ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日：2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbastl19d08
Clone Library Name barley_pub
No. Definition Score
(bits)		 E
Value
1dbj|AB028870.1| Hordeum vulgare Hv-MMT1 mRNA for S-adenosyl-L-me... 72 1e-10
2gb|AE009951.2| Fusobacterium nucleatum subsp. nucleatum ATCC 255... 40 0.34
3gb|AC186561.1| Gasterosteus aculeatus clone VMRC28-125N12, compl... 38 1.3
4emb|AL392110.12| Human DNA sequence from clone RP11-29M23 on chr... 38 1.3
5emb|AL136224.24| Human DNA sequence from clone RP1-305A19 on chr... 38 1.3
6emb|Z69729.1|SPAC13G7 S.pombe chromosome I cosmid c13G7 38 1.3
7emb|BX914203.24| Zebrafish DNA sequence from clone CH211-22E19 i... 38 1.3
8gb|AC012215.11| Homo sapiens chromosome , clone RP11-345N15, com... 38 1.3
9gb|AC083838.6| Homo sapiens chromosome 8, clone RP11-42L4, compl... 38 1.3
10gb|AC074041.3|AC074041 Mus musculus strain C57BL6/J chromosome 2... 38 1.3
11gb|AY240876.1| Saccharomyces paradoxus 60S ribosomal protein (RP... 38 1.3
12gb|AC026757.12|AC026757 Arabidopsis thaliana chromosome 1 BAC F2... 38 1.3
13emb|AL928836.9| Mouse DNA sequence from clone RP23-239M4 on chro... 38 1.3
14gb|AE014849.1| Plasmodium falciparum 3D7 chromosome 12, section ... 36 5.3
15gb|AC149266.1| Solanum demissum chromosome 5 clone PGEC872C13 ma... 36 5.3
16gb|AC132595.3| Mus musculus BAC clone RP24-229G7 from chromosome... 36 5.3
17gb|AY812459.1| Schistosoma japonicum SJCHGC04555 protein mRNA, p... 36 5.3
18gb|AY792388.1| Sisymbrium irio clone BAC Si51B6 isolate Si51B6_0... 36 5.3
19emb|CR731253.1|CNS0GR6I Tetraodon nigroviridis full-length cDNA 36 5.3
20ref|XM_648546.1| Entamoeba histolytica HM-1:IMSS hypothetical pr... 36 5.3
21ref|XM_758287.1| Theileria parva strain Muguga chromosome 3 hypo... 36 5.3
22gb|AC165968.3| Mus musculus BAC clone RP23-181K4 from chromosome... 36 5.3
23emb|CR936343.5| Mouse DNA sequence from clone RP23-273E13 on chr... 36 5.3
24emb|AL450384.34| Human DNA sequence from clone RP11-383B4 on chr... 36 5.3
25emb|AL445426.20| Human DNA sequence from clone RP11-62J10 on chr... 36 5.3
26gb|AF516145.1| Lyngbya majuscula barbamide biosynthesis gene clu... 36 5.3
27emb|AL354857.13| Human DNA sequence from clone RP11-346N8 on chr... 36 5.3
28emb|CR548612.1| Paramecium tetraurelia macronuclear largest chro... 36 5.3
29emb|BX571660.1| Wolinella succinogenes, complete genome; segment... 36 5.3
30emb|CR556704.4| Mouse DNA sequence from clone RP23-324J18 on chr... 36 5.3
31emb|BX950184.7| Zebrafish DNA sequence from clone CH211-103O12 i... 36 5.3
32emb|BX511082.3| Zebrafish DNA sequence from clone DKEY-7J20 in l... 36 5.3
33gb|AC091742.5| Homo sapiens BAC clone RP11-1220K2 from 7, comple... 36 5.3
34emb|BX927198.7| Mouse DNA sequence from clone RP23-285I7 on chro... 36 5.3
35emb|BX936283.12| Mouse DNA sequence from clone RP23-66M21 on chr... 36 5.3
36gb|AC148819.3| Medicago truncatula chromosome 2 BAC clone mte1-1... 36 5.3
37gb|AF250225.1|AF250225 Helicobacter pylori IceA2 (iceA2) and CAT... 36 5.3
38emb|BX322648.16| Mouse DNA sequence from clone RP23-29L22 on chr... 36 5.3
39emb|BX005028.16| Zebrafish DNA sequence from clone CH211-177D23,... 36 5.3
40emb|BX901960.4| Mouse DNA sequence from clone RP24-116B15 on chr... 36 5.3
41gb|AC084627.1|CBRG45D05 Caenorhabditis briggsae cosmid G45D05, c... 36 5.3
42emb|BX465222.9| Mouse DNA sequence from clone RP24-73A23 on chro... 36 5.3
43emb|AL772218.29| Mouse DNA sequence from clone RP23-129K21 on ch... 36 5.3
44gb|AE001439.1| Helicobacter pylori J99, complete genome 36 5.3
45gb|AE017220.1| Salmonella enterica subsp. enterica serovar Chole... 36 5.3
46gb|AE000511.1| Helicobacter pylori 26695, complete genome 36 5.3
47gb|AF020708.1|AF020708 Helicobacter pylori methylase HpyI (hpyIM... 36 5.3
48gb|AF020707.1|AF020707 Helicobacter pylori methylase HpyI (hpyIM... 36 5.3
49gb|AF020706.1|AF020706 Helicobacter pylori methylase HpyI (hpyIM... 36 5.3
50emb|CR938712.13| Mouse DNA sequence from clone RP23-207A10 on ch... 36 5.3
51dbj|AP006418.1| Lotus japonicus genomic DNA, chromosome 6, clone... 36 5.3
52gb|U43917.1|HPU43917 Helicobacter pylori serine acetyltransferas... 36 5.3 
>dbj|AB028870.1| Hordeum vulgare Hv-MMT1 mRNA for S-adenosyl-L-methionine:
            L-methionine S-methyltransferase, complete cds
          Length = 3543

