Clone Name | rbastl19a11 |
---|---|
Clone Library Name | barley_pub |
>emb|CR382292.9| Zebrafish DNA sequence from clone DKEY-96L17 in linkage group 5, complete sequence Length = 178208 Score = 44.1 bits (22), Expect = 0.29 Identities = 22/22 (100%) Strand = Plus / Plus Query: 35 catgacatttattgccatgtac 56 |||||||||||||||||||||| Sbjct: 130498 catgacatttattgccatgtac 130519
>emb|BX323038.3| Zebrafish DNA sequence from clone DKEYP-57D7 in linkage group 1, complete sequence Length = 87548 Score = 44.1 bits (22), Expect = 0.29 Identities = 22/22 (100%) Strand = Plus / Minus Query: 35 catgacatttattgccatgtac 56 |||||||||||||||||||||| Sbjct: 10888 catgacatttattgccatgtac 10867
>gb|AC147027.4| Pan troglodytes BAC clone RP43-92F2 from 7, complete sequence Length = 162023 Score = 42.1 bits (21), Expect = 1.1 Identities = 21/21 (100%) Strand = Plus / Plus Query: 192 ttttttaattttatgtacaga 212 ||||||||||||||||||||| Sbjct: 147857 ttttttaattttatgtacaga 147877
>gb|AC161472.4| Pan troglodytes BAC clone CH251-584L3 from chromosome 7, complete sequence Length = 189756 Score = 42.1 bits (21), Expect = 1.1 Identities = 21/21 (100%) Strand = Plus / Plus Query: 192 ttttttaattttatgtacaga 212 ||||||||||||||||||||| Sbjct: 53678 ttttttaattttatgtacaga 53698
>emb|BX936452.24| Zebrafish DNA sequence from clone CH211-282C13 in linkage group 13, complete sequence Length = 136110 Score = 42.1 bits (21), Expect = 1.1 Identities = 21/21 (100%) Strand = Plus / Minus Query: 35 catgacatttattgccatgta 55 ||||||||||||||||||||| Sbjct: 16063 catgacatttattgccatgta 16043
>gb|AC000056.1| Homo sapiens BAC clone CTB-5F13 from 7, complete sequence Length = 84838 Score = 42.1 bits (21), Expect = 1.1 Identities = 21/21 (100%) Strand = Plus / Plus Query: 192 ttttttaattttatgtacaga 212 ||||||||||||||||||||| Sbjct: 10252 ttttttaattttatgtacaga 10272
>gb|AC142291.1| Pan troglodytes BAC clone RP43-184P18 from 7, complete sequence Length = 152668 Score = 42.1 bits (21), Expect = 1.1 Identities = 21/21 (100%) Strand = Plus / Plus Query: 179 ttatgcacatgggttttttaa 199 ||||||||||||||||||||| Sbjct: 40034 ttatgcacatgggttttttaa 40054
>gb|AC091485.8| Homo sapiens BAC clone RP11-434N4 from 2, complete sequence Length = 112063 Score = 42.1 bits (21), Expect = 1.1 Identities = 21/21 (100%) Strand = Plus / Plus Query: 192 ttttttaattttatgtacaga 212 ||||||||||||||||||||| Sbjct: 22705 ttttttaattttatgtacaga 22725
>emb|CR388077.11| Zebrafish DNA sequence from clone CH211-286E11 in linkage group 8, complete sequence Length = 192705 Score = 40.1 bits (20), Expect = 4.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 29 atttaccatgacatttattgccat 52 |||| ||||||||||||||||||| Sbjct: 181438 attttccatgacatttattgccat 181415
>emb|CR361543.9| Zebrafish DNA sequence from clone CH211-25E11 in linkage group 8, complete sequence Length = 66809 Score = 40.1 bits (20), Expect = 4.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 29 atttaccatgacatttattgccat 52 ||||| |||||||||||||||||| Sbjct: 7238 atttaacatgacatttattgccat 7215
>emb|AL845509.6| Human DNA sequence from clone DAQB-282H15 on chromosome 6 Contains the 5' end of the Notch4 gene for Notch homolog 4 (Drosophila), the 3' end of the C6orf10 gene for chromosome 6 open reading frame 10 and one CpG island, complete sequence Length = 126404 Score = 40.1 bits (20), Expect = 4.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 192 ttttttaattttatgtacagagaa 215 |||| ||||||||||||||||||| Sbjct: 99413 ttttataattttatgtacagagaa 99390
>emb|BX284927.5| Human DNA sequence from clone DASS-105C4 on chromosome 6, complete sequence Length = 108760 Score = 40.1 bits (20), Expect = 4.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 192 ttttttaattttatgtacagagaa 215 |||| ||||||||||||||||||| Sbjct: 85725 ttttataattttatgtacagagaa 85702
