ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbastl19d07
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1emb|CT009689.5| Pig DNA sequence from clone CH242-266P8 on chrom... 46 0.060
2emb|AL162596.30| Human DNA sequence from clone RP1-13P20 on chro... 40 3.7
3emb|AL354951.7| Human DNA sequence from clone RP11-451M19 on chr... 40 3.7
4emb|AL161442.22| Human DNA sequence from clone RP6-102F8 on chro... 40 3.7
5emb|AL645611.9| Mouse DNA sequence from clone RP23-432O24 on chr... 40 3.7
6gb|AF468050.1| Danio rerio laminin beta 4 (lamb4) mRNA, complete... 40 3.7
7gb|AC135960.14| Pan troglodytes clone rp43-55o12, complete sequence 40 3.7
8emb|BX548078.8| Zebrafish DNA sequence from clone CH211-212C13 i... 40 3.7
9gb|AC035140.7| Homo sapiens chromosome 5 clone CTD-2631K10, comp... 40 3.7
10gb|AC000079.1| Homo sapiens Chromosome 22q11.2 Cosmid Clone 49c1... 40 3.7
11gb|AC000068.2| Homo sapiens Chromosome 22q11.2 Cosmid Clone 102g... 40 3.7
12dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic D... 40 3.7
13dbj|AP006878.1| Thermococcus kodakarensis KOD1 DNA, complete genome 40 3.7
14ref|NM_173276.1| Danio rerio laminin, beta 4 (lamb4), mRNA 40 3.7
15dbj|AP003802.2| Oryza sativa (japonica cultivar-group) genomic D... 40 3.7
16dbj|AP004668.3| Oryza sativa (japonica cultivar-group) genomic D... 40 3.7

>emb|CT009689.5| Pig DNA sequence from clone CH242-266P8 on chromosome 17, complete
             sequence
          Length = 38080

 Score = 46.1 bits (23), Expect = 0.060
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                    
Query: 99    cactacgtaccatctttttctct 121
             |||||||||||||||||||||||
Sbjct: 23691 cactacgtaccatctttttctct 23669



to top

>emb|AL162596.30| Human DNA sequence from clone RP1-13P20 on chromosome 1q21.1-21.3
             Contains the SPRL2A gene for small proline rich-like
             (epidermal differentiation complex) 2A, the LEP1 gene for
             late envelope protein 1, a novel gene, the MCSP gene for
             mitochondrial capsule selenoprotein and the IVL gene for
             involucrin, complete sequence
          Length = 116067

 Score = 40.1 bits (20), Expect = 3.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 14    aggaaccattcacaatcaacacat 37
             |||||||||| |||||||||||||
Sbjct: 88238 aggaaccattgacaatcaacacat 88261



to top

>emb|AL354951.7| Human DNA sequence from clone RP11-451M19 on chromosome 10 Contains a
              ribosomal protein L21 (RPL21) pseudogene, the XPNPEP1 gene
              for X-prolyl aminopeptidase (aminopeptidase P) 1, soluble
              (SAMP, XPNPEP, XPNPEPL), a novel gene and one CpG island,
              complete sequence
          Length = 205329

 Score = 40.1 bits (20), Expect = 3.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 22     ttcacaatcaacacatgaat 41
              ||||||||||||||||||||
Sbjct: 147138 ttcacaatcaacacatgaat 147119



to top

>emb|AL161442.22| Human DNA sequence from clone RP6-102F8 on chromosome Xq25-26.3
             Contains the 5' end of variants of the MBNL3 gene for
             muscleblind-like 3 (Drosophila) and a CpG island, complete
             sequence
          Length = 112453

 Score = 40.1 bits (20), Expect = 3.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 111   tctttttctcttcctctgca 130
             ||||||||||||||||||||
Sbjct: 54091 tctttttctcttcctctgca 54110



to top

>emb|AL645611.9| Mouse DNA sequence from clone RP23-432O24 on chromosome 11 Contains
             part of the Adamts2 gene for a disintegrin-like and
             metalloprotease (reprolysin type) with thrombospondin type
             1 motif 2, complete sequence
          Length = 69492

