ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
menu 
| Clone Name | rbastl18d09 |
|---|---|
| Clone Library Name | barley_pub |
>emb|AL391832.10| Human DNA sequence from clone RP11-443B7 on chromosome 1 Contains two novel genes (LOC284527), complete sequence Length = 144648 Score = 44.1 bits (22), Expect = 0.29 Identities = 22/22 (100%) Strand = Plus / Minus Query: 40 atcttctttttctttcttttgc 61 |||||||||||||||||||||| Sbjct: 104465 atcttctttttctttcttttgc 104444
>dbj|AK154432.1| Mus musculus NOD-derived CD11c +ve dendritic cells cDNA, RIKEN full-length enriched library, clone:F630031K04 product:ATP synthase alpha chain, mitochondrial (EC 3.6.3.14) homolog [Nicotiana plumbaginifolia], full insert sequence Length = 4094 Score = 44.1 bits (22), Expect = 0.29 Identities = 22/22 (100%) Strand = Plus / Minus Query: 37 atgatcttctttttctttcttt 58 |||||||||||||||||||||| Sbjct: 3850 atgatcttctttttctttcttt 3829
>emb|CR318601.8| Zebrafish DNA sequence from clone CH211-274E20 in linkage group 7, complete sequence Length = 165501 Score = 44.1 bits (22), Expect = 0.29 Identities = 25/26 (96%) Strand = Plus / Plus Query: 34 tgcatgatcttctttttctttctttt 59 |||||||||||||||||||| ||||| Sbjct: 73703 tgcatgatcttctttttcttcctttt 73728
>gb|AC121281.19| Mus musculus chromosome 3, clone RP23-61G16, complete sequence Length = 196761 Score = 42.1 bits (21), Expect = 1.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 111 ttatactatactacagtacta 131 ||||||||||||||||||||| Sbjct: 98668 ttatactatactacagtacta 98688 Score = 40.1 bits (20), Expect = 4.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 112 tatactatactacagtacta 131 |||||||||||||||||||| Sbjct: 98762 tatactatactacagtacta 98781
>gb|AC111106.10| Mus musculus chromosome 3, clone RP23-193O12, complete sequence Length = 202749 Score = 42.1 bits (21), Expect = 1.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 39 gatcttctttttctttctttt 59 ||||||||||||||||||||| Sbjct: 122373 gatcttctttttctttctttt 122393
>gb|AC005736.1| Homo sapiens chromosome 16, BAC clone 462G18 (LANL), complete sequence Length = 215441 Score = 42.1 bits (21), Expect = 1.2 Identities = 24/25 (96%) Strand = Plus / Minus Query: 37 atgatcttctttttctttcttttgc 61 ||||| ||||||||||||||||||| Sbjct: 164574 atgatattctttttctttcttttgc 164550
>emb|BX957326.8| Zebrafish DNA sequence from clone DKEY-31B16 in linkage group 23, complete sequence Length = 259092 Score = 42.1 bits (21), Expect = 1.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 41 tcttctttttctttcttttgc 61 ||||||||||||||||||||| Sbjct: 81975 tcttctttttctttcttttgc 81995
>emb|AL445071.15| Human DNA sequence from clone RP11-460H18 on chromosome 10 Contains a peptidylprolyl isomerase A (cyclophilin A) (PPIA)(CYPA, CYPH) pseudogene, a ribosomal protein S24 (RPS24) pseudogene, the 5' end of a novel gene and a CpG island, complete sequence Length = 151478 Score = 42.1 bits (21), Expect = 1.2 Identities = 24/25 (96%) Strand = Plus / Plus Query: 43 ttctttttctttcttttgcgacagg 67 |||||||||||||||||| |||||| Sbjct: 139225 ttctttttctttcttttgagacagg 139249
>gb|AC123789.6| Homo sapiens chromosome 11, clone RP5-998N23, complete sequence Length = 137691 Score = 42.1 bits (21), Expect = 1.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 107 atgcttatactatactacagt 127 ||||||||||||||||||||| Sbjct: 15569 atgcttatactatactacagt 15549
