>gb|AE006367.1| Lactococcus lactis subsp. lactis IL1403 section 129 of 218 of the
            complete genome
          Length = 11901

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 251  gttttttgtcaaaaaaggcct 271
            |||||||||||||||||||||
Sbjct: 4932 gttttttgtcaaaaaaggcct 4912

>gb|U13876.3| Caenorhabditis elegans cosmid F57B9, complete sequence
          Length = 39112

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 192  cgaaatacagtatctcaatcc 212
            |||||||||||||||||||||
Sbjct: 5828 cgaaatacagtatctcaatcc 5808

>emb|AL158053.14| Human DNA sequence from clone RP11-156J23 on chromosome Xq21.2-21.33
              Contains a discs, large homolog 7 (Drosophila) (DLG7)
              pseudogene, complete sequence
          Length = 177722

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 99     agctgaaagacaagtaacgag 119
              |||||||||||||||||||||
Sbjct: 122044 agctgaaagacaagtaacgag 122064

>gb|AY648725.1| Danio rerio Opa-interacting protein 2 mRNA, complete cds
          Length = 987

 Score = 40.1 bits (20), Expect = 4.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 276 atggaagggagttgggagag 295
           ||||||||||||||||||||
Sbjct: 98  atggaagggagttgggagag 117

>emb|AL451046.8| Human DNA sequence from clone RP11-174C7 on chromosome 6 Contains a
             ubiquitin-like 1 (sentrin) (UBL1) pseudogene, a novel
             pseudogene, a pyridoxal (pyridoxine, vitamin B6) kinase
             (PDXK) pseudogene and a novel gene, complete sequence
          Length = 105692

 Score = 40.1 bits (20), Expect = 4.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 10    aatcctacacggatataaaa 29
             ||||||||||||||||||||
Sbjct: 91561 aatcctacacggatataaaa 91580

>emb|BX465844.25| Zebrafish DNA sequence from clone CH211-106I3 in linkage group 10,
            complete sequence
          Length = 167771

 Score = 40.1 bits (20), Expect = 4.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 276  atggaagggagttgggagag 295
            ||||||||||||||||||||
Sbjct: 2324 atggaagggagttgggagag 2343

>gb|AC094020.2| Homo sapiens chromosome 3 clone RP11-425J9, complete sequence
          Length = 194729

 Score = 40.1 bits (20), Expect = 4.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 229    tcacatctattcttacacca 248
              ||||||||||||||||||||
Sbjct: 114772 tcacatctattcttacacca 114791

>ref|NM_001002865.1| Danio rerio exosome component 8 (exosc8), mRNA
          Length = 987

 Score = 40.1 bits (20), Expect = 4.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 276 atggaagggagttgggagag 295
           ||||||||||||||||||||
Sbjct: 98  atggaagggagttgggagag 117

>gb|BC095236.1| Danio rerio exosome component 8, mRNA (cDNA clone MGC:110381
           IMAGE:7410517), complete cds
          Length = 968

 Score = 40.1 bits (20), Expect = 4.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 276 atggaagggagttgggagag 295
           ||||||||||||||||||||
Sbjct: 81  atggaagggagttgggagag 100

>gb|AC068284.5| Homo sapiens BAC clone RP11-473K18 from 2, complete sequence
          Length = 110512

 Score = 40.1 bits (20), Expect = 4.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 222   acaaacttcacatctattct 241
             ||||||||||||||||||||
Sbjct: 22462 acaaacttcacatctattct 22481


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 3,036,681
Number of Sequences: 3902068
Number of extensions: 3036681
Number of successful extensions: 57983
Number of sequences better than 10.0: 10
Number of HSP's better than 10.0 without gapping: 10
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 57968
Number of HSP's gapped (non-prelim): 15
length of query: 319
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 297
effective length of database: 17,147,199,772
effective search space: 5092718332284
effective search space used: 5092718332284
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)