 Score = 40.1 bits (20), Expect = 3.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 102   tacgtaccatctttttctct 121
             ||||||||||||||||||||
Sbjct: 62029 tacgtaccatctttttctct 62048



to top

>gb|AF468050.1| Danio rerio laminin beta 4 (lamb4) mRNA, complete cds
          Length = 5943

 Score = 40.1 bits (20), Expect = 3.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 239  aagtcataacccctctgtct 258
            ||||||||||||||||||||
Sbjct: 1891 aagtcataacccctctgtct 1872



to top

>gb|AC135960.14| Pan troglodytes clone rp43-55o12, complete sequence
          Length = 157430

 Score = 40.1 bits (20), Expect = 3.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 162   cagcaatttctctcctgact 181
             ||||||||||||||||||||
Sbjct: 19903 cagcaatttctctcctgact 19884



to top

>emb|BX548078.8| Zebrafish DNA sequence from clone CH211-212C13 in linkage group 15,
              complete sequence
          Length = 205316

 Score = 40.1 bits (20), Expect = 3.7
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                          
Query: 111    tctttttctcttcctctgcaaggaaaca 138
              |||||| ||||| |||||||||||||||
Sbjct: 201366 tcttttgctctttctctgcaaggaaaca 201339



to top

>gb|AC035140.7| Homo sapiens chromosome 5 clone CTD-2631K10, complete sequence
          Length = 61965

 Score = 40.1 bits (20), Expect = 3.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 111   tctttttctcttcctctgca 130
             ||||||||||||||||||||
Sbjct: 33667 tctttttctcttcctctgca 33686



to top

>gb|AC000079.1| Homo sapiens Chromosome 22q11.2 Cosmid Clone 49c12 In DGCR Region,
             complete sequence
          Length = 39540

 Score = 40.1 bits (20), Expect = 3.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 162   cagcaatttctctcctgact 181
             ||||||||||||||||||||
Sbjct: 30948 cagcaatttctctcctgact 30929



to top

>gb|AC000068.2| Homo sapiens Chromosome 22q11.2 Cosmid Clone 102g9 In DGCR Region,
            complete sequence
          Length = 43934

 Score = 40.1 bits (20), Expect = 3.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 162  cagcaatttctctcctgact 181
            ||||||||||||||||||||
Sbjct: 6599 cagcaatttctctcctgact 6580



to top

>dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, complete
                sequence
          Length = 29644043

 Score = 40.1 bits (20), Expect = 3.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                    
Query: 62       gaaaccatgcatatttttct 81
                ||||||||||||||||||||
Sbjct: 15324313 gaaaccatgcatatttttct 15324294



to top

>dbj|AP006878.1| Thermococcus kodakarensis KOD1 DNA, complete genome
          Length = 2088737

 Score = 40.1 bits (20), Expect = 3.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 114    ttttctcttcctctgcaagg 133
              ||||||||||||||||||||
Sbjct: 933971 ttttctcttcctctgcaagg 933990



to top

>ref|NM_173276.1| Danio rerio laminin, beta 4 (lamb4), mRNA
          Length = 5943

 Score = 40.1 bits (20), Expect = 3.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 239  aagtcataacccctctgtct 258
            ||||||||||||||||||||
Sbjct: 1891 aagtcataacccctctgtct 1872



to top

>dbj|AP003802.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, BAC
             clone:OJ1047_A06
          Length = 111673

 Score = 40.1 bits (20), Expect = 3.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 62    gaaaccatgcatatttttct 81
             ||||||||||||||||||||
Sbjct: 31312 gaaaccatgcatatttttct 31293



to top

>dbj|AP004668.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, PAC
              clone:P0475E07
          Length = 139961

 Score = 40.1 bits (20), Expect = 3.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 62     gaaaccatgcatatttttct 81
              ||||||||||||||||||||
Sbjct: 110326 gaaaccatgcatatttttct 110307


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 3,096,110
Number of Sequences: 3902068
Number of extensions: 3096110
Number of successful extensions: 63281
Number of sequences better than 10.0: 16
Number of HSP's better than 10.0 without gapping: 16
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 63229
Number of HSP's gapped (non-prelim): 52
length of query: 282
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 260
effective length of database: 17,147,199,772
effective search space: 4458271940720
effective search space used: 4458271940720
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top