>emb|AL163002.1|ATF15A17 Arabidopsis thaliana DNA chromosome 5, BAC clone F15A17 (ESSA project) Length = 99008 Score = 42.1 bits (21), Expect = 1.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 38 tgatcttctttttctttcttt 58 ||||||||||||||||||||| Sbjct: 59231 tgatcttctttttctttcttt 59211
>gb|AF427791.1| Hordeum vulgare Mla locus, complete sequence Length = 261265 Score = 42.1 bits (21), Expect = 1.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 43 ttctttttctttcttttgcga 63 ||||||||||||||||||||| Sbjct: 41164 ttctttttctttcttttgcga 41184
>gb|AC011472.7|AC011472 Homo sapiens chromosome 19 clone CTC-510F12, complete sequence Length = 122321 Score = 42.1 bits (21), Expect = 1.2 Identities = 24/25 (96%) Strand = Plus / Plus Query: 43 ttctttttctttcttttgcgacagg 67 |||||||||||||||||| |||||| Sbjct: 56648 ttctttttctttcttttgagacagg 56672
>gb|AC008003.8|AC008003 Drosophila melanogaster, chromosome 2L, region 24D-24D, BAC clone BACR48D02, complete sequence Length = 181728 Score = 42.1 bits (21), Expect = 1.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 66 ggatcatgatcattatcttca 86 ||||||||||||||||||||| Sbjct: 139084 ggatcatgatcattatcttca 139104
>gb|AC007391.3| Homo sapiens BAC clone RP11-429J10 from 2, complete sequence Length = 183991 Score = 42.1 bits (21), Expect = 1.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 276 atcttattcttataccaagcc 296 ||||||||||||||||||||| Sbjct: 55074 atcttattcttataccaagcc 55054
>gb|AC009225.4| Homo sapiens BAC clone RP11-156A1 from 2, complete sequence Length = 163352 Score = 42.1 bits (21), Expect = 1.2 Identities = 24/25 (96%) Strand = Plus / Plus Query: 43 ttctttttctttcttttgcgacagg 67 |||||||||||||||||| |||||| Sbjct: 107950 ttctttttctttcttttgagacagg 107974
>dbj|AB005240.1| Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MOK16 Length = 80770 Score = 42.1 bits (21), Expect = 1.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 38 tgatcttctttttctttcttt 58 ||||||||||||||||||||| Sbjct: 30370 tgatcttctttttctttcttt 30350
>emb|BX928749.12| Zebrafish DNA sequence from clone CH211-201A8 in linkage group 2, complete sequence Length = 215263 Score = 42.1 bits (21), Expect = 1.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 41 tcttctttttctttcttttgc 61 ||||||||||||||||||||| Sbjct: 161780 tcttctttttctttcttttgc 161800
>gb|AE003577.4| Drosophila melanogaster chromosome 2L, section 14 of 83 of the complete sequence Length = 290034 Score = 42.1 bits (21), Expect = 1.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 66 ggatcatgatcattatcttca 86 ||||||||||||||||||||| Sbjct: 59844 ggatcatgatcattatcttca 59864
>emb|AL731548.13| Mouse DNA sequence from clone RP23-71M18 on chromosome X, complete sequence Length = 218612 Score = 42.1 bits (21), Expect = 1.2 Identities = 24/25 (96%) Strand = Plus / Minus Query: 35 gcatgatcttctttttctttctttt 59 ||||||| ||||||||||||||||| Sbjct: 32469 gcatgattttctttttctttctttt 32445
>gb|BC057222.1| Homo sapiens triadin, mRNA (cDNA clone IMAGE:4338427), partial cds Length = 1211 Score = 40.1 bits (20), Expect = 4.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 40 atcttctttttctttctttt 59 |||||||||||||||||||| Sbjct: 1181 atcttctttttctttctttt 1162
>gb|AC119957.9| Mus musculus chromosome 17, clone RP24-466G23, complete sequence Length = 153209 Score = 40.1 bits (20), Expect = 4.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 39 gatcttctttttctttcttt 58 |||||||||||||||||||| Sbjct: 148220 gatcttctttttctttcttt 148201
