ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbastl20b10
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1gb|AC162940.4| Mus musculus BAC clone RP23-95D3 from chromosome ... 44 0.36
2gb|AC131117.4| Mus musculus BAC clone RP24-351I18 from 13, compl... 44 0.36
3gb|AC124128.11| Mus musculus chromosome 6, clone RP23-158O11, co... 42 1.4
4emb|BX629343.11| Zebrafish DNA sequence from clone DKEY-66M17 in... 42 1.4
5emb|BX284692.14| Zebrafish DNA sequence from clone CH211-282O22 ... 42 1.4
6gb|AC102611.10| Mus musculus chromosome 1, clone RP23-416O18, co... 40 5.6
7gb|AC138595.10| Mus musculus chromosome 1, clone RP24-286D13, co... 40 5.6
8ref|XM_648854.1| Entamoeba histolytica HM-1:IMSS hypothetical pr... 40 5.6
9emb|AL390765.17| Human DNA sequence from clone RP11-509I1 on chr... 40 5.6
10emb|AL356534.12| Human DNA sequence from clone RP11-629P13 on ch... 40 5.6
11gb|AF461197.1| Medicago sativa cytosolic malate dehydrogenase ge... 40 5.6
12emb|CR925789.6| Zebrafish DNA sequence from clone DKEY-47M9 in l... 40 5.6
13gb|AC100834.3| Homo sapiens chromosome 15, clone CTD-2125J1, com... 40 5.6
14gb|AC117531.2| Homo sapiens chromosome 5 clone RP11-603O17, comp... 40 5.6
15gb|AC159216.2| Pan troglodytes BAC clone CH251-477A18 from chrom... 40 5.6
16gb|AC006432.15| Homo sapiens 12p13 PAC RPCI11-726G1 (Roswell Par... 40 5.6
17gb|AC027671.9| Homo sapiens chromosome 10 clone RP11-183F21, com... 40 5.6
18gb|AC104040.3| Homo sapiens chromosome 8, clone CTD-2023L15, com... 40 5.6
19gb|AC009334.8| Homo sapiens chromosome 1, clone RP11-45L2, compl... 40 5.6
20gb|AF312994.1|AF312994 Mus musculus chromosome 1 clone MML, comp... 40 5.6
21gb|AC092821.11| Homo sapiens 12 BAC RP11-525E9 (Roswell Park Can... 40 5.6
22gb|AC104257.12| Homo sapiens chromosome 8, clone CTD-2501M5, com... 40 5.6
23gb|AC113346.2| Homo sapiens chromosome 5 clone CTD-2532K18, comp... 40 5.6
24gb|AC124442.3| Mus musculus BAC clone RP24-178G20 from 7, comple... 40 5.6
25emb|AL807814.5| Mouse DNA sequence from clone RP23-392I19 on chr... 40 5.6
26emb|AL669898.17| Mouse DNA sequence from clone RP23-6C3 on chrom... 40 5.6
27gb|AC161208.9| Mus musculus chromosome 5, clone RP23-71M14, comp... 40 5.6

>gb|AC162940.4| Mus musculus BAC clone RP23-95D3 from chromosome 13, complete sequence
          Length = 218228

 Score = 44.1 bits (22), Expect = 0.36
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                       
Query: 385   cagcttctactgttgtcagaccatgt 410
             |||||||| |||||||||||||||||
Sbjct: 45905 cagcttctcctgttgtcagaccatgt 45930



to top

>gb|AC131117.4| Mus musculus BAC clone RP24-351I18 from 13, complete sequence
          Length = 193056

 Score = 44.1 bits (22), Expect = 0.36
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                        
Query: 385    cagcttctactgttgtcagaccatgt 410
              |||||||| |||||||||||||||||
Sbjct: 149904 cagcttctcctgttgtcagaccatgt 149929



to top

>gb|AC124128.11| Mus musculus chromosome 6, clone RP23-158O11, complete sequence
          Length = 208907

