Clone Name	rbastl19b01
Clone Library Name	barley_pub

---

No.	Definition	Score (bits)	E Value
1	gb|AE017196.1| Wolbachia endosymbiont of Drosophila melanogaster...	48	0.024
2	gb|AC112633.6| Rattus norvegicus 11 BAC CH230-200K21 (Children's...	44	0.37
3	ref|XM_724596.1| Plasmodium yoelii yoelii str. 17XNL hypothetica...	44	0.37
4	gb|AC127315.4| Mus musculus BAC clone RP23-218F21 from chromosom...	42	1.5
5	gb|AC124463.2| Mus musculus BAC clone RP24-152K14 from chromosom...	42	1.5
6	emb|AL137013.4| Human DNA sequence from clone RP11-311P8 on chro...	42	1.5
7	ref|XM_963063.1| PREDICTED: Tribolium castaneum similar to CG969...	42	1.5
8	emb|BX842607.1|OSJN00296 Oryza sativa genomic DNA, chromosome 4,...	42	1.5
9	gb|AC092965.4| Homo sapiens 3 BAC RP11-440K22 (Roswell Park Canc...	42	1.5
10	gb|AC019089.6| Homo sapiens BAC clone RP11-370L14 from 4, comple...	42	1.5
11	dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic D...	42	1.5
12	gb|AC115914.6| Mus musculus chromosome 8, clone RP24-487J5, comp...	42	1.5
13	gb|AY185094.1| Podarcis sicula strain PST cytochrome b (cytb) ge...	42	1.5
14	gb|AY770892.1| Podarcis sicula haplotype 25 cytochrome b (cytb) ...	42	1.5
15	gb|AY770891.1| Podarcis sicula haplotype 24 cytochrome b (cytb) ...	42	1.5
16	gb|AY770890.1| Podarcis sicula haplotype 23 cytochrome b (cytb) ...	42	1.5
17	gb|AY770889.1| Podarcis sicula haplotype 22 cytochrome b (cytb) ...	42	1.5
18	gb|AY770888.1| Podarcis sicula haplotype 21 cytochrome b (cytb) ...	42	1.5
19	gb|AY770887.1| Podarcis sicula haplotype 20 cytochrome b (cytb) ...	42	1.5
20	gb|AY770886.1| Podarcis sicula haplotype 19 cytochrome b (cytb) ...	42	1.5
21	gb|AY770885.1| Podarcis sicula haplotype 18 cytochrome b (cytb) ...	42	1.5
22	gb|AY770884.1| Podarcis sicula haplotype 17 cytochrome b (cytb) ...	42	1.5
23	gb|AY770883.1| Podarcis sicula haplotype 16 cytochrome b (cytb) ...	42	1.5
24	gb|AY770882.1| Podarcis sicula haplotype 15 cytochrome b (cytb) ...	42	1.5
25	gb|AY770881.1| Podarcis sicula haplotype 14 cytochrome b (cytb) ...	42	1.5
26	gb|AY770880.1| Podarcis sicula haplotype 13 cytochrome b (cytb) ...	42	1.5
27	gb|AY770879.1| Podarcis sicula haplotype 12 cytochrome b (cytb) ...	42	1.5
28	gb|AY770878.1| Podarcis sicula haplotype 11 cytochrome b (cytb) ...	42	1.5
29	gb|AY770877.1| Podarcis sicula haplotype 10 cytochrome b (cytb) ...	42	1.5
30	gb|AY770875.1| Podarcis sicula haplotype 8 cytochrome b (cytb) g...	42	1.5
31	gb|AY770874.1| Podarcis sicula haplotype 7 cytochrome b (cytb) g...	42	1.5
32	gb|AY770873.1| Podarcis sicula haplotype 6 cytochrome b (cytb) g...	42	1.5
33	gb|AY770872.1| Podarcis sicula haplotype 5 cytochrome b (cytb) g...	42	1.5
34	gb|AY770871.1| Podarcis sicula haplotype 4 cytochrome b (cytb) g...	42	1.5
35	gb|AY770870.1| Podarcis sicula haplotype 3 cytochrome b (cytb) g...	42	1.5
36	gb|AY770869.1| Podarcis sicula haplotype 1 cytochrome b (cytb) g...	42	1.5
37	gb|AC145590.3| Mus musculus BAC clone RP24-175D4 from chromosome...	40	5.7
38	emb|CR376741.14| Zebrafish DNA sequence from clone DKEY-114B16 i...	40	5.7