>gb|AC121964.1| Mus musculus chromosome 19 clone RP24-257N11, complete sequence Length = 143290 Score = 40.1 bits (20), Expect = 4.6 Identities = 23/24 (95%) Strand = Plus / Plus Query: 36 catgatcttctttttctttctttt 59 ||||||||||||||||||| |||| Sbjct: 128158 catgatcttctttttctttatttt 128181
>gb|AC163722.6| Mus musculus BAC clone RP23-447O11 from chromosome 19, complete sequence Length = 178562 Score = 40.1 bits (20), Expect = 4.6 Identities = 23/24 (95%) Strand = Plus / Minus Query: 36 catgatcttctttttctttctttt 59 ||||||||||||||||||| |||| Sbjct: 127773 catgatcttctttttctttatttt 127750
>gb|AC163217.9| Mus musculus chromosome 1, clone RP23-474A1, complete sequence Length = 184175 Score = 40.1 bits (20), Expect = 4.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 41 tcttctttttctttcttttg 60 |||||||||||||||||||| Sbjct: 160080 tcttctttttctttcttttg 160061
>ref|NM_001003154.1| Canis familiaris triadin (TRDN), mRNA Length = 3649 Score = 40.1 bits (20), Expect = 4.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 40 atcttctttttctttctttt 59 |||||||||||||||||||| Sbjct: 1136 atcttctttttctttctttt 1117
>ref|NM_006073.1| Homo sapiens triadin (TRDN), mRNA Length = 2947 Score = 40.1 bits (20), Expect = 4.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 40 atcttctttttctttctttt 59 |||||||||||||||||||| Sbjct: 1024 atcttctttttctttctttt 1005
>gb|AC121299.16| Mus musculus chromosome 17, clone RP23-402P8, complete sequence Length = 217287 Score = 40.1 bits (20), Expect = 4.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 39 gatcttctttttctttcttt 58 |||||||||||||||||||| Sbjct: 185489 gatcttctttttctttcttt 185508
>gb|AC150389.2| Branchiostoma floridae clone CH302-114C5, complete sequence Length = 192476 Score = 40.1 bits (20), Expect = 4.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 318 atttttgtggatggagggca 337 |||||||||||||||||||| Sbjct: 126568 atttttgtggatggagggca 126587
>gb|AC130729.3| Oryza sativa (japonica cultivar-group) chromosome 5 clone P0668F02, complete sequence Length = 178061 Score = 40.1 bits (20), Expect = 4.6 Identities = 26/28 (92%) Strand = Plus / Plus Query: 15 tatcatggttgccttttgctgcatgatc 42 ||||| |||| ||||||||||||||||| Sbjct: 41917 tatcaaggttaccttttgctgcatgatc 41944
>gb|AC147676.10| Canis Familiaris, clone XX-25H12, complete sequence Length = 203436 Score = 40.1 bits (20), Expect = 4.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 40 atcttctttttctttctttt 59 |||||||||||||||||||| Sbjct: 93033 atcttctttttctttctttt 93014
>ref|NM_000367.2| Homo sapiens thiopurine S-methyltransferase (TPMT), mRNA Length = 3258 Score = 40.1 bits (20), Expect = 4.6 Identities = 23/24 (95%) Strand = Plus / Minus Query: 43 ttctttttctttcttttgcgacag 66 |||||||||||||||||| ||||| Sbjct: 2840 ttctttttctttcttttgagacag 2817
>gb|AC160142.4| Pan troglodytes BAC clone CH251-350E17 from chromosome unknown, complete sequence Length = 199482 Score = 40.1 bits (20), Expect = 4.6 Identities = 26/28 (92%) Strand = Plus / Minus Query: 43 ttctttttctttcttttgcgacaggatc 70 |||||||| ||| ||||||||||||||| Sbjct: 167753 ttcttttttttttttttgcgacaggatc 167726 Score = 40.1 bits (20), Expect = 4.6 Identities = 26/28 (92%) Strand = Plus / Minus Query: 43 ttctttttctttcttttgcgacaggatc 70 |||||||| ||| ||||||||||||||| Sbjct: 67992 ttcttttttttttttttgcgacaggatc 67965
