Clone Name | rbastl18h04 |
---|---|
Clone Library Name | barley_pub |
>emb|AL162754.2|NMA3Z2491 Neisseria meningitidis serogroup A strain Z2491 complete genome; segment 3/7 Length = 311321 Score = 44.1 bits (22), Expect = 0.30 Identities = 22/22 (100%) Strand = Plus / Minus Query: 283 ttgctttgggtggttctcaagt 304 |||||||||||||||||||||| Sbjct: 54689 ttgctttgggtggttctcaagt 54668
>emb|AL845352.7| Mouse DNA sequence from clone RP23-29A7 on chromosome 2, complete sequence Length = 196996 Score = 44.1 bits (22), Expect = 0.30 Identities = 22/22 (100%) Strand = Plus / Minus Query: 34 tttactatttccttgctgtctc 55 |||||||||||||||||||||| Sbjct: 14395 tttactatttccttgctgtctc 14374
>gb|AC117199.3| Mus musculus BAC clone RP23-134L22 from 10, complete sequence Length = 210514 Score = 42.1 bits (21), Expect = 1.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 164 aactaagatgcagtgctacaa 184 ||||||||||||||||||||| Sbjct: 104810 aactaagatgcagtgctacaa 104790
>gb|AC162908.4| Mus musculus BAC clone RP24-296A15 from chromosome 10, complete sequence Length = 170988 Score = 42.1 bits (21), Expect = 1.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 164 aactaagatgcagtgctacaa 184 ||||||||||||||||||||| Sbjct: 159254 aactaagatgcagtgctacaa 159234
>dbj|AP007159.1| Aspergillus oryzae RIB40 genomic DNA, SC026 Length = 2324132 Score = 42.1 bits (21), Expect = 1.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 299 tcaagtacgttgatgagatca 319 ||||||||||||||||||||| Sbjct: 387881 tcaagtacgttgatgagatca 387861
>dbj|AP001360.5| Homo sapiens genomic DNA, chromosome 11 clone:RP11-831A10, complete sequence Length = 190766 Score = 42.1 bits (21), Expect = 1.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 217 tgaactctcaatctctcagga 237 ||||||||||||||||||||| Sbjct: 130100 tgaactctcaatctctcagga 130120
>ref|XM_727196.1| Plasmodium chabaudi chabaudi hypothetical protein (PC302091.00.0) partial mRNA Length = 267 Score = 40.1 bits (20), Expect = 4.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 332 tcatcactggaacccttgag 351 |||||||||||||||||||| Sbjct: 212 tcatcactggaacccttgag 193
>ref|XM_740917.1| Plasmodium chabaudi chabaudi nif-like protein (PC000750.01.0) partial mRNA Length = 522 Score = 40.1 bits (20), Expect = 4.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 332 tcatcactggaacccttgag 351 |||||||||||||||||||| Sbjct: 467 tcatcactggaacccttgag 448
>gb|AC163650.2| Mus musculus BAC clone RP24-383A20 from chromosome 13, complete sequence Length = 210177 Score = 40.1 bits (20), Expect = 4.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 213 accttgaactctcaatctct 232 |||||||||||||||||||| Sbjct: 20137 accttgaactctcaatctct 20118
>gb|AF528749.1| Uranoscodon superciliosus NADH dehydrogenase subunit 1 (ND1) gene, partial cds; tRNA-Ile, tRNA-Gln, and tRNA-Met genes, complete sequence; NADH dehydrogenase subunit 2 (ND2) gene, complete cds; tRNA-Trp, tRNA-Ala, tRNA-Asn, tRNA-Cys, and tRNA-Tyr genes, complete sequence; and cytochrome c oxidase subunit I (COI) gene, partial cds; mitochondrial genes for mitochondrial products Length = 1737 Score = 40.1 bits (20), Expect = 4.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 78 ctaatcttaggagaactaattgcc 101 |||||||||| ||||||||||||| Sbjct: 1086 ctaatcttagaagaactaattgcc 1109
>emb|CR352340.10| Zebrafish DNA sequence from clone CH211-191L23 in linkage group 17, complete sequence Length = 145947 Score = 40.1 bits (20), Expect = 4.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 15 tgaataattcaactcttcat 34 |||||||||||||||||||| Sbjct: 84270 tgaataattcaactcttcat 84289
>emb|CR382126.1| Kluyveromyces lactis strain NRRL Y-1140 chromosome F of strain NRRL Y-1140 of Kluyveromyces lactis Length = 2602197 Score = 40.1 bits (20), Expect = 4.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 143 tttgatatttgaaaacagtg 162 |||||||||||||||||||| Sbjct: 1980818 tttgatatttgaaaacagtg 1980799