 Score = 71.9 bits (36), Expect = 1e-10
 Identities = 42/44 (95%)
 Strand = Plus / Minus

                                                        
Query: 1    tcaacgcttttatcccttttttgattcaaaacaaagttgttcaa 44
            ||||||||||||| ||||||||||||| ||||||||||||||||
Sbjct: 3470 tcaacgcttttattccttttttgattcgaaacaaagttgttcaa 3427
to top
>gb|AE009951.2| Fusobacterium nucleatum subsp. nucleatum ATCC 25586, complete genome
          Length = 2174500

 Score = 40.1 bits (20), Expect = 0.34
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 24      attcaaaacaaagttgttca 43
               ||||||||||||||||||||
Sbjct: 1458119 attcaaaacaaagttgttca 1458138
to top
>gb|AC186561.1| Gasterosteus aculeatus clone VMRC28-125N12, complete sequence
          Length = 147166

 Score = 38.2 bits (19), Expect = 1.3
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 8     ttttatcccttttttgatt 26
             |||||||||||||||||||
Sbjct: 71737 ttttatcccttttttgatt 71719
to top
>emb|AL392110.12| Human DNA sequence from clone RP11-29M23 on chromosome 9, complete
             sequence
          Length = 167921

 Score = 38.2 bits (19), Expect = 1.3
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 10    ttatcccttttttgattca 28
             |||||||||||||||||||
Sbjct: 88698 ttatcccttttttgattca 88680
to top
>emb|AL136224.24| Human DNA sequence from clone RP1-305A19 on chromosome 6 Contains the
             3' end of the TCBA1 gene for T-cell lymphoma breakpoint
             associated target 1, complete sequence
          Length = 70540

 Score = 38.2 bits (19), Expect = 1.3
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 21    ttgattcaaaacaaagttg 39
             |||||||||||||||||||
Sbjct: 46272 ttgattcaaaacaaagttg 46254
to top
>emb|Z69729.1|SPAC13G7 S.pombe chromosome I cosmid c13G7
          Length = 25009

 Score = 38.2 bits (19), Expect = 1.3
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                               
Query: 8    ttttatcccttttttgatt 26
            |||||||||||||||||||
Sbjct: 1083 ttttatcccttttttgatt 1065
to top
>emb|BX914203.24| Zebrafish DNA sequence from clone CH211-22E19 in linkage group 11,
             complete sequence
          Length = 179563

 Score = 38.2 bits (19), Expect = 1.3
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 20    tttgattcaaaacaaagtt 38
             |||||||||||||||||||
Sbjct: 27803 tttgattcaaaacaaagtt 27785
to top
>gb|AC012215.11| Homo sapiens chromosome , clone RP11-345N15, complete sequence
          Length = 210723