>gb|AC118138.2| Homo sapiens BAC clone RP11-451K15 from 7, complete sequence Length = 180150 Score = 40.1 bits (20), Expect = 4.6 Identities = 23/24 (95%) Strand = Plus / Plus Query: 43 ttctttttctttcttttgcgacag 66 |||||||||||||||||| ||||| Sbjct: 142627 ttctttttctttcttttgagacag 142650
>gb|AC137527.3| Homo sapiens chromosome 16 clone WF-X504C1, complete sequence Length = 39732 Score = 40.1 bits (20), Expect = 4.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 40 atcttctttttctttctttt 59 |||||||||||||||||||| Sbjct: 397 atcttctttttctttctttt 416
>gb|AY372049.1| Lactobacillus johnsonii strain NCC 533 RpsT, RpsO, metallo beta subunit lactamase, hypothetical protein, Tuf, trigger factor, Clp protease, GTP binding protein, and phosphotyrosinase protein phosphatase genes, complete cds Length = 9074 Score = 40.1 bits (20), Expect = 4.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 37 atgatcttctttttctttct 56 |||||||||||||||||||| Sbjct: 2315 atgatcttctttttctttct 2296
>gb|AC024607.3| Mus musculus strain C57BL6/J chromosome 5 clone RP23-240H6, complete sequence Length = 197273 Score = 40.1 bits (20), Expect = 4.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 41 tcttctttttctttcttttg 60 |||||||||||||||||||| Sbjct: 180598 tcttctttttctttcttttg 180579
>ref|XM_644990.1| Entamoeba histolytica HM-1:IMSS leucine rich repeat protein (248.t00012) partial mRNA Length = 4971 Score = 40.1 bits (20), Expect = 4.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 40 atcttctttttctttctttt 59 |||||||||||||||||||| Sbjct: 2271 atcttctttttctttctttt 2252
>gb|AC116773.8| Mus musculus chromosome 1, clone RP23-430H21, complete sequence Length = 210414 Score = 40.1 bits (20), Expect = 4.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 40 atcttctttttctttctttt 59 |||||||||||||||||||| Sbjct: 4590 atcttctttttctttctttt 4571
>gb|BC029393.1| Homo sapiens triadin, mRNA (cDNA clone IMAGE:4338005), containing frame-shift errors Length = 1211 Score = 40.1 bits (20), Expect = 4.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 40 atcttctttttctttctttt 59 |||||||||||||||||||| Sbjct: 1177 atcttctttttctttctttt 1158
>emb|AL591400.8| Human DNA sequence from clone RP11-65C6 on chromosome 6 Contains 40s ribosomal protein S3a (v-fos transformation effector protein 1) (RPS3A)(FTE1) pseudogene, complete sequence Length = 101739 Score = 40.1 bits (20), Expect = 4.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 42 cttctttttctttcttttgc 61 |||||||||||||||||||| Sbjct: 4503 cttctttttctttcttttgc 4484
>emb|AL589723.7| Human DNA sequence from clone RP11-204B7 on chromosome 6 Contains the TPMT gene for thiopurine S-methyltransferase, the gene for a novel protein similar to (TAT-interactive protein, 72-KD; tripartite motif protein TRIM32; zinc-finger protein HT2A), complete sequence Length = 147927 Score = 40.1 bits (20), Expect = 4.6 Identities = 23/24 (95%) Strand = Plus / Plus Query: 43 ttctttttctttcttttgcgacag 66 |||||||||||||||||| ||||| Sbjct: 91276 ttctttttctttcttttgagacag 91299
