>gb|AY253318.1| HIV-1 isolate 01TZA306 from Tanzania gag protein (gag) and pol
            protein (pol) genes, partial cds; and vif protein (vif),
            vpr protein (vpr), tat protein (tat), rev protein (rev),
            vpu protein (vpu), envelope glycoprotein (env), and nef
            protein (nef) genes, complete cds
          Length = 8737

 Score = 40.1 bits (20), Expect = 2.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 39   tttctctagctgaaacaaca 58
            ||||||||||||||||||||
Sbjct: 3127 tttctctagctgaaacaaca 3146

>gb|AY463223.1| HIV-1 isolate C.ZA.J54Ma from South Africa, complete genome
          Length = 9117

 Score = 40.1 bits (20), Expect = 2.1
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                        
Query: 31   aaagattttttctctagctgaaacaaca 58
            ||||||| |||||||| |||||||||||
Sbjct: 3366 aaagattgtttctctaactgaaacaaca 3393

>gb|DQ011177.1| HIV-1 isolate 04ZASK136B1 from South Africa, complete genome
          Length = 9042

 Score = 40.1 bits (20), Expect = 2.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 39   tttctctagctgaaacaaca 58
            ||||||||||||||||||||
Sbjct: 3367 tttctctagctgaaacaaca 3386

>gb|DQ011166.1| HIV-1 isolate 04ZASK135B1 from South Africa, complete genome
          Length = 9073

 Score = 40.1 bits (20), Expect = 2.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 39   tttctctagctgaaacaaca 58
            ||||||||||||||||||||
Sbjct: 3340 tttctctagctgaaacaaca 3359

>emb|AL773508.6| Mouse DNA sequence from clone RP23-253D15 on chromosome 2, complete
             sequence
          Length = 132091

 Score = 40.1 bits (20), Expect = 2.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 105   tatctccctctcttcttctc 124
             ||||||||||||||||||||
Sbjct: 44695 tatctccctctcttcttctc 44676

>gb|AY713414.1| HIV-1 isolate 94IN_20635-4 from India gag protein (gag) and pol
            protein (pol) genes, partial cds; and vif protein (vif),
            vpr protein (vpr), tat protein (tat), rev protein (rev),
            vpu protein (vpu), envelope glycoprotein (env), and nef
            protein (nef) genes, complete cds
          Length = 8745

 Score = 40.1 bits (20), Expect = 2.1
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                        
Query: 31   aaagattttttctctagctgaaacaaca 58
            ||||||| |||||||| |||||||||||
Sbjct: 3119 aaagattgtttctctaactgaaacaaca 3146

>gb|AC079436.2| Rattus norvegicus strain Brown Norway chromosome 4 clone RP31-108L19,
             complete sequence
          Length = 174622

 Score = 40.1 bits (20), Expect = 2.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 104   atatctccctctcttcttct 123
             ||||||||||||||||||||
Sbjct: 72144 atatctccctctcttcttct 72163

>gb|DQ351226.1| HIV-1 isolate 03ZAPS025MB1 from South Africa, complete genome
          Length = 9081

 Score = 40.1 bits (20), Expect = 2.1
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                        
Query: 31   aaagattttttctctagctgaaacaaca 58
            ||||||| |||||||| |||||||||||
Sbjct: 3352 aaagattgtttctctaactgaaacaaca 3379

>ref|NM_148696.2| Arabidopsis thaliana hydrolase, hydrolyzing O-glycosyl compounds
           AT3G07320 mRNA, complete cds
          Length = 1762

 Score = 38.2 bits (19), Expect = 8.4
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                              
Query: 106 atctccctctcttcttctc 124
           |||||||||||||||||||
Sbjct: 40  atctccctctcttcttctc 58

>gb|AC123743.11| Mus musculus chromosome 5, clone RP24-116M4, complete sequence
          Length = 177350