 Score = 38.2 bits (19), Expect = 1.3
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 24     attcaaaacaaagttgttc 42
              |||||||||||||||||||
Sbjct: 131149 attcaaaacaaagttgttc 131167
to top
>gb|AC083838.6| Homo sapiens chromosome 8, clone RP11-42L4, complete sequence
          Length = 156623

 Score = 38.2 bits (19), Expect = 1.3
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 24    attcaaaacaaagttgttc 42
             |||||||||||||||||||
Sbjct: 60503 attcaaaacaaagttgttc 60521
to top
>gb|AC074041.3|AC074041 Mus musculus strain C57BL6/J chromosome 2 clone RP23-258D16, complete
              sequence
          Length = 170548

 Score = 38.2 bits (19), Expect = 1.3
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 7      cttttatcccttttttgat 25
              |||||||||||||||||||
Sbjct: 123235 cttttatcccttttttgat 123217
to top
>gb|AY240876.1| Saccharomyces paradoxus 60S ribosomal protein (RPL28) and putative
           HD superfamily phosphohydrolase genes, partial cds
          Length = 672

 Score = 38.2 bits (19), Expect = 1.3
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                  
Query: 2   caacgcttttatcccttttttga 24
           ||||||||||||| |||||||||
Sbjct: 357 caacgcttttatcgcttttttga 379
to top
>gb|AC026757.12|AC026757 Arabidopsis thaliana chromosome 1 BAC F2H10 genomic sequence, complete
             sequence
          Length = 95870

 Score = 38.2 bits (19), Expect = 1.3
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                    
Query: 22    tgattcaaaacaaagttgttcaa 44
             |||||||||||||| ||||||||
Sbjct: 41565 tgattcaaaacaaaattgttcaa 41587
to top
>emb|AL928836.9| Mouse DNA sequence from clone RP23-239M4 on chromosome 2, complete
             sequence
          Length = 97325

 Score = 38.2 bits (19), Expect = 1.3
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 7     cttttatcccttttttgat 25
             |||||||||||||||||||
Sbjct: 49319 cttttatcccttttttgat 49337
to top
>gb|AE014849.1| Plasmodium falciparum 3D7 chromosome 12, section 6 of 9 of the complete
             sequence
          Length = 250421

 Score = 36.2 bits (18), Expect = 5.3
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                               
Query: 11    tatcccttttttgattca 28
             ||||||||||||||||||
Sbjct: 82005 tatcccttttttgattca 82022
to top
>gb|AC149266.1| Solanum demissum chromosome 5 clone PGEC872C13 map MAP_LOC, complete
             sequence
          Length = 100564

 Score = 36.2 bits (18), Expect = 5.3
 Identities = 21/22 (95%)
 Strand = Plus / Minus

                                   
Query: 17    ttttttgattcaaaacaaagtt 38
             ||||||||| ||||||||||||
Sbjct: 13462 ttttttgatacaaaacaaagtt 13441
to top
>gb|AC132595.3| Mus musculus BAC clone RP24-229G7 from chromosome 7, complete sequence
          Length = 155547

 Score = 36.2 bits (18), Expect = 5.3
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                                
Query: 22     tgattcaaaacaaagttg 39
              ||||||||||||||||||
Sbjct: 154328 tgattcaaaacaaagttg 154311
to top
>gb|AY812459.1| Schistosoma japonicum SJCHGC04555 protein mRNA, partial cds
          Length = 914

 Score = 36.2 bits (18), Expect = 5.3
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                            
Query: 15 ccttttttgattcaaaac 32
          ||||||||||||||||||
Sbjct: 85 ccttttttgattcaaaac 68
to top
>gb|AY792388.1| Sisymbrium irio clone BAC Si51B6 isolate Si51B6_03C centromere
           satellite
          Length = 932

 Score = 36.2 bits (18), Expect = 5.3
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                             
Query: 13  tcccttttttgattcaaa 30
           ||||||||||||||||||
Sbjct: 914 tcccttttttgattcaaa 931
to top
>emb|CR731253.1|CNS0GR6I Tetraodon nigroviridis full-length cDNA
          Length = 1241

 Score = 36.2 bits (18), Expect = 5.3
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                            
Query: 9  tttatcccttttttgatt 26
          ||||||||||||||||||
Sbjct: 33 tttatcccttttttgatt 50
to top
>ref|XM_648546.1| Entamoeba histolytica HM-1:IMSS hypothetical protein (76.t00002)
            partial mRNA
          Length = 1806