39	gb|AC098889.3| Mus musculus BAC clone RP23-122O10 from 10, compl...	40	5.7
40	gb|AC138714.4| Mus musculus chromosome 18 clone RP23-406C12, com...	40	5.7
41	gb|AC133904.9| Mus musculus chromosome 19, clone RP24-143J12, co...	40	5.7
42	ref|XM_674716.1| Plasmodium berghei strain ANKA hypothetical pro...	40	5.7
43	emb|AL590807.13| Human DNA sequence from clone RP11-325L2 on chr...	40	5.7
44	emb|AL589863.11| Human DNA sequence from clone RP11-310J24 on ch...	40	5.7
45	emb|AL513209.16| Human DNA sequence from clone RP11-177F15 on ch...	40	5.7
46	emb|AL356794.10| Human DNA sequence from clone RP11-551A11 on ch...	40	5.7
47	emb|AL139420.13| Human DNA sequence from clone RP4-712E4 on chro...	40	5.7
48	gb|AC063948.44| Homo sapiens 12 BAC RP11-321F8 (Roswell Park Can...	40	5.7
49	emb|BX469905.5| Zebrafish DNA sequence from clone CH211-160B7 in...	40	5.7
50	emb|BX294117.17| Zebrafish DNA sequence from clone CH211-270F13 ...	40	5.7
51	gb|AF457461.1| Mustela nivalis cytochrome b (cytb) mRNA, complet...	40	5.7
52	gb|AC018884.6| Homo sapiens BAC clone RP11-369I16 from 4, comple...	40	5.7
53	gb|AC153145.4| Mus musculus BAC clone RP23-222C3 from chromosome...	40	5.7
54	dbj|AK036080.1| Mus musculus 16 days neonate cerebellum cDNA, RI...	40	5.7
55	gb|AC158597.7| Mus musculus 10 BAC RP24-216E13 (Roswell Park Can...	40	5.7
56	dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic D...	40	5.7
57	gb|AC117832.6| Homo sapiens chromosome 15, clone RP11-963M5, com...	40	5.7
58	gb|AC097482.2| Homo sapiens BAC clone RP11-131L11 from 4, comple...	40	5.7
59	gb|AC009432.7|AC009432 Homo sapiens chromosome 15, clone RP11-57...	40	5.7
60	gb|AC017088.8| Homo sapiens BAC clone RP11-496P1 from 2, complet...	40	5.7
61	dbj|AP003376.3| Oryza sativa (japonica cultivar-group) genomic D...	40	5.7
62	gb|AY188794.1| Mustela nivalis haplotype Ru2 cytochrome b (cytb)...	40	5.7
63	gb|AY188793.1| Mustela nivalis haplotype Est cytochrome b (cytb)...	40	5.7
64	emb|AL445594.3|CNS07ED4 Human chromosome 14 DNA sequence BAC R-7...	40	5.7
65	emb|AL355097.5|CNS05TCG Human chromosome 14 DNA sequence BAC R-2...	40	5.7
66	dbj|AP002006.6| Homo sapiens genomic DNA, chromosome 11 clone:RP...	40	5.7
67	dbj|AP001981.6| Homo sapiens genomic DNA, chromosome 11 clone:RP...	40	5.7
68	gb|AC115945.9| Mus musculus chromosome 3, clone RP24-555P13, com...	40	5.7
69	emb|AL929266.9| Zebrafish DNA sequence from clone CH211-67E16 in...	40	5.7
70	gb|AC004477.1|AC004477 Homo sapiens chromosome 17, clone HRPC890...	40	5.7
71	emb|AL672162.6| Mouse DNA sequence from clone RP23-100C4 on chro...	40	5.7
72	gb|AC147989.4| Mus musculus BAC clone RP24-468I14 from 18, compl...	40	5.7
73	emb|CT009609.1| Desulfococcus multivorans vrl island	40	5.7
74	emb|X84060.1|HSTCF11A H.sapiens TCF11 gene, exon 3-6	40	5.7
75	dbj|AB051270.1| Mustela nivalis mitochondrial cytb gene for cyto...	40	5.7
76	dbj|AB051269.1| Mustela nivalis mitochondrial cytb gene for cyto...	40	5.7
77	dbj|AB051268.1| Mustela nivalis mitochondrial cytb gene for cyto...	40	5.7
78	dbj|AB051259.1| Mustela erminea mitochondrial cytb gene for cyto...	40	5.7

