ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbastl19d10
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1gb|DP000031.1| Dasypus novemcinctus target 116 genomic scaffold 46 0.099
2emb|Z12028.1|LPBFRUCG L.pimpinellifolium gene encoding vacuolar ... 44 0.39
3emb|Z12027.1|LEBFRUCG L.esculentum gene for vacuolar invertase 44 0.39
4gb|AC105247.16| Homo sapiens chromosome 18, clone CTD-2545G7, co... 42 1.5
5emb|AL390840.17| Human DNA sequence from clone RP13-213K19 on ch... 40 6.1
6gb|CP000090.1| Ralstonia eutropha JMP134 chromosome 1, complete ... 40 6.1
7gb|AC087342.6| Homo sapiens chromosome 8, clone RP11-540E4, comp... 40 6.1
8gb|AC124037.5| Mus Musculus chromosome 4 BAC, clone CT7-104L5 st... 40 6.1
9gb|AC092958.4| Homo sapiens 3 BAC RP11-639B1 (Roswell Park Cance... 40 6.1
10gb|AC068020.7| Homo sapiens chromosome 8, clone RP11-556O5, comp... 40 6.1
11gb|AC139453.10| Homo sapiens 3 BAC RP11-803B1 (Roswell Park Canc... 40 6.1
12gb|AF217970.1|AF217970 Homo sapiens clone PP1195 unknown mRNA 40 6.1
13gb|U13503.1|HIV1U13503 Human immunodeficiency virus type 1, isol... 40 6.1
14emb|AL671866.8| Mouse DNA sequence from clone RP23-59L24 on chro... 40 6.1

>gb|DP000031.1| Dasypus novemcinctus target 116 genomic scaffold
          Length = 288075

 Score = 46.1 bits (23), Expect = 0.099
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                     
Query: 116    aataatacagcctacataaaaga 138
              |||||||||||||||||||||||
Sbjct: 151492 aataatacagcctacataaaaga 151514



to top

>emb|Z12028.1|LPBFRUCG L.pimpinellifolium gene encoding vacuolar invertase
          Length = 10965

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                  
Query: 85   cacaagaaatcaagtgatgttt 106
            ||||||||||||||||||||||
Sbjct: 1280 cacaagaaatcaagtgatgttt 1301



to top

>emb|Z12027.1|LEBFRUCG L.esculentum gene for vacuolar invertase
          Length = 10798

 Score = 44.1 bits (22), Expect = 0.39
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                  
Query: 85   cacaagaaatcaagtgatgttt 106
            ||||||||||||||||||||||
Sbjct: 1280 cacaagaaatcaagtgatgttt 1301



to top

>gb|AC105247.16| Homo sapiens chromosome 18, clone CTD-2545G7, complete sequence
          Length = 165814

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 286   ccttccttttttcctttacct 306
             |||||||||||||||||||||
Sbjct: 63604 ccttccttttttcctttacct 63584



to top

>emb|AL390840.17| Human DNA sequence from clone RP13-213K19 on chromosome X Contains a
              tubulin beta polypeptide pseudogene, complete sequence
          Length = 197611

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 278    tcatcgtcccttcctttttt 297
              ||||||||||||||||||||
Sbjct: 163835 tcatcgtcccttcctttttt 163854



to top

>gb|CP000090.1| Ralstonia eutropha JMP134 chromosome 1, complete sequence
          Length = 3806533

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 407     ctggctcgcgcgcttggcgc 426
               ||||||||||||||||||||
Sbjct: 3794473 ctggctcgcgcgcttggcgc 3794492



to top

>gb|AC087342.6| Homo sapiens chromosome 8, clone RP11-540E4, complete sequence
          Length = 151023

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 329   ttgcaaaacgcaattctgct 348
             ||||||||||||||||||||
Sbjct: 43989 ttgcaaaacgcaattctgct 43970



to top

>gb|AC124037.5| Mus Musculus chromosome 4 BAC, clone CT7-104L5 strain 129Sv ES cell
            line, Complete Sequence, complete sequence
          Length = 134412

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 9    ggagagatagacaagggcat 28
            ||||||||||||||||||||
Sbjct: 2195 ggagagatagacaagggcat 2214



to top

>gb|AC092958.4| Homo sapiens 3 BAC RP11-639B1 (Roswell Park Cancer Institute Human BAC
             Library) complete sequence
          Length = 162692

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 287   cttccttttttcctttacct 306
             ||||||||||||||||||||
Sbjct: 76602 cttccttttttcctttacct 76583



to top

>gb|AC068020.7| Homo sapiens chromosome 8, clone RP11-556O5, complete sequence
          Length = 203411

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 329    ttgcaaaacgcaattctgct 348
              ||||||||||||||||||||
Sbjct: 126950 ttgcaaaacgcaattctgct 126969



to top

>gb|AC139453.10| Homo sapiens 3 BAC RP11-803B1 (Roswell Park Cancer Institute Human BAC
             Library) complete sequence
          Length = 149461

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 329   ttgcaaaacgcaattctgct 348
             ||||||||||||||||||||
Sbjct: 95693 ttgcaaaacgcaattctgct 95712



to top

>gb|AF217970.1|AF217970 Homo sapiens clone PP1195 unknown mRNA
          Length = 2854

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 329 ttgcaaaacgcaattctgct 348
           ||||||||||||||||||||
Sbjct: 698 ttgcaaaacgcaattctgct 717



to top

>gb|U13503.1|HIV1U13503 Human immunodeficiency virus type 1, isolate 020 clone 08 from
           Brazil, envelope glycoprotein (env) gene, V1V2 region,
           partial cds
          Length = 273

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 2   ggaaaacggagagatagacaaggg 25
           |||||| |||||||||||||||||
Sbjct: 96  ggaaaaaggagagatagacaaggg 119



to top

>emb|AL671866.8| Mouse DNA sequence from clone RP23-59L24 on chromosome 4, complete
              sequence
          Length = 230447

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 9      ggagagatagacaagggcat 28
              ||||||||||||||||||||
Sbjct: 167449 ggagagatagacaagggcat 167430


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 4,137,329
Number of Sequences: 3902068
Number of extensions: 4137329
Number of successful extensions: 77407
Number of sequences better than 10.0: 14
Number of HSP's better than 10.0 without gapping: 14
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 77369
Number of HSP's gapped (non-prelim): 38
length of query: 454
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 432
effective length of database: 17,147,199,772
effective search space: 7407590301504
effective search space used: 7407590301504
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top