 Score = 36.2 bits (18), Expect = 5.3
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                              
Query: 15   ccttttttgattcaaaac 32
            ||||||||||||||||||
Sbjct: 1610 ccttttttgattcaaaac 1627
to top
>ref|XM_758287.1| Theileria parva strain Muguga chromosome 3 hypothetical protein
            (TP03_0360) partial mRNA
          Length = 4062

 Score = 36.2 bits (18), Expect = 5.3
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                              
Query: 27   caaaacaaagttgttcaa 44
            ||||||||||||||||||
Sbjct: 1492 caaaacaaagttgttcaa 1475
to top
>gb|AC165968.3| Mus musculus BAC clone RP23-181K4 from chromosome 7, complete sequence
          Length = 190840

 Score = 36.2 bits (18), Expect = 5.3
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                                
Query: 22     tgattcaaaacaaagttg 39
              ||||||||||||||||||
Sbjct: 123478 tgattcaaaacaaagttg 123461
to top
>emb|CR936343.5| Mouse DNA sequence from clone RP23-273E13 on chromosome X, complete
             sequence
          Length = 149137

 Score = 36.2 bits (18), Expect = 5.3
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                               
Query: 13    tcccttttttgattcaaa 30
             ||||||||||||||||||
Sbjct: 22788 tcccttttttgattcaaa 22805
to top
>emb|AL450384.34| Human DNA sequence from clone RP11-383B4 on chromosome 10 Contains the 3'
              end of the CACNB2 gene for calcium channel
              voltage-dependent beta 2 subunit, the 5' end of a novel
              gene, a novel gene and the 3' end of a novel gene
              (LOC221078) (FLJ23743), complete sequence
          Length = 124571

 Score = 36.2 bits (18), Expect = 5.3
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                                
Query: 7      cttttatcccttttttga 24
              ||||||||||||||||||
Sbjct: 110785 cttttatcccttttttga 110768
to top
>emb|AL445426.20| Human DNA sequence from clone RP11-62J10 on chromosome 1 Contains the
             3' end of a novel gene and a CpG island, complete sequence
          Length = 159117

 Score = 36.2 bits (18), Expect = 5.3
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                               
Query: 20    tttgattcaaaacaaagt 37
             ||||||||||||||||||
Sbjct: 31619 tttgattcaaaacaaagt 31636
to top
>gb|AF516145.1| Lyngbya majuscula barbamide biosynthesis gene cluster, complete
             sequence
          Length = 40156

 Score = 36.2 bits (18), Expect = 5.3
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                               
Query: 17    ttttttgattcaaaacaa 34
             ||||||||||||||||||
Sbjct: 27258 ttttttgattcaaaacaa 27275
to top
>emb|AL354857.13| Human DNA sequence from clone RP11-346N8 on chromosome 6 Contains the 3'
              end of the EPHA7 gene for ephrin receptor A7, complete
              sequence
          Length = 199223

 Score = 36.2 bits (18), Expect = 5.3
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                                
Query: 24     attcaaaacaaagttgtt 41
              ||||||||||||||||||
Sbjct: 171980 attcaaaacaaagttgtt 171997
to top
>emb|CR548612.1| Paramecium tetraurelia macronuclear largest chromosome, complete sequence
          Length = 984602

 Score = 36.2 bits (18), Expect = 5.3
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                                
Query: 18     tttttgattcaaaacaaa 35
              ||||||||||||||||||
Sbjct: 146595 tttttgattcaaaacaaa 146578
to top
>emb|BX571660.1| Wolinella succinogenes, complete genome; segment 4/7
          Length = 349926

 Score = 36.2 bits (18), Expect = 5.3
 Identities = 21/22 (95%)
 Strand = Plus / Minus

                                    
Query: 16     cttttttgattcaaaacaaagt 37
              ||||||||||| ||||||||||
Sbjct: 216655 cttttttgattaaaaacaaagt 216634
to top
>emb|CR556704.4| Mouse DNA sequence from clone RP23-324J18 on chromosome X, complete
              sequence
          Length = 199507