>emb|CR762487.7| Zebrafish DNA sequence from clone CH211-197G14 in linkage group 13, complete sequence Length = 219918 Score = 40.1 bits (20), Expect = 4.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 253 tagttcctccagcttcacaa 272 |||||||||||||||||||| Sbjct: 65597 tagttcctccagcttcacaa 65578
>gb|AC093430.3| Homo sapiens chromosome 1 clone RP11-171B15, complete sequence Length = 153414 Score = 40.1 bits (20), Expect = 4.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 29 cttcatttactatttccttgctgt 52 ||||||| |||||||||||||||| Sbjct: 119276 cttcattcactatttccttgctgt 119253
>gb|AC023281.13| Homo sapiens 12p BAC RP11-780A5 (Roswell Park Cancer Institute Human BAC Library) complete sequence Length = 145410 Score = 40.1 bits (20), Expect = 4.7 Identities = 26/28 (92%) Strand = Plus / Plus Query: 25 aactcttcatttactatttccttgctgt 52 |||||||| ||| ||||||||||||||| Sbjct: 16388 aactcttcctttgctatttccttgctgt 16415
>gb|AC091108.5| Homo sapiens chromosome 18, clone RP11-765H19, complete sequence Length = 164790 Score = 40.1 bits (20), Expect = 4.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 89 agaactaattgccaagtgcctaat 112 |||||||||||| ||||||||||| Sbjct: 48988 agaactaattgcaaagtgcctaat 49011
>gb|AC102391.12| Mus musculus chromosome 18, clone RP24-62K22, complete sequence Length = 196455 Score = 40.1 bits (20), Expect = 4.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 37 actatttccttgctgtctct 56 |||||||||||||||||||| Sbjct: 106939 actatttccttgctgtctct 106958
>emb|BX005336.10| Zebrafish DNA sequence from clone DKEY-85K7 in linkage group 7, complete sequence Length = 233826 Score = 40.1 bits (20), Expect = 4.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 157 acagtgcaactaagatgcag 176 |||||||||||||||||||| Sbjct: 110531 acagtgcaactaagatgcag 110550
>ref|XM_560172.1| Anopheles gambiae str. PEST ENSANGP00000029630 (ENSANGG00000016129), partial mRNA Length = 627 Score = 40.1 bits (20), Expect = 4.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 168 aagatgcagtgctacaagattaaa 191 |||||||||||| ||||||||||| Sbjct: 520 aagatgcagtgccacaagattaaa 543
>ref|XM_309145.2| Anopheles gambiae str. PEST ENSANGP00000025319 (ENSANGG00000016129), partial mRNA Length = 1322 Score = 40.1 bits (20), Expect = 4.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 168 aagatgcagtgctacaagattaaa 191 |||||||||||| ||||||||||| Sbjct: 1027 aagatgcagtgccacaagattaaa 1050
>ref|XM_309146.2| Anopheles gambiae str. PEST ENSANGP00000018618 (ENSANGG00000016129), partial mRNA Length = 1451 Score = 40.1 bits (20), Expect = 4.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 168 aagatgcagtgctacaagattaaa 191 |||||||||||| ||||||||||| Sbjct: 1156 aagatgcagtgccacaagattaaa 1179
>emb|AL833795.7| Mouse DNA sequence from clone RP23-81B16 on chromosome X, complete sequence Length = 72909 Score = 40.1 bits (20), Expect = 4.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 266 ttcacaacaggtttcttttgcttt 289 |||||||||| ||||||||||||| Sbjct: 4354 ttcacaacagctttcttttgcttt 4331 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 3,479,333 Number of Sequences: 3902068 Number of extensions: 3479333 Number of successful extensions: 65352 Number of sequences better than 10.0: 22 Number of HSP's better than 10.0 without gapping: 22 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 65306 Number of HSP's gapped (non-prelim): 46 length of query: 354 length of database: 17,233,045,268 effective HSP length: 22 effective length of query: 332 effective length of database: 17,147,199,772 effective search space: 5692870324304 effective search space used: 5692870324304 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)