>gb|AC165428.1| Strongylocentrotus purpuratus BAC clone contig containing Eve, the hox
              cluster, cholinesterase, and COLP5alpha genes, complete
              sequence
          Length = 796348

 Score = 38.2 bits (19), Expect = 1.0
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                     
Query: 7      agatacgttctgacataatatac 29
              ||||||||| |||||||||||||
Sbjct: 678968 agatacgttttgacataatatac 678990

>gb|AY483155.1| Hordeum vulgare putative cellulose synthase catalytic subunit (CesA6)
            mRNA, complete cds
          Length = 3745

 Score = 36.2 bits (18), Expect = 4.0
 Identities = 21/22 (95%)
 Strand = Plus / Minus

                                  
Query: 14   ttctgacataatatactctaag 35
            ||||||||| ||||||||||||
Sbjct: 3677 ttctgacatgatatactctaag 3656

>gb|AC158671.3| Mus musculus 6 BAC RP23-62E15 (Roswell Park Cancer Institute (C57BL/6J
             Female) Mouse BAC Library) complete sequence
          Length = 218969

 Score = 36.2 bits (18), Expect = 4.0
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                               
Query: 15    tctgacataatatactct 32
             ||||||||||||||||||
Sbjct: 76936 tctgacataatatactct 76919

>gb|AE001437.1| Clostridium acetobutylicum ATCC 824, complete genome
          Length = 3940880

 Score = 36.2 bits (18), Expect = 4.0
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                                 
Query: 14      ttctgacataatatactc 31
               ||||||||||||||||||
Sbjct: 1023084 ttctgacataatatactc 1023067

>gb|AC174771.1| Gasterosteus aculeatus clone VMRC28-84K03, complete sequence
          Length = 128214

 Score = 36.2 bits (18), Expect = 4.0
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                                
Query: 20     cataatatactctaagaa 37
              ||||||||||||||||||
Sbjct: 124985 cataatatactctaagaa 124968

>gb|AC153885.2| Mus musculus 6 BAC RP23-477L5 (Roswell Park Cancer Institute (C57BL/6J
              Female) Mouse BAC Library) complete sequence
          Length = 190785

 Score = 36.2 bits (18), Expect = 4.0
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                                
Query: 15     tctgacataatatactct 32
              ||||||||||||||||||
Sbjct: 159546 tctgacataatatactct 159529

>emb|AL162811.6|CNS01RI1 Human chromosome 14 DNA sequence BAC R-101G3 of library RPCI-11 from
              chromosome 14 of Homo sapiens (Human), complete sequence
          Length = 161204

 Score = 36.2 bits (18), Expect = 4.0
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                                
Query: 13     gttctgacataatatact 30
              ||||||||||||||||||
Sbjct: 151463 gttctgacataatatact 151446


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 178,056
Number of Sequences: 3902068
Number of extensions: 178056
Number of successful extensions: 44030
Number of sequences better than 10.0: 7
Number of HSP's better than 10.0 without gapping: 7
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 43985
Number of HSP's gapped (non-prelim): 45
length of query: 38
length of database: 17,233,045,268
effective HSP length: 20
effective length of query: 18
effective length of database: 17,155,003,908
effective search space: 308790070344
effective search space used: 308790070344
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 18 (36.2 bits)