 Score = 38.2 bits (19), Expect = 8.4
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 101   cctatatctccctctcttc 119
             |||||||||||||||||||
Sbjct: 14650 cctatatctccctctcttc 14668

>gb|AY703908.1| HIV-1 isolate 03ZASK040B1 from South Africa, complete genome
          Length = 9020

 Score = 38.2 bits (19), Expect = 8.4
 Identities = 25/27 (92%)
 Strand = Plus / Plus

                                       
Query: 32   aagattttttctctagctgaaacaaca 58
            |||||| |||||||| |||||||||||
Sbjct: 3357 aagattgtttctctaactgaaacaaca 3383

>gb|AC140291.2| Mus musculus BAC clone RP24-326N12 from chromosome 5, complete sequence
          Length = 167269

 Score = 38.2 bits (19), Expect = 8.4
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 101   cctatatctccctctcttc 119
             |||||||||||||||||||
Sbjct: 64321 cctatatctccctctcttc 64303

>gb|DQ396396.1| HIV-1 isolate 04ZASK193B1 from South Africa, complete genome
          Length = 9083

 Score = 38.2 bits (19), Expect = 8.4
 Identities = 25/27 (92%)
 Strand = Plus / Plus

                                       
Query: 32   aagattttttctctagctgaaacaaca 58
            |||||| |||||||| |||||||||||
Sbjct: 3372 aagattgtttctctaactgaaacaaca 3398

>gb|DQ396391.1| HIV-1 isolate 03ZAPS143MB1 from South Africa, complete genome
          Length = 9075

 Score = 38.2 bits (19), Expect = 8.4
 Identities = 25/27 (92%)
 Strand = Plus / Plus

                                       
Query: 32   aagattttttctctagctgaaacaaca 58
            |||||| |||||||| |||||||||||
Sbjct: 3359 aagattgtttctctaactgaaacaaca 3385

>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3
          Length = 36102668

 Score = 38.2 bits (19), Expect = 8.4
 Identities = 25/27 (92%)
 Strand = Plus / Minus

                                        
Query: 97    ttatcctatatctccctctcttcttct 123
             |||||||||  ||||||||||||||||
Sbjct: 92370 ttatcctatccctccctctcttcttct 92344

>gb|AC009853.4|ATAC009853 Arabidopsis thaliana chromosome III BAC F21O3 genomic sequence,
            complete sequence
          Length = 90112

 Score = 38.2 bits (19), Expect = 8.4
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                               
Query: 106  atctccctctcttcttctc 124
            |||||||||||||||||||
Sbjct: 8762 atctccctctcttcttctc 8744

>gb|AC012395.5|ATAC012395 Arabidopsis thaliana chromosome III BAC T1B9 genomic sequence,
           complete sequence
          Length = 99128

 Score = 38.2 bits (19), Expect = 8.4
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                              
Query: 106 atctccctctcttcttctc 124
           |||||||||||||||||||
Sbjct: 770 atctccctctcttcttctc 788

>emb|AL359915.14| Human DNA sequence from clone RP11-418J17 on chromosome 1 Contains the 3'
              end of a novel gene, a ribosomal protein L6 (RPL6)
              pseudogene and the 5' end of a novel gene, complete
              sequence
          Length = 159158

 Score = 38.2 bits (19), Expect = 8.4
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 92     cttatttatcctatatctc 110
              |||||||||||||||||||
Sbjct: 145269 cttatttatcctatatctc 145251

>gb|AF521703.1| Actinobacillus actinomycetemcomitans isolate D7S type IV pilus-like
            cluster, complete sequence; and unknown genes
          Length = 6325

 Score = 38.2 bits (19), Expect = 8.4
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                               
Query: 75   ggcggtaaatacaccgcct 93
            |||||||||||||||||||
Sbjct: 6081 ggcggtaaatacaccgcct 6063

>gb|AC147881.2| Xenopus tropicalis clone CH216-115N11, complete sequence
          Length = 162394