>emb|AL845557.1| Human DNA sequence from clone XXbac-556A18 on chromosome 6 contains the gene for chromosome 6 open reading frame 10 and a heterogeneous nuclear ribonucleoprotein A1 (HNRPA1) pseudogene, complete sequence Length = 49278 Score = 40.1 bits (20), Expect = 4.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 192 ttttttaattttatgtacagagaa 215 |||| ||||||||||||||||||| Sbjct: 16614 ttttataattttatgtacagagaa 16591
>emb|AL671511.4| Human DNA sequence from clone XXbac-154L12 on chromosome 6 contains the 3' end of the C6ORF10 gene for chromosome 6 open reading frame 10 and a heterogeneous nuclear ribonucleoprotein A1 (HNRPA1) pseudogene, complete sequence Length = 87294 Score = 40.1 bits (20), Expect = 4.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 192 ttttttaattttatgtacagagaa 215 |||| ||||||||||||||||||| Sbjct: 54867 ttttataattttatgtacagagaa 54844
>emb|AL161613.23| Human DNA sequence from clone RP11-22J15 on chromosome 13 Contains the 5' end of the LATS2 gene for LATS, large tumor suppressor, homolog 2 (LATS (large tumor suppressor, Drosophila) homolog 2), a ribosomal protein S12 (40S ribosomal protein S12) (RPS12) pseudogene, a chromosome 9 open reading frame 12 (C9orf12) (INSP5K2, FLJ13161)pseudogene and two CpG islands, complete sequence Length = 113372 Score = 40.1 bits (20), Expect = 4.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 185 acatgggttttttaatttta 204 |||||||||||||||||||| Sbjct: 38500 acatgggttttttaatttta 38481
>emb|AL137878.11| Human DNA sequence from clone RP11-145J3 on chromosome 13 Contains the 3' end of the EPSTI1 gene for epithelial stromal interaction 1 (breast), a novel gene and a pseudogene, complete sequence Length = 87358 Score = 40.1 bits (20), Expect = 4.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 35 catgacatttattgccatgt 54 |||||||||||||||||||| Sbjct: 16168 catgacatttattgccatgt 16149
>emb|AL035445.4|HS372B18 Human DNA sequence from clone RP3-372B18 on chromosome 6p21.2-22.1 Contains an HNRPA1 (Heterogenous Nuclear Ribonucleoprotein A1 (Helix Destabilizing protein, HDP, HNRNP core protein A1)) pseudogene and the 3' end of the C6orf10 gene for TSBP (Testis Specific Basic Protein). Contains ESTs and GSSs, complete sequence Length = 38216 Score = 40.1 bits (20), Expect = 4.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 192 ttttttaattttatgtacagagaa 215 |||| ||||||||||||||||||| Sbjct: 34218 ttttataattttatgtacagagaa 34241
>emb|BX927180.8| Human DNA sequence from clone DAMA-391O5 on chromosome 6, complete sequence Length = 69474 Score = 40.1 bits (20), Expect = 4.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 192 ttttttaattttatgtacagagaa 215 |||| ||||||||||||||||||| Sbjct: 38680 ttttataattttatgtacagagaa 38703
>emb|BX548071.7| Zebrafish DNA sequence from clone DKEY-25L23 in linkage group 9, complete sequence Length = 223099 Score = 40.1 bits (20), Expect = 4.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 29 atttaccatgacatttattgccat 52 ||||| |||||||||||||||||| Sbjct: 125126 atttaacatgacatttattgccat 125149
>emb|CR847543.13| Zebrafish DNA sequence from clone DKEY-183P4 in linkage group 8, complete sequence Length = 207382 Score = 40.1 bits (20), Expect = 4.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 29 atttaccatgacatttattgccat 52 ||||| |||||||||||||||||| Sbjct: 192648 atttaacatgacatttattgccat 192671
>emb|CR759737.4| Human DNA sequence from clone DADB-285H20 on chromosome 6, complete sequence Length = 83525 Score = 40.1 bits (20), Expect = 4.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 192 ttttttaattttatgtacagagaa 215 |||| ||||||||||||||||||| Sbjct: 59923 ttttataattttatgtacagagaa 59900
>gb|AC183273.3| Pan troglodytes BAC clone CH251-142H10 from chromosome 7, complete sequence Length = 180027 Score = 40.1 bits (20), Expect = 4.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 69 tgtgagagagatggtactac 88 |||||||||||||||||||| Sbjct: 66435 tgtgagagagatggtactac 66454
>emb|BX323602.7| Zebrafish DNA sequence from clone RP71-61H23, complete sequence Length = 156514 Score = 40.1 bits (20), Expect = 4.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 29 atttaccatgacatttattgccat 52 ||||| |||||||||||||||||| Sbjct: 10463 atttaacatgacatttattgccat 10440
