| Clone Name | rbastl19d07 |
|---|---|
| Clone Library Name | barley_pub |
>emb|CT009689.5| Pig DNA sequence from clone CH242-266P8 on chromosome 17, complete sequence Length = 38080 Score = 46.1 bits (23), Expect = 0.060 Identities = 23/23 (100%) Strand = Plus / Minus Query: 99 cactacgtaccatctttttctct 121 ||||||||||||||||||||||| Sbjct: 23691 cactacgtaccatctttttctct 23669
>emb|AL162596.30| Human DNA sequence from clone RP1-13P20 on chromosome 1q21.1-21.3 Contains the SPRL2A gene for small proline rich-like (epidermal differentiation complex) 2A, the LEP1 gene for late envelope protein 1, a novel gene, the MCSP gene for mitochondrial capsule selenoprotein and the IVL gene for involucrin, complete sequence Length = 116067 Score = 40.1 bits (20), Expect = 3.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 14 aggaaccattcacaatcaacacat 37 |||||||||| ||||||||||||| Sbjct: 88238 aggaaccattgacaatcaacacat 88261
>emb|AL354951.7| Human DNA sequence from clone RP11-451M19 on chromosome 10 Contains a ribosomal protein L21 (RPL21) pseudogene, the XPNPEP1 gene for X-prolyl aminopeptidase (aminopeptidase P) 1, soluble (SAMP, XPNPEP, XPNPEPL), a novel gene and one CpG island, complete sequence Length = 205329 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 22 ttcacaatcaacacatgaat 41 |||||||||||||||||||| Sbjct: 147138 ttcacaatcaacacatgaat 147119
>emb|AL161442.22| Human DNA sequence from clone RP6-102F8 on chromosome Xq25-26.3 Contains the 5' end of variants of the MBNL3 gene for muscleblind-like 3 (Drosophila) and a CpG island, complete sequence Length = 112453 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 111 tctttttctcttcctctgca 130 |||||||||||||||||||| Sbjct: 54091 tctttttctcttcctctgca 54110
>emb|AL645611.9| Mouse DNA sequence from clone RP23-432O24 on chromosome 11 Contains part of the Adamts2 gene for a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif 2, complete sequence Length = 69492 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 102 tacgtaccatctttttctct 121 |||||||||||||||||||| Sbjct: 62029 tacgtaccatctttttctct 62048
>gb|AF468050.1| Danio rerio laminin beta 4 (lamb4) mRNA, complete cds Length = 5943 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 239 aagtcataacccctctgtct 258 |||||||||||||||||||| Sbjct: 1891 aagtcataacccctctgtct 1872
>gb|AC135960.14| Pan troglodytes clone rp43-55o12, complete sequence Length = 157430 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 162 cagcaatttctctcctgact 181 |||||||||||||||||||| Sbjct: 19903 cagcaatttctctcctgact 19884
>emb|BX548078.8| Zebrafish DNA sequence from clone CH211-212C13 in linkage group 15, complete sequence Length = 205316 Score = 40.1 bits (20), Expect = 3.7 Identities = 26/28 (92%) Strand = Plus / Minus Query: 111 tctttttctcttcctctgcaaggaaaca 138 |||||| ||||| ||||||||||||||| Sbjct: 201366 tcttttgctctttctctgcaaggaaaca 201339
>gb|AC035140.7| Homo sapiens chromosome 5 clone CTD-2631K10, complete sequence Length = 61965 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 111 tctttttctcttcctctgca 130 |||||||||||||||||||| Sbjct: 33667 tctttttctcttcctctgca 33686
>gb|AC000079.1| Homo sapiens Chromosome 22q11.2 Cosmid Clone 49c12 In DGCR Region, complete sequence Length = 39540 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 162 cagcaatttctctcctgact 181 |||||||||||||||||||| Sbjct: 30948 cagcaatttctctcctgact 30929
>gb|AC000068.2| Homo sapiens Chromosome 22q11.2 Cosmid Clone 102g9 In DGCR Region, complete sequence Length = 43934 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 162 cagcaatttctctcctgact 181 |||||||||||||||||||| Sbjct: 6599 cagcaatttctctcctgact 6580
>dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, complete sequence Length = 29644043 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 62 gaaaccatgcatatttttct 81 |||||||||||||||||||| Sbjct: 15324313 gaaaccatgcatatttttct 15324294
>dbj|AP006878.1| Thermococcus kodakarensis KOD1 DNA, complete genome Length = 2088737 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 114 ttttctcttcctctgcaagg 133 |||||||||||||||||||| Sbjct: 933971 ttttctcttcctctgcaagg 933990
>ref|NM_173276.1| Danio rerio laminin, beta 4 (lamb4), mRNA Length = 5943 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 239 aagtcataacccctctgtct 258 |||||||||||||||||||| Sbjct: 1891 aagtcataacccctctgtct 1872
>dbj|AP003802.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, BAC clone:OJ1047_A06 Length = 111673 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 62 gaaaccatgcatatttttct 81 |||||||||||||||||||| Sbjct: 31312 gaaaccatgcatatttttct 31293
>dbj|AP004668.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, PAC clone:P0475E07 Length = 139961 Score = 40.1 bits (20), Expect = 3.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 62 gaaaccatgcatatttttct 81 |||||||||||||||||||| Sbjct: 110326 gaaaccatgcatatttttct 110307 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 3,096,110 Number of Sequences: 3902068 Number of extensions: 3096110 Number of successful extensions: 63281 Number of sequences better than 10.0: 16 Number of HSP's better than 10.0 without gapping: 16 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 63229 Number of HSP's gapped (non-prelim): 52 length of query: 282 length of database: 17,233,045,268 effective HSP length: 22 effective length of query: 260 effective length of database: 17,147,199,772 effective search space: 4458271940720 effective search space used: 4458271940720 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)