 Score = 38.2 bits (19), Expect = 8.4
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 94    tatttatcctatatctccc 112
             |||||||||||||||||||
Sbjct: 87650 tatttatcctatatctccc 87632

>gb|AY463220.1| HIV-1 isolate C.ZA.1195MB from South Africa, complete genome
          Length = 9105

 Score = 38.2 bits (19), Expect = 8.4
 Identities = 25/27 (92%)
 Strand = Plus / Plus

                                       
Query: 32   aagattttttctctagctgaaacaaca 58
            |||||| |||||||| |||||||||||
Sbjct: 3372 aagattgtttctctaactgaaacaaca 3398

>gb|AC125411.1| Genomic sequence for Oryza sativa, Nipponbare strain, clone
             OSJNAb0079B22, from chromosome 3, complete sequence
          Length = 156933

 Score = 38.2 bits (19), Expect = 8.4
 Identities = 25/27 (92%)
 Strand = Plus / Minus

                                        
Query: 97    ttatcctatatctccctctcttcttct 123
             |||||||||  ||||||||||||||||
Sbjct: 26370 ttatcctatccctccctctcttcttct 26344

>gb|AF443115.1| HIV-1 isolate 00BW5031.1 from Botswana, complete genome
          Length = 9047

 Score = 38.2 bits (19), Expect = 8.4
 Identities = 25/27 (92%)
 Strand = Plus / Plus

                                       
Query: 32   aagattttttctctagctgaaacaaca 58
            |||||| |||||||| |||||||||||
Sbjct: 3313 aagattgtttctctaactgaaacaaca 3339

>gb|AF361874.1|AF361874 HIV-1 isolate 97TZ04 from Tanzania truncated gag protein (gag),
            partial cds; and pol protein (pol), vif protein (vif),
            vpr protein (vpr), truncated tat protein (tat), truncated
            rev protein (rev), vpu protein (vpu), envelope
            glycoprotein (env), and nef protein (nef) genes, complete
            cds
          Length = 8834

 Score = 38.2 bits (19), Expect = 8.4
 Identities = 25/27 (92%)
 Strand = Plus / Plus

                                       
Query: 32   aagattttttctctagctgaaacaaca 58
            |||||| || |||||||||||||||||
Sbjct: 3137 aagattgttactctagctgaaacaaca 3163

>gb|AC097627.1| Genomic sequence for Oryza sativa, Nipponbare strain, clone
             OSJNBb0079B22, from chromosome 3, complete sequence
          Length = 125217

 Score = 38.2 bits (19), Expect = 8.4
 Identities = 25/27 (92%)
 Strand = Plus / Plus

                                        
Query: 97    ttatcctatatctccctctcttcttct 123
             |||||||||  ||||||||||||||||
Sbjct: 32848 ttatcctatccctccctctcttcttct 32874

>gb|AY901971.1| HIV-1 isolate 03ZASK078B1 from South Africa, complete genome
          Length = 9121

 Score = 38.2 bits (19), Expect = 8.4
 Identities = 25/27 (92%)
 Strand = Plus / Plus

                                       
Query: 32   aagattttttctctagctgaaacaaca 58
            |||||| |||||||| |||||||||||
Sbjct: 3371 aagattgtttctctaactgaaacaaca 3397

>gb|DQ275646.1| HIV-1 isolate 03ZAPS133MB1 from South Africa gag protein (gag) gene,
            complete cds; pol protein (pol) gene, partial cds; and
            vif protein (vif), vpr protein (vpr), tat protein (tat),
            rev protein (rev), vpu protein (vpu), envelope
            glycoprotein (env), and nef protein (nef) genes, complete
            cds
          Length = 8969

 Score = 38.2 bits (19), Expect = 8.4
 Identities = 25/27 (92%)
 Strand = Plus / Plus