---

>gb|AE017196.1| Wolbachia endosymbiont of Drosophila melanogaster, complete genome
          Length = 1267782

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 27/28 (96%)
 Strand = Plus / Plus

                                           
Query: 1       caaaattcagttatactatggttcttat 28
               ||||||| ||||||||||||||||||||
Sbjct: 1031902 caaaattaagttatactatggttcttat 1031929

---

>gb|AC112633.6| Rattus norvegicus 11 BAC CH230-200K21 (Children's Hospital Oakland
             Research Institute) complete sequence
          Length = 230130

 Score = 44.1 bits (22), Expect = 0.37
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                       
Query: 89    aaagagtacaagtataactcagcaga 114
             |||||||||||||||||| |||||||
Sbjct: 49676 aaagagtacaagtataacccagcaga 49701

---

>ref|XM_724596.1| Plasmodium yoelii yoelii str. 17XNL hypothetical protein (PY01862)
           partial mRNA
          Length = 756

 Score = 44.1 bits (22), Expect = 0.37
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 267 atcatatgtttttgacaagaat 288
           ||||||||||||||||||||||
Sbjct: 486 atcatatgtttttgacaagaat 465

---

>gb|AC127315.4| Mus musculus BAC clone RP23-218F21 from chromosome 8, complete sequence
          Length = 207577

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 114    aaaaatctccacaaataaaac 134
              |||||||||||||||||||||
Sbjct: 107551 aaaaatctccacaaataaaac 107531

---

>gb|AC124463.2| Mus musculus BAC clone RP24-152K14 from chromosome 1, complete sequence
          Length = 153199

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 195   ctttcttcctcttttcttcacttct 219
             ||||||||||||||||||| |||||
Sbjct: 76447 ctttcttcctcttttcttctcttct 76471

---

>emb|AL137013.4| Human DNA sequence from clone RP11-311P8 on chromosome Xq13.1-13.3
            Contains the 3' end of gene FLJ31812, a ribosomal protein
            L21 (RPL21) pseudogene, a telomeric repeat binding factor
            (NIMA-interacting) (TERF1) pseudogene and the 3' end of
            gene FLJ31792, complete sequence
          Length = 146259

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 194  gctttcttcctcttttcttca 214
            |||||||||||||||||||||
Sbjct: 7727 gctttcttcctcttttcttca 7747

---

>ref|XM_963063.1| PREDICTED: Tribolium castaneum similar to CG9696-PD, isoform D
            (LOC656538), mRNA
          Length = 7839

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 193  cgctttcttcctcttttcttc 213
            |||||||||||||||||||||
Sbjct: 1251 cgctttcttcctcttttcttc 1231

---

>emb|BX842607.1|OSJN00296 Oryza sativa genomic DNA, chromosome 4, BAC clone: B1248C03, complete
             sequence
          Length = 141099

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 194   gctttcttcctcttttcttca 214
             |||||||||||||||||||||
Sbjct: 76748 gctttcttcctcttttcttca 76728

---

>gb|AC092965.4| Homo sapiens 3 BAC RP11-440K22 (Roswell Park Cancer Institute Human BAC
             Library) complete sequence
          Length = 187033

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 65    cataatacaggcaaaaagaaa 85
             |||||||||||||||||||||
Sbjct: 93468 cataatacaggcaaaaagaaa 93448

---

>gb|AC019089.6| Homo sapiens BAC clone RP11-370L14 from 4, complete sequence
          Length = 177160

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 198   tcttcctcttttcttcacttc 218
             |||||||||||||||||||||
Sbjct: 90533 tcttcctcttttcttcacttc 90513

---

>dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 4, complete
               sequence
          Length = 35498469

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                    
Query: 194     gctttcttcctcttttcttca 214
               |||||||||||||||||||||
Sbjct: 1639466 gctttcttcctcttttcttca 1639446

---

>gb|AC115914.6| Mus musculus chromosome 8, clone RP24-487J5, complete sequence
          Length = 163170