 Score = 36.2 bits (18), Expect = 5.3
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                                
Query: 13     tcccttttttgattcaaa 30
              ||||||||||||||||||
Sbjct: 148504 tcccttttttgattcaaa 148521
to top
>emb|BX950184.7| Zebrafish DNA sequence from clone CH211-103O12 in linkage group 12,
              complete sequence
          Length = 150475

 Score = 36.2 bits (18), Expect = 5.3
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                                
Query: 25     ttcaaaacaaagttgttc 42
              ||||||||||||||||||
Sbjct: 141524 ttcaaaacaaagttgttc 141507
to top
>emb|BX511082.3| Zebrafish DNA sequence from clone DKEY-7J20 in linkage group 9,
             complete sequence
          Length = 101163

 Score = 36.2 bits (18), Expect = 5.3
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                               
Query: 27    caaaacaaagttgttcaa 44
             ||||||||||||||||||
Sbjct: 43596 caaaacaaagttgttcaa 43613
to top
>gb|AC091742.5| Homo sapiens BAC clone RP11-1220K2 from 7, complete sequence
          Length = 191041

 Score = 36.2 bits (18), Expect = 5.3
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                               
Query: 19    ttttgattcaaaacaaag 36
             ||||||||||||||||||
Sbjct: 80334 ttttgattcaaaacaaag 80317
to top
>emb|BX927198.7| Mouse DNA sequence from clone RP23-285I7 on chromosome X, complete
             sequence
          Length = 102716

 Score = 36.2 bits (18), Expect = 5.3
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                               
Query: 13    tcccttttttgattcaaa 30
             ||||||||||||||||||
Sbjct: 30857 tcccttttttgattcaaa 30874
to top
>emb|BX936283.12| Mouse DNA sequence from clone RP23-66M21 on chromosome X, complete
             sequence
          Length = 195292

 Score = 36.2 bits (18), Expect = 5.3
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                               
Query: 13    tcccttttttgattcaaa 30
             ||||||||||||||||||
Sbjct: 63138 tcccttttttgattcaaa 63155
to top
>gb|AC148819.3| Medicago truncatula chromosome 2 BAC clone mte1-11g7, complete sequence
          Length = 105682

 Score = 36.2 bits (18), Expect = 5.3
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                               
Query: 20    tttgattcaaaacaaagt 37
             ||||||||||||||||||
Sbjct: 47427 tttgattcaaaacaaagt 47444
to top
>gb|AF250225.1|AF250225 Helicobacter pylori IceA2 (iceA2) and CATG-specific methyltransferase
            (hpyIM) genes, complete cds
          Length = 1953

 Score = 36.2 bits (18), Expect = 5.3
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                              
Query: 19   ttttgattcaaaacaaag 36
            ||||||||||||||||||
Sbjct: 1163 ttttgattcaaaacaaag 1146
to top
>emb|BX322648.16| Mouse DNA sequence from clone RP23-29L22 on chromosome X, complete
             sequence
          Length = 115242

 Score = 36.2 bits (18), Expect = 5.3
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                               
Query: 13    tcccttttttgattcaaa 30
             ||||||||||||||||||
Sbjct: 30818 tcccttttttgattcaaa 30835
to top
>emb|BX005028.16| Zebrafish DNA sequence from clone CH211-177D23, complete sequence
          Length = 149509

 Score = 36.2 bits (18), Expect = 5.3
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                               
Query: 19    ttttgattcaaaacaaag 36
             ||||||||||||||||||
Sbjct: 35521 ttttgattcaaaacaaag 35504
to top
>emb|BX901960.4| Mouse DNA sequence from clone RP24-116B15 on chromosome X, complete
             sequence
          Length = 185687

 Score = 36.2 bits (18), Expect = 5.3
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                               
Query: 13    tcccttttttgattcaaa 30
             ||||||||||||||||||
Sbjct: 93964 tcccttttttgattcaaa 93947
to top
>gb|AC084627.1|CBRG45D05 Caenorhabditis briggsae cosmid G45D05, complete sequence
          Length = 38530

 Score = 36.2 bits (18), Expect = 5.3
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                               
Query: 18    tttttgattcaaaacaaa 35
             ||||||||||||||||||
Sbjct: 31457 tttttgattcaaaacaaa 31474
to top
>emb|BX465222.9| Mouse DNA sequence from clone RP24-73A23 on chromosome X, complete
             sequence
          Length = 207803