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 303   tatcaaacaccataatgataa 323
             |||||||||||||||||||||
Sbjct: 75495 tatcaaacaccataatgataa 75515



to top

>emb|BX629343.11| Zebrafish DNA sequence from clone DKEY-66M17 in linkage group 13,
             complete sequence
          Length = 207677

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 368   aacatgggcaagcatggcagc 388
             |||||||||||||||||||||
Sbjct: 38318 aacatgggcaagcatggcagc 38298



to top

>emb|BX284692.14| Zebrafish DNA sequence from clone CH211-282O22 in linkage group 17,
             complete sequence
          Length = 162970

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 241   aaaagttccatgtaaaattaa 261
             |||||||||||||||||||||
Sbjct: 15660 aaaagttccatgtaaaattaa 15640



to top

>gb|AC102611.10| Mus musculus chromosome 1, clone RP23-416O18, complete sequence
          Length = 210808

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 370  catgggcaagcatggcagct 389
            ||||||||||||||||||||
Sbjct: 8378 catgggcaagcatggcagct 8397



to top

>gb|AC138595.10| Mus musculus chromosome 1, clone RP24-286D13, complete sequence
          Length = 172490

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 370    catgggcaagcatggcagct 389
              ||||||||||||||||||||
Sbjct: 121487 catgggcaagcatggcagct 121506



to top

>ref|XM_648854.1| Entamoeba histolytica HM-1:IMSS hypothetical protein (68.t00042)
           partial mRNA
          Length = 621

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 241 aaaagttccatgtaaaatta 260
           ||||||||||||||||||||
Sbjct: 57  aaaagttccatgtaaaatta 76



to top

>emb|AL390765.17| Human DNA sequence from clone RP11-509I1 on chromosome 1 Contains the
             5' end of the GNG4 gene for guanine nucleotide binding (G
             protein) gamma 4 protein, the 3' end of the CHS1 gene for
             Chediak-Higashi syndrome 1 protein and a CpG island,
             complete sequence
          Length = 80101

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 243   aagttccatgtaaaattaag 262
             ||||||||||||||||||||
Sbjct: 68261 aagttccatgtaaaattaag 68280



to top

>emb|AL356534.12| Human DNA sequence from clone RP11-629P13 on chromosome 6, complete
             sequence
          Length = 175757

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 250   atgtaaaattaagcaagaca 269
             ||||||||||||||||||||
Sbjct: 97977 atgtaaaattaagcaagaca 97958



to top

>gb|AF461197.1| Medicago sativa cytosolic malate dehydrogenase gene, exons 1 and 2
            and partial cds
          Length = 3482

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 225  gactcagatgcagttgaaaa 244
            ||||||||||||||||||||
Sbjct: 1759 gactcagatgcagttgaaaa 1778



to top

>emb|CR925789.6| Zebrafish DNA sequence from clone DKEY-47M9 in linkage group 14,
             complete sequence
          Length = 173071

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 161   caacacaggcacatacagtc 180
             ||||||||||||||||||||
Sbjct: 15222 caacacaggcacatacagtc 15203



to top

>gb|AC100834.3| Homo sapiens chromosome 15, clone CTD-2125J1, complete sequence
          Length = 152005

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 21    tataatttacacaatcacaa 40
             ||||||||||||||||||||
Sbjct: 49479 tataatttacacaatcacaa 49498



to top

>gb|AC117531.2| Homo sapiens chromosome 5 clone RP11-603O17, complete sequence
          Length = 160415

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 351    gcattctctctccagccaac 370
              ||||||||||||||||||||
Sbjct: 120853 gcattctctctccagccaac 120872



to top

>gb|AC159216.2| Pan troglodytes BAC clone CH251-477A18 from chromosome unknown,
             complete sequence
          Length = 206361