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 114    aaaaatctccacaaataaaac 134
              |||||||||||||||||||||
Sbjct: 146986 aaaaatctccacaaataaaac 146966

---

>gb|AY185094.1| Podarcis sicula strain PST cytochrome b (cytb) gene, complete cds;
           mitochondrial gene for mitochondrial product
          Length = 1143

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 11  ttatactatggttcttatatg 31
           |||||||||||||||||||||
Sbjct: 307 ttatactatggttcttatatg 327

---

>gb|AY770892.1| Podarcis sicula haplotype 25 cytochrome b (cytb) gene, partial cds;
           mitochondrial
          Length = 887

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 11  ttatactatggttcttatatg 31
           |||||||||||||||||||||
Sbjct: 183 ttatactatggttcttatatg 203

---

>gb|AY770891.1| Podarcis sicula haplotype 24 cytochrome b (cytb) gene, partial cds;
           mitochondrial
          Length = 887

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 11  ttatactatggttcttatatg 31
           |||||||||||||||||||||
Sbjct: 183 ttatactatggttcttatatg 203

---

>gb|AY770890.1| Podarcis sicula haplotype 23 cytochrome b (cytb) gene, partial cds;
           mitochondrial
          Length = 887

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 11  ttatactatggttcttatatg 31
           |||||||||||||||||||||
Sbjct: 183 ttatactatggttcttatatg 203

---

>gb|AY770889.1| Podarcis sicula haplotype 22 cytochrome b (cytb) gene, partial cds;
           mitochondrial
          Length = 887

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 11  ttatactatggttcttatatg 31
           |||||||||||||||||||||
Sbjct: 183 ttatactatggttcttatatg 203

---

>gb|AY770888.1| Podarcis sicula haplotype 21 cytochrome b (cytb) gene, partial cds;
           mitochondrial
          Length = 887

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 11  ttatactatggttcttatatg 31
           |||||||||||||||||||||
Sbjct: 183 ttatactatggttcttatatg 203

---

>gb|AY770887.1| Podarcis sicula haplotype 20 cytochrome b (cytb) gene, partial cds;
           mitochondrial
          Length = 887

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 11  ttatactatggttcttatatg 31
           |||||||||||||||||||||
Sbjct: 183 ttatactatggttcttatatg 203

---

>gb|AY770886.1| Podarcis sicula haplotype 19 cytochrome b (cytb) gene, partial cds;
           mitochondrial
          Length = 887

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 11  ttatactatggttcttatatg 31
           |||||||||||||||||||||
Sbjct: 183 ttatactatggttcttatatg 203

---

>gb|AY770885.1| Podarcis sicula haplotype 18 cytochrome b (cytb) gene, partial cds;
           mitochondrial
          Length = 887

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 11  ttatactatggttcttatatg 31
           |||||||||||||||||||||
Sbjct: 183 ttatactatggttcttatatg 203

---

>gb|AY770884.1| Podarcis sicula haplotype 17 cytochrome b (cytb) gene, partial cds;
           mitochondrial
          Length = 887

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 11  ttatactatggttcttatatg 31
           |||||||||||||||||||||
Sbjct: 183 ttatactatggttcttatatg 203

---

>gb|AY770883.1| Podarcis sicula haplotype 16 cytochrome b (cytb) gene, partial cds;
           mitochondrial
          Length = 887

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 11  ttatactatggttcttatatg 31
           |||||||||||||||||||||
Sbjct: 183 ttatactatggttcttatatg 203

---

>gb|AY770882.1| Podarcis sicula haplotype 15 cytochrome b (cytb) gene, partial cds;
           mitochondrial
          Length = 887

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 11  ttatactatggttcttatatg 31
           |||||||||||||||||||||
Sbjct: 183 ttatactatggttcttatatg 203

---

>gb|AY770881.1| Podarcis sicula haplotype 14 cytochrome b (cytb) gene, partial cds;
           mitochondrial
          Length = 887

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 11  ttatactatggttcttatatg 31
           |||||||||||||||||||||
Sbjct: 183 ttatactatggttcttatatg 203

---

>gb|AY770880.1| Podarcis sicula haplotype 13 cytochrome b (cytb) gene, partial cds;
           mitochondrial
          Length = 887