 Score = 36.2 bits (18), Expect = 5.3
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                               
Query: 13    tcccttttttgattcaaa 30
             ||||||||||||||||||
Sbjct: 20968 tcccttttttgattcaaa 20951
to top
>emb|AL772218.29| Mouse DNA sequence from clone RP23-129K21 on chromosome 2, complete
              sequence
          Length = 218427

 Score = 36.2 bits (18), Expect = 5.3
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                                
Query: 27     caaaacaaagttgttcaa 44
              ||||||||||||||||||
Sbjct: 166251 caaaacaaagttgttcaa 166268
to top
>gb|AE001439.1| Helicobacter pylori J99, complete genome
          Length = 1643831

 Score = 36.2 bits (18), Expect = 5.3
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                                 
Query: 19      ttttgattcaaaacaaag 36
               ||||||||||||||||||
Sbjct: 1264317 ttttgattcaaaacaaag 1264334
to top
>gb|AE017220.1| Salmonella enterica subsp. enterica serovar Choleraesuis str. SC-B67,
               complete genome
          Length = 4755700

 Score = 36.2 bits (18), Expect = 5.3
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                                 
Query: 18      tttttgattcaaaacaaa 35
               ||||||||||||||||||
Sbjct: 4648179 tttttgattcaaaacaaa 4648196
to top
>gb|AE000511.1| Helicobacter pylori 26695, complete genome
          Length = 1667867

 Score = 36.2 bits (18), Expect = 5.3
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                                 
Query: 19      ttttgattcaaaacaaag 36
               ||||||||||||||||||
Sbjct: 1285983 ttttgattcaaaacaaag 1286000
to top
>gb|AF020708.1|AF020708 Helicobacter pylori methylase HpyI (hpyIM) gene, complete cds
          Length = 990

 Score = 36.2 bits (18), Expect = 5.3
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                             
Query: 19  ttttgattcaaaacaaag 36
           ||||||||||||||||||
Sbjct: 200 ttttgattcaaaacaaag 183
to top
>gb|AF020707.1|AF020707 Helicobacter pylori methylase HpyI (hpyIM) gene, complete cds
          Length = 990

 Score = 36.2 bits (18), Expect = 5.3
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                             
Query: 19  ttttgattcaaaacaaag 36
           ||||||||||||||||||
Sbjct: 200 ttttgattcaaaacaaag 183
to top
>gb|AF020706.1|AF020706 Helicobacter pylori methylase HpyI (hpyIM) gene, complete cds
          Length = 3028

 Score = 36.2 bits (18), Expect = 5.3
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                             
Query: 19  ttttgattcaaaacaaag 36
           ||||||||||||||||||
Sbjct: 200 ttttgattcaaaacaaag 183
to top
>emb|CR938712.13| Mouse DNA sequence from clone RP23-207A10 on chromosome X, complete
             sequence
          Length = 90603

 Score = 36.2 bits (18), Expect = 5.3
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                               
Query: 13    tcccttttttgattcaaa 30
             ||||||||||||||||||
Sbjct: 53722 tcccttttttgattcaaa 53705
to top
>dbj|AP006418.1| Lotus japonicus genomic DNA, chromosome 6, clone:LjT23A02, TM0306,
             complete sequence
          Length = 62713

 Score = 36.2 bits (18), Expect = 5.3
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                               
Query: 14    cccttttttgattcaaaa 31
             ||||||||||||||||||
Sbjct: 12708 cccttttttgattcaaaa 12691
to top
>gb|U43917.1|HPU43917 Helicobacter pylori serine acetyltransferase homolog (cysE) and
            ulcer-associated (iceA) genes, complete cds, and DNA
            adenine methylase homolog (M.HpyI) gene, partial cds
          Length = 2134

 Score = 36.2 bits (18), Expect = 5.3
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                              
Query: 19   ttttgattcaaaacaaag 36
            ||||||||||||||||||
Sbjct: 1510 ttttgattcaaaacaaag 1493


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 576,465
Number of Sequences: 3902068
Number of extensions: 576465
Number of successful extensions: 161780
Number of sequences better than 10.0: 52
Number of HSP's better than 10.0 without gapping: 52
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 161428
Number of HSP's gapped (non-prelim): 352
length of query: 44
length of database: 17,233,045,268
effective HSP length: 20
effective length of query: 24
effective length of database: 17,155,003,908
effective search space: 411720093792
effective search space used: 411720093792
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 18 (36.2 bits)
to top