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 238   ttgaaaagttccatgtaaaa 257
             ||||||||||||||||||||
Sbjct: 36625 ttgaaaagttccatgtaaaa 36606



to top

>gb|AC006432.15| Homo sapiens 12p13 PAC RPCI11-726G1 (Roswell Park Cancer Institute Human
              PAC Library) complete sequence
          Length = 180685

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 42     atgaaaacccagccgcttgg 61
              ||||||||||||||||||||
Sbjct: 149997 atgaaaacccagccgcttgg 150016



to top

>gb|AC027671.9| Homo sapiens chromosome 10 clone RP11-183F21, complete sequence
          Length = 152867

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 238   ttgaaaagttccatgtaaaa 257
             ||||||||||||||||||||
Sbjct: 68713 ttgaaaagttccatgtaaaa 68732



to top

>gb|AC104040.3| Homo sapiens chromosome 8, clone CTD-2023L15, complete sequence
          Length = 136646

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 67     atagtttttacccttgcata 86
              ||||||||||||||||||||
Sbjct: 126304 atagtttttacccttgcata 126323



to top

>gb|AC009334.8| Homo sapiens chromosome 1, clone RP11-45L2, complete sequence
          Length = 165618

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 243   aagttccatgtaaaattaag 262
             ||||||||||||||||||||
Sbjct: 99816 aagttccatgtaaaattaag 99797



to top

>gb|AF312994.1|AF312994 Mus musculus chromosome 1 clone MML, complete sequence
          Length = 228283

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 370    catgggcaagcatggcagct 389
              ||||||||||||||||||||
Sbjct: 209953 catgggcaagcatggcagct 209972



to top

>gb|AC092821.11| Homo sapiens 12 BAC RP11-525E9 (Roswell Park Cancer Institute Human BAC
             Library) complete sequence
          Length = 121181

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 42    atgaaaacccagccgcttgg 61
             ||||||||||||||||||||
Sbjct: 43656 atgaaaacccagccgcttgg 43637



to top

>gb|AC104257.12| Homo sapiens chromosome 8, clone CTD-2501M5, complete sequence
          Length = 167787

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 67     atagtttttacccttgcata 86
              ||||||||||||||||||||
Sbjct: 111632 atagtttttacccttgcata 111613



to top

>gb|AC113346.2| Homo sapiens chromosome 5 clone CTD-2532K18, complete sequence
          Length = 175075

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 351  gcattctctctccagccaac 370
            ||||||||||||||||||||
Sbjct: 2669 gcattctctctccagccaac 2688



to top

>gb|AC124442.3| Mus musculus BAC clone RP24-178G20 from 7, complete sequence
          Length = 177517

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 371    atgggcaagcatggcagcttctac 394
              ||||||||||||||||| ||||||
Sbjct: 139658 atgggcaagcatggcaggttctac 139635



to top

>emb|AL807814.5| Mouse DNA sequence from clone RP23-392I19 on chromosome X, complete
              sequence
          Length = 173965

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 350    agcattctctctccagccaa 369
              ||||||||||||||||||||
Sbjct: 116884 agcattctctctccagccaa 116903



to top

>emb|AL669898.17| Mouse DNA sequence from clone RP23-6C3 on chromosome X, complete sequence
          Length = 220201

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 82     gcataacaatgcttagaaga 101
              ||||||||||||||||||||
Sbjct: 156998 gcataacaatgcttagaaga 157017



to top

>gb|AC161208.9| Mus musculus chromosome 5, clone RP23-71M14, complete sequence
          Length = 211079

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 98     aagatttcagcatgaacaaa 117
              ||||||||||||||||||||
Sbjct: 157591 aagatttcagcatgaacaaa 157572


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 3,652,574
Number of Sequences: 3902068
Number of extensions: 3652574
Number of successful extensions: 63566
Number of sequences better than 10.0: 27
Number of HSP's better than 10.0 without gapping: 27
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 63519
Number of HSP's gapped (non-prelim): 47
length of query: 417
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 395
effective length of database: 17,147,199,772
effective search space: 6773143909940
effective search space used: 6773143909940
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top