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 11  ttatactatggttcttatatg 31
           |||||||||||||||||||||
Sbjct: 183 ttatactatggttcttatatg 203

---

>gb|AY770879.1| Podarcis sicula haplotype 12 cytochrome b (cytb) gene, partial cds;
           mitochondrial
          Length = 887

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 11  ttatactatggttcttatatg 31
           |||||||||||||||||||||
Sbjct: 183 ttatactatggttcttatatg 203

---

>gb|AY770878.1| Podarcis sicula haplotype 11 cytochrome b (cytb) gene, partial cds;
           mitochondrial
          Length = 887

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 11  ttatactatggttcttatatg 31
           |||||||||||||||||||||
Sbjct: 183 ttatactatggttcttatatg 203

---

>gb|AY770877.1| Podarcis sicula haplotype 10 cytochrome b (cytb) gene, partial cds;
           mitochondrial
          Length = 887

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 11  ttatactatggttcttatatg 31
           |||||||||||||||||||||
Sbjct: 183 ttatactatggttcttatatg 203

---

>gb|AY770875.1| Podarcis sicula haplotype 8 cytochrome b (cytb) gene, partial cds;
           mitochondrial
          Length = 887

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 11  ttatactatggttcttatatg 31
           |||||||||||||||||||||
Sbjct: 183 ttatactatggttcttatatg 203

---

>gb|AY770874.1| Podarcis sicula haplotype 7 cytochrome b (cytb) gene, partial cds;
           mitochondrial
          Length = 887

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 11  ttatactatggttcttatatg 31
           |||||||||||||||||||||
Sbjct: 183 ttatactatggttcttatatg 203

---

>gb|AY770873.1| Podarcis sicula haplotype 6 cytochrome b (cytb) gene, partial cds;
           mitochondrial
          Length = 887

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 11  ttatactatggttcttatatg 31
           |||||||||||||||||||||
Sbjct: 183 ttatactatggttcttatatg 203

---

>gb|AY770872.1| Podarcis sicula haplotype 5 cytochrome b (cytb) gene, partial cds;
           mitochondrial
          Length = 887

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 11  ttatactatggttcttatatg 31
           |||||||||||||||||||||
Sbjct: 183 ttatactatggttcttatatg 203

---

>gb|AY770871.1| Podarcis sicula haplotype 4 cytochrome b (cytb) gene, partial cds;
           mitochondrial
          Length = 887

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 11  ttatactatggttcttatatg 31
           |||||||||||||||||||||
Sbjct: 183 ttatactatggttcttatatg 203

---

>gb|AY770870.1| Podarcis sicula haplotype 3 cytochrome b (cytb) gene, partial cds;
           mitochondrial
          Length = 887

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 11  ttatactatggttcttatatg 31
           |||||||||||||||||||||
Sbjct: 183 ttatactatggttcttatatg 203

---

>gb|AY770869.1| Podarcis sicula haplotype 1 cytochrome b (cytb) gene, partial cds;
           mitochondrial
          Length = 887

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 11  ttatactatggttcttatatg 31
           |||||||||||||||||||||
Sbjct: 183 ttatactatggttcttatatg 203

---

>gb|AC145590.3| Mus musculus BAC clone RP24-175D4 from chromosome 19, complete sequence
          Length = 179063

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 115   aaaatctccacaaataaaac 134
             ||||||||||||||||||||
Sbjct: 89304 aaaatctccacaaataaaac 89285

---

>emb|CR376741.14| Zebrafish DNA sequence from clone DKEY-114B16 in linkage group 8,
              complete sequence
          Length = 166048

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 124    acaaataaaaccaagtaaaa 143
              ||||||||||||||||||||
Sbjct: 133016 acaaataaaaccaagtaaaa 133035

---

>gb|AC098889.3| Mus musculus BAC clone RP23-122O10 from 10, complete sequence
          Length = 204770

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 126   aaataaaaccaagtaaaagc 145
             ||||||||||||||||||||
Sbjct: 45202 aaataaaaccaagtaaaagc 45221

---

>gb|AC138714.4| Mus musculus chromosome 18 clone RP23-406C12, complete sequence
          Length = 191928

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 194  gctttcttcctcttttcttc 213
            ||||||||||||||||||||
Sbjct: 8365 gctttcttcctcttttcttc 8346