>emb|AL357140.33| Human DNA sequence from clone RP11-84A14 on chromosome 1 Contains the 5' end of the CLSTN1 gene for calsyntenin 1, the CTNNBIP1 gene for catenin, beta interacting protein 1, two novel genes, the LZIC gene for leucine zipper and CTNNBIP1 domain containing, the 5' end of the NMNAT1 gene for nicotinamide nucleotide adenylyltransferase 1 and a CpG island, complete sequence Length = 177470 Score = 40.1 bits (20), Expect = 4.6 Identities = 23/24 (95%) Strand = Plus / Plus Query: 43 ttctttttctttcttttgcgacag 66 |||||||||||||||||| ||||| Sbjct: 154959 ttctttttctttcttttgagacag 154982
>emb|AL162615.13| Human DNA sequence from clone RP5-1041C10 on chromosome 20 Contains the 5' end of the B4GALT5 gene for UDP-Gal:betaGlcNAc beta 1,4-galactosyltransferase polypeptide 5, b, the SNRPFP1 gene for small nuclear ribonucleoprotein polypeptide F pseudogene 1, a cytokine-like nuclear factor n-pac (N-PAC) pseudogene, the 5' end of the SLC9A8 gene for solute carrier family 9 (sodium/hydrogen exchanger) isoform 8 and two CpG islands, complete sequence Length = 140092 Score = 40.1 bits (20), Expect = 4.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 40 atcttctttttctttctttt 59 |||||||||||||||||||| Sbjct: 22926 atcttctttttctttctttt 22945
>emb|AL353681.8| Human DNA sequence from clone RP1-158P9 on chromosome 1 Contains a novel gene and a pseudogene, complete sequence Length = 113539 Score = 40.1 bits (20), Expect = 4.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 41 tcttctttttctttcttttg 60 |||||||||||||||||||| Sbjct: 98489 tcttctttttctttcttttg 98470
>emb|AL161732.7| Human DNA sequence from clone RP11-52I12 on chromosome 9 Contains the 3' end of the TMEM2 gene for transmembrane protein 2, complete sequence Length = 137391 Score = 40.1 bits (20), Expect = 4.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 41 tcttctttttctttcttttg 60 |||||||||||||||||||| Sbjct: 60267 tcttctttttctttcttttg 60286
>emb|AL133352.12| Human DNA sequence from clone RP11-411B6 on chromosome 10 Contains the 3' end of the WNT8B gene for wingless-type MMTV integration site family member 8B, the gene for secretory pathway component Sec31B-1 (SEC31B-1), the NDUFB8 gene for NADH dehydrogenase (ubiquinone) 1 beta subcomplex 8, 19kDa, the HIF1AN gene for hypoxia-inducible factor 1, alpha subunit inhibitor and four CpG islands, complete sequence Length = 157808 Score = 40.1 bits (20), Expect = 4.6 Identities = 23/24 (95%) Strand = Plus / Minus Query: 43 ttctttttctttcttttgcgacag 66 |||||||||||||||||| ||||| Sbjct: 78164 ttctttttctttcttttgagacag 78141
>emb|AL096701.14|HSA247I13 Human DNA sequence from clone RP11-247I13 on chromosome 22 Contains the 5' end of the DRG1 gene for developmentally regulated GTP binding protein 1, the EIF4ENIF1 gene foreukaryotic translation initiation factor 4E nuclear import factor 1, the 5' end of the gene for homolog of yeast Sfi1 (SFI1), a H2A histone family member Z (H2AFZ) pseudogene, a ribosomal protein S26 (RPS260) pseudogene, two novel genes and two CpG islands, complete sequence Length = 168110 Score = 40.1 bits (20), Expect = 4.6 Identities = 26/28 (92%) Strand = Plus / Plus Query: 43 ttctttttctttcttttgcgacaggatc 70 |||||||||||| ||||| ||||||||| Sbjct: 114328 ttctttttcttttttttgggacaggatc 114355
>gb|AC157787.6| Mus musculus chromosome 1, clone RP23-158A6, complete sequence Length = 199981 Score = 40.1 bits (20), Expect = 4.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 41 tcttctttttctttcttttg 60 |||||||||||||||||||| Sbjct: 185858 tcttctttttctttcttttg 185877