>emb|BX004888.9| Zebrafish DNA sequence from clone DKEY-8F21 in linkage group 1, complete sequence Length = 219280 Score = 40.1 bits (20), Expect = 4.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 29 atttaccatgacatttattgccat 52 ||||||| |||||||||||||||| Sbjct: 141204 atttaccttgacatttattgccat 141181
>emb|BX470204.13| Zebrafish DNA sequence from clone CH211-63C23 in linkage group 10, complete sequence Length = 185190 Score = 40.1 bits (20), Expect = 4.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 29 atttaccatgacatttattgccat 52 ||||||||| |||||||||||||| Sbjct: 65279 atttaccataacatttattgccat 65302
>dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 4, complete sequence Length = 35498469 Score = 40.1 bits (20), Expect = 4.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 181 atgcacatgggttttttaat 200 |||||||||||||||||||| Sbjct: 11161734 atgcacatgggttttttaat 11161753
>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete sequence Length = 43261740 Score = 40.1 bits (20), Expect = 4.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 250 tggtactggaatttgttggt 269 |||||||||||||||||||| Sbjct: 31942663 tggtactggaatttgttggt 31942682
>dbj|AP003409.4| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, BAC clone:B1131G08 Length = 158241 Score = 40.1 bits (20), Expect = 4.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 250 tggtactggaatttgttggt 269 |||||||||||||||||||| Sbjct: 128741 tggtactggaatttgttggt 128760
>emb|AL954309.11| Zebrafish DNA sequence from clone CH211-213D2 in linkage group 8, complete sequence Length = 209195 Score = 40.1 bits (20), Expect = 4.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 29 atttaccatgacatttattgccat 52 ||||| |||||||||||||||||| Sbjct: 134576 atttaacatgacatttattgccat 134553
>emb|BX072550.6| Zebrafish DNA sequence from clone DKEY-24P1 in linkage group 15, complete sequence Length = 229061 Score = 40.1 bits (20), Expect = 4.5 Identities = 23/24 (95%) Strand = Plus / Plus Query: 29 atttaccatgacatttattgccat 52 ||||| |||||||||||||||||| Sbjct: 79692 atttaacatgacatttattgccat 79715
>emb|CT009591.8| Human DNA sequence from clone DAAP-263O12 on chromosome 6, complete sequence Length = 80114 Score = 40.1 bits (20), Expect = 4.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 192 ttttttaattttatgtacagagaa 215 |||| ||||||||||||||||||| Sbjct: 60738 ttttataattttatgtacagagaa 60715
>emb|AL731637.2|OSJN00278 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBb0115I09, complete sequence Length = 141580 Score = 40.1 bits (20), Expect = 4.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 181 atgcacatgggttttttaat 200 |||||||||||||||||||| Sbjct: 30358 atgcacatgggttttttaat 30377
>dbj|AB011968.1| Oryza sativa OsPK7 gene, complete cds Length = 5816 Score = 40.1 bits (20), Expect = 4.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 250 tggtactggaatttgttggt 269 |||||||||||||||||||| Sbjct: 1269 tggtactggaatttgttggt 1250
>dbj|AP003256.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P0460E08 Length = 170021 Score = 40.1 bits (20), Expect = 4.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 250 tggtactggaatttgttggt 269 |||||||||||||||||||| Sbjct: 39390 tggtactggaatttgttggt 39409 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 3,598,593 Number of Sequences: 3902068 Number of extensions: 3598593 Number of successful extensions: 73006 Number of sequences better than 10.0: 34 Number of HSP's better than 10.0 without gapping: 34 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 72914 Number of HSP's gapped (non-prelim): 92 length of query: 342 length of database: 17,233,045,268 effective HSP length: 22 effective length of query: 320 effective length of database: 17,147,199,772 effective search space: 5487103927040 effective search space used: 5487103927040 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)