---

>gb|AC133904.9| Mus musculus chromosome 19, clone RP24-143J12, complete sequence
          Length = 163882

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 115    aaaatctccacaaataaaac 134
              ||||||||||||||||||||
Sbjct: 139907 aaaatctccacaaataaaac 139926

---

>ref|XM_674716.1| Plasmodium berghei strain ANKA hypothetical protein (PB000731.02.0)
            partial mRNA
          Length = 2994

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 71   acaggcaaaaagaaaggtaa 90
            ||||||||||||||||||||
Sbjct: 2898 acaggcaaaaagaaaggtaa 2917

---

>emb|AL590807.13| Human DNA sequence from clone RP11-325L2 on chromosome 13 Contains an
             ADP-ribosylation factor pseudogene, complete sequence
          Length = 178914

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 77    aaaaagaaaggtaaagagta 96
             ||||||||||||||||||||
Sbjct: 36995 aaaaagaaaggtaaagagta 36976

---

>emb|AL589863.11| Human DNA sequence from clone RP11-310J24 on chromosome 10, complete
             sequence
          Length = 168231

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 194   gctttcttcctcttttcttc 213
             ||||||||||||||||||||
Sbjct: 88565 gctttcttcctcttttcttc 88584

---

>emb|AL513209.16| Human DNA sequence from clone RP11-177F15 on chromosome 1 Contains part
             of a novel gene (FLJ33910), complete sequence
          Length = 140169

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 368   caacccaaaacagaaatttgacag 391
             ||||| ||||||||||||||||||
Sbjct: 42583 caaccaaaaacagaaatttgacag 42606

---

>emb|AL356794.10| Human DNA sequence from clone RP11-551A11 on chromosome 6 Contains a
             ribosomal protein S3A (40S ribosomal protein S3a, v-fos
             transformation effector protein 1) (RPS3A)(FTE1)
             pseudogene, complete sequence
          Length = 164439

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 200   ttcctcttttcttcacttct 219
             ||||||||||||||||||||
Sbjct: 65721 ttcctcttttcttcacttct 65740

---

>emb|AL139420.13| Human DNA sequence from clone RP4-712E4 on chromosome 1p11.1-13.2
             Contains the 5' end of the TBX15 gene for T-box 15, a
             novel gene, the 3' end of the WARS2 gene for tryptophanyl
             tRNA synthetase 2 (mitochondrial), the 3' end of  a novel
             gene and a CpG island, complete sequence
          Length = 122122

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 211   ttcacttctggtatcaaaag 230
             ||||||||||||||||||||
Sbjct: 41862 ttcacttctggtatcaaaag 41881

---

>gb|AC063948.44| Homo sapiens 12 BAC RP11-321F8 (Roswell Park Cancer Institute Human BAC
             Library) complete sequence
          Length = 146502

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 196   tttcttcctcttttcttcacttct 219
             |||||||||||||||||| |||||
Sbjct: 56760 tttcttcctcttttcttcccttct 56783

---

>emb|BX469905.5| Zebrafish DNA sequence from clone CH211-160B7 in linkage group 9,
             complete sequence
          Length = 113585

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 124   acaaataaaaccaagtaaaa 143
             ||||||||||||||||||||
Sbjct: 13569 acaaataaaaccaagtaaaa 13588



 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 124   acaaataaaaccaagtaaaa 143
             ||||||||||||||||||||
Sbjct: 13390 acaaataaaaccaagtaaaa 13409



 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 124   acaaataaaaccaagtaaaa 143
             ||||||||||||||||||||
Sbjct: 13010 acaaataaaaccaagtaaaa 13029

---

>emb|BX294117.17| Zebrafish DNA sequence from clone CH211-270F13 in linkage group 8,
             complete sequence
          Length = 114534

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 124   acaaataaaaccaagtaaaa 143
             ||||||||||||||||||||
Sbjct: 35024 acaaataaaaccaagtaaaa 35005

---

>gb|AF457461.1| Mustela nivalis cytochrome b (cytb) mRNA, complete cds;
           mitochondrial gene for mitochondrial product
          Length = 1140

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 11  ttatactatggttcttatat 30
           ||||||||||||||||||||
Sbjct: 304 ttatactatggttcttatat 323

