||||||||||| ||||
Sbjct: 55997 gtcatttattgaattacactataaccta 55970



to top

>gb|AC016240.23| Homo sapiens chromosome 8, clone RP11-27N21, complete sequence
          Length = 167578

 Score = 40.1 bits (20), Expect = 5.0
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                         
Query: 121   ttatccacaggcaatgaaatccctatgt 148
             ||||||| ||| ||||||||||||||||
Sbjct: 79659 ttatccaaaggaaatgaaatccctatgt 79686



to top

>gb|AC006195.1|AC006195 Homo sapiens clone RP11-350H1 from 7p14-15, complete sequence
          Length = 150242

 Score = 40.1 bits (20), Expect = 5.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 73     ataaaaatatatgaaatagg 92
              ||||||||||||||||||||
Sbjct: 140438 ataaaaatatatgaaatagg 140457



to top

>dbj|BA000019.2| Nostoc sp. PCC 7120 DNA, complete genome
          Length = 6413771

 Score = 40.1 bits (20), Expect = 5.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 61     ttctacaggataataaaaat 80
              ||||||||||||||||||||
Sbjct: 281695 ttctacaggataataaaaat 281714



to top

>gb|AC007911.8|AC007911 Homo sapiens chromosome 18, clone RP11-520K18, complete sequence
          Length = 160299

 Score = 40.1 bits (20), Expect = 5.0
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 55    tattgcttctacaggataataaaa 78
             ||||||||| ||||||||||||||
Sbjct: 59912 tattgcttccacaggataataaaa 59935



to top

>gb|AE003721.3| Drosophila melanogaster chromosome 3R, section 59 of 118 of the
             complete sequence
          Length = 224889

 Score = 40.1 bits (20), Expect = 5.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 73    ataaaaatatatgaaatagg 92
             ||||||||||||||||||||
Sbjct: 46887 ataaaaatatatgaaatagg 46906



to top

>emb|AL732626.8| Mouse DNA sequence from clone RP23-191F22 on chromosome 4, complete
             sequence
          Length = 151688

 Score = 40.1 bits (20), Expect = 5.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 73    ataaaaatatatgaaatagg 92
             ||||||||||||||||||||
Sbjct: 91473 ataaaaatatatgaaatagg 91492



to top

>gb|M35299.1|RATPSTIAA Rat pancreatic secretory trypsin inhibitor-like protein (PSTI) mRNA,
            complete cds
          Length = 2338

 Score = 40.1 bits (20), Expect = 5.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 70   ataataaaaatatatgaaat 89
            ||||||||||||||||||||
Sbjct: 2301 ataataaaaatatatgaaat 2320


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 3,989,670
Number of Sequences: 3902068
Number of extensions: 3989670
Number of successful extensions: 89764
Number of sequences better than 10.0: 48
Number of HSP's better than 10.0 without gapping: 48
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 89597
Number of HSP's gapped (non-prelim): 167
length of query: 376
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 354
effective length of database: 17,147,199,772
effective search space: 6070108719288
effective search space used: 6070108719288
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top