                                       
Query: 32   aagattttttctctagctgaaacaaca 58
            |||||| |||||||| |||||||||||
Sbjct: 3352 aagattatttctctaactgaaacaaca 3378

>gb|DQ369977.1| HIV-1 isolate 03ZAPS042MB1 from South Africa, complete genome
          Length = 9015

 Score = 38.2 bits (19), Expect = 8.4
 Identities = 25/27 (92%)
 Strand = Plus / Plus

                                       
Query: 32   aagattttttctctagctgaaacaaca 58
            |||||| |||||||| |||||||||||
Sbjct: 3353 aagattgtttctctaactgaaacaaca 3379

>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3,
             complete sequence
          Length = 36192742

 Score = 38.2 bits (19), Expect = 8.4
 Identities = 25/27 (92%)
 Strand = Plus / Minus

                                        
Query: 97    ttatcctatatctccctctcttcttct 123
             |||||||||  ||||||||||||||||
Sbjct: 92370 ttatcctatccctccctctcttcttct 92344

>gb|AC012509.13| Homo sapiens BAC clone RP11-532A9 from 2, complete sequence
          Length = 209877

 Score = 38.2 bits (19), Expect = 8.4
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 105   tatctccctctcttcttct 123
             |||||||||||||||||||
Sbjct: 39938 tatctccctctcttcttct 39956

>gb|AC009492.4| Homo sapiens BAC clone RP11-423F9 from 2, complete sequence
          Length = 212549

 Score = 38.2 bits (19), Expect = 8.4
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 36    ttttttctctagctgaaac 54
             |||||||||||||||||||
Sbjct: 44443 ttttttctctagctgaaac 44461

>gb|DQ351222.1| HIV-1 isolate 02ZAPS013MB1 from South Africa, complete genome
          Length = 9022

 Score = 38.2 bits (19), Expect = 8.4
 Identities = 25/27 (92%)
 Strand = Plus / Plus

                                       
Query: 32   aagattttttctctagctgaaacaaca 58
            |||||| |||||||| |||||||||||
Sbjct: 3355 aagattatttctctaactgaaacaaca 3381

>gb|AY087496.1| Arabidopsis thaliana clone 36049 mRNA, complete sequence
          Length = 1713

 Score = 38.2 bits (19), Expect = 8.4
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                              
Query: 106 atctccctctcttcttctc 124
           |||||||||||||||||||
Sbjct: 15  atctccctctcttcttctc 33

>dbj|AK118068.1| Arabidopsis thaliana At3g07320 mRNA for putative beta-1,3-glucanase
           precursor, complete cds, clone: RAFL19-31-M21
          Length = 1762

 Score = 38.2 bits (19), Expect = 8.4
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                              
Query: 106 atctccctctcttcttctc 124
           |||||||||||||||||||
Sbjct: 40  atctccctctcttcttctc 58

>gb|AE015927.1| Clostridium tetani E88, complete genome
          Length = 2799251

 Score = 38.2 bits (19), Expect = 8.4
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 35     attttttctctagctgaaa 53
              |||||||||||||||||||
Sbjct: 543526 attttttctctagctgaaa 543544

>gb|AC126054.5| Mus musculus BAC clone RP23-298O13 from 8, complete sequence
          Length = 233117

 Score = 38.2 bits (19), Expect = 8.4
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 40    ttctctagctgaaacaaca 58
             |||||||||||||||||||
Sbjct: 85966 ttctctagctgaaacaaca 85984


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 1,798,080
Number of Sequences: 3902068
Number of extensions: 1798080
Number of successful extensions: 112115
Number of sequences better than 10.0: 37
Number of HSP's better than 10.0 without gapping: 37
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 111953
Number of HSP's gapped (non-prelim): 162
length of query: 172
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 150
effective length of database: 17,147,199,772
effective search space: 2572079965800
effective search space used: 2572079965800
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 19 (38.2 bits)