---

>gb|AC018884.6| Homo sapiens BAC clone RP11-369I16 from 4, complete sequence
          Length = 166300

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 372    ccaaaacagaaatttgacag 391
              ||||||||||||||||||||
Sbjct: 113183 ccaaaacagaaatttgacag 113164

---

>gb|AC153145.4| Mus musculus BAC clone RP23-222C3 from chromosome 18, complete
            sequence
          Length = 193382

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 194  gctttcttcctcttttcttc 213
            ||||||||||||||||||||
Sbjct: 8365 gctttcttcctcttttcttc 8346

---

>dbj|AK036080.1| Mus musculus 16 days neonate cerebellum cDNA, RIKEN full-length
           enriched library, clone:9630033B02
           product:unclassifiable, full insert sequence
          Length = 3843

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 194 gctttcttcctcttttcttc 213
           ||||||||||||||||||||
Sbjct: 531 gctttcttcctcttttcttc 512

---

>gb|AC158597.7| Mus musculus 10 BAC RP24-216E13 (Roswell Park Cancer Institute
             (C57BL/6J Male) Mouse BAC Library) complete sequence
          Length = 167526

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 126   aaataaaaccaagtaaaagc 145
             ||||||||||||||||||||
Sbjct: 39096 aaataaaaccaagtaaaagc 39077

---

>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete
                sequence
          Length = 43261740

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                    
Query: 35       acaccattacgcaattttct 54
                ||||||||||||||||||||
Sbjct: 31122531 acaccattacgcaattttct 31122550

---

>gb|AC117832.6| Homo sapiens chromosome 15, clone RP11-963M5, complete sequence
          Length = 171462

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 200    ttcctcttttcttcacttct 219
              ||||||||||||||||||||
Sbjct: 129626 ttcctcttttcttcacttct 129607

---

>gb|AC097482.2| Homo sapiens BAC clone RP11-131L11 from 4, complete sequence
          Length = 160763

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 62    ccacataatacaggcaaaaa 81
             ||||||||||||||||||||
Sbjct: 63721 ccacataatacaggcaaaaa 63740

---

>gb|AC009432.7|AC009432 Homo sapiens chromosome 15, clone RP11-57P19, complete sequence
          Length = 199609

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 200   ttcctcttttcttcacttct 219
             ||||||||||||||||||||
Sbjct: 66215 ttcctcttttcttcacttct 66196

---

>gb|AC017088.8| Homo sapiens BAC clone RP11-496P1 from 2, complete sequence
          Length = 200440

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 236   gcagcaaacatccatcacat 255
             ||||||||||||||||||||
Sbjct: 48390 gcagcaaacatccatcacat 48409

---

>dbj|AP003376.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, BAC
             clone:OSJNBa0014K08
          Length = 177263

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 35    acaccattacgcaattttct 54
             ||||||||||||||||||||
Sbjct: 48876 acaccattacgcaattttct 48895

---

>gb|AY188794.1| Mustela nivalis haplotype Ru2 cytochrome b (cytb) gene, partial
           cds; mitochondrial gene for mitochondrial product
          Length = 337

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 11  ttatactatggttcttatat 30
           ||||||||||||||||||||
Sbjct: 266 ttatactatggttcttatat 285

---

>gb|AY188793.1| Mustela nivalis haplotype Est cytochrome b (cytb) gene, partial
           cds; mitochondrial gene for mitochondrial product
          Length = 337

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 11  ttatactatggttcttatat 30
           ||||||||||||||||||||
Sbjct: 266 ttatactatggttcttatat 285

---

>emb|AL445594.3|CNS07ED4 Human chromosome 14 DNA sequence BAC R-74H1 of library RPCI-11 from
             chromosome 14 of Homo sapiens (Human), complete sequence
          Length = 171409

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 373   caaaacagaaatttgacagattgg 396
             |||||| |||||||||||||||||
Sbjct: 40679 caaaactgaaatttgacagattgg 40656

---

>emb|AL355097.5|CNS05TCG Human chromosome 14 DNA sequence BAC R-204N11 of library RPCI-11 from
             chromosome 14 of Homo sapiens (Human), complete sequence
          Length = 164686

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 373   caaaacagaaatttgacagattgg 396
             |||||| |||||||||||||||||
Sbjct: 17990 caaaactgaaatttgacagattgg 18013

---

>dbj|AP002006.6| Homo sapiens genomic DNA, chromosome 11 clone:RP11-723C19, complete
              sequence
          Length = 167355

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 105    actcagcagaaaaatctcca 124
              ||||||||||||||||||||
Sbjct: 143718 actcagcagaaaaatctcca 143699

---

>dbj|AP001981.6| Homo sapiens genomic DNA, chromosome 11 clone:RP11-361A21, complete
             sequence
          Length = 183481

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 105   actcagcagaaaaatctcca 124
             ||||||||||||||||||||
Sbjct: 85016 actcagcagaaaaatctcca 84997

---

>gb|AC115945.9| Mus musculus chromosome 3, clone RP24-555P13, complete sequence
          Length = 172240

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 200    ttcctcttttcttcacttct 219
              ||||||||||||||||||||
Sbjct: 124815 ttcctcttttcttcacttct 124796

---

>emb|AL929266.9| Zebrafish DNA sequence from clone CH211-67E16 in linkage group 9,
             complete sequence
          Length = 199104

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 124   acaaataaaaccaagtaaaa 143
             ||||||||||||||||||||
Sbjct: 15414 acaaataaaaccaagtaaaa 15395

---

>gb|AC004477.1|AC004477 Homo sapiens chromosome 17, clone HRPC890E16, complete sequence
          Length = 135505

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 366    cccaacccaaaacagaaatt 385
              ||||||||||||||||||||
Sbjct: 100870 cccaacccaaaacagaaatt 100851

---

>emb|AL672162.6| Mouse DNA sequence from clone RP23-100C4 on chromosome 2, complete
             sequence
          Length = 136483

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 196   tttcttcctcttttcttcac 215
             ||||||||||||||||||||
Sbjct: 48398 tttcttcctcttttcttcac 48379

---

>gb|AC147989.4| Mus musculus BAC clone RP24-468I14 from 18, complete sequence
          Length = 204168

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 194   gctttcttcctcttttcttc 213
             ||||||||||||||||||||
Sbjct: 82479 gctttcttcctcttttcttc 82498

---

>emb|CT009609.1| Desulfococcus multivorans vrl island
          Length = 89210

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 370   acccaaaacagaaatttgac 389
             ||||||||||||||||||||
Sbjct: 40996 acccaaaacagaaatttgac 41015

---

>emb|X84060.1|HSTCF11A H.sapiens TCF11 gene, exon 3-6
          Length = 5544

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 366 cccaacccaaaacagaaatt 385
           ||||||||||||||||||||
Sbjct: 655 cccaacccaaaacagaaatt 636

---

>dbj|AB051270.1| Mustela nivalis mitochondrial cytb gene for cytochrome b, partial
           cds, isolate:HS928
          Length = 402

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 11  ttatactatggttcttatat 30
           ||||||||||||||||||||
Sbjct: 304 ttatactatggttcttatat 323

---

>dbj|AB051269.1| Mustela nivalis mitochondrial cytb gene for cytochrome b, partial
           cds, isolate:HS1171
          Length = 402

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 11  ttatactatggttcttatat 30
           ||||||||||||||||||||
Sbjct: 304 ttatactatggttcttatat 323

---

>dbj|AB051268.1| Mustela nivalis mitochondrial cytb gene for cytochrome b, partial
           cds, isolate:HS1119
          Length = 402

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 11  ttatactatggttcttatat 30
           ||||||||||||||||||||
Sbjct: 304 ttatactatggttcttatat 323

---

>dbj|AB051259.1| Mustela erminea mitochondrial cytb gene for cytochrome b, partial
           cds, isolate:HEG305HS1759
          Length = 402

 Score = 40.1 bits (20), Expect = 5.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 11  ttatactatggttcttatat 30
           ||||||||||||||||||||
Sbjct: 304 ttatactatggttcttatat 323


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 5,304,869
Number of Sequences: 3902068
Number of extensions: 5304869
Number of successful extensions: 118178
Number of sequences better than 10.0: 78
Number of HSP's better than 10.0 without gapping: 78
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 117911
Number of HSP's gapped (non-prelim): 267
length of query: 428
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 406
effective length of database: 17,147,199,772
effective search space: 6961763107432
effective search space used: 6961763107432
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)

---