>emb|AL596086.9| Mouse DNA sequence from clone RP23-168C20 on chromosome 11 Contains the 3' end of the Tex14 gene for testis expressed gene 14, complete sequence Length = 200501 Score = 40.1 bits (20), Expect = 4.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 41 tcttctttttctttcttttg 60 |||||||||||||||||||| Sbjct: 183502 tcttctttttctttcttttg 183521
>gb|AC163677.2| Mus musculus BAC clone RP24-86D16 from chromosome 17, complete sequence Length = 222584 Score = 40.1 bits (20), Expect = 4.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 41 tcttctttttctttcttttg 60 |||||||||||||||||||| Sbjct: 131492 tcttctttttctttcttttg 131511
>emb|CR749591.1| Homo sapiens mRNA; cDNA DKFZp779I2253 (from clone DKFZp779I2253) Length = 3445 Score = 40.1 bits (20), Expect = 4.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 40 atcttctttttctttctttt 59 |||||||||||||||||||| Sbjct: 80 atcttctttttctttctttt 61
>gb|AC161624.4| Pan troglodytes BAC clone CH251-149E7 from chromosome unknown, complete sequence Length = 180132 Score = 40.1 bits (20), Expect = 4.6 Identities = 26/28 (92%) Strand = Plus / Plus Query: 43 ttctttttctttcttttgcgacaggatc 70 |||||||||||| ||||| ||||||||| Sbjct: 33399 ttctttttcttttttttgggacaggatc 33426
>gb|AC025458.5| Homo sapiens chromosome 5 clone CTD-2206G10, complete sequence Length = 119760 Score = 40.1 bits (20), Expect = 4.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 8 gagtatatatcatggttgcc 27 |||||||||||||||||||| Sbjct: 17068 gagtatatatcatggttgcc 17087
>gb|AE012356.1| Xanthomonas campestris pv. campestris str. ATCC 33913, section 264 of 460 of the complete genome Length = 10623 Score = 40.1 bits (20), Expect = 4.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 294 gccgctggcggcgccgccgt 313 |||||||||||||||||||| Sbjct: 1657 gccgctggcggcgccgccgt 1638
>gb|AC107976.4| Homo sapiens chromosome 15, clone CTD-2576F9, complete sequence Length = 131548 Score = 40.1 bits (20), Expect = 4.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 40 atcttctttttctttctttt 59 |||||||||||||||||||| Sbjct: 28496 atcttctttttctttctttt 28515
>gb|AC105418.5| Homo sapiens BAC clone RP11-450O3 from 7, complete sequence Length = 195834 Score = 40.1 bits (20), Expect = 4.6 Identities = 23/24 (95%) Strand = Plus / Minus Query: 43 ttctttttctttcttttgcgacag 66 |||||||||||||||||| ||||| Sbjct: 92790 ttctttttctttcttttgagacag 92767
>ref|XM_631530.1| Dictyostelium discoideum AX4 hypothetical protein (DDB0188028), partial mRNA Length = 792 Score = 40.1 bits (20), Expect = 4.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 40 atcttctttttctttctttt 59 |||||||||||||||||||| Sbjct: 474 atcttctttttctttctttt 455
>gb|AC025205.12| Homo sapiens chromosome 17, clone RP11-140O10, complete sequence Length = 188417 Score = 40.1 bits (20), Expect = 4.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 41 tcttctttttctttcttttg 60 |||||||||||||||||||| Sbjct: 24871 tcttctttttctttcttttg 24890
>gb|AC073855.5| Homo sapiens BAC clone RP11-799A12 from 4, complete sequence Length = 193024 Score = 40.1 bits (20), Expect = 4.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 40 atcttctttttctttctttt 59 |||||||||||||||||||| Sbjct: 180932 atcttctttttctttctttt 180951
>gb|AC092349.3| Homo sapiens chromosome 5 clone RP11-287J9, complete sequence Length = 144155 Score = 40.1 bits (20), Expect = 4.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 40 atcttctttttctttctttt 59 |||||||||||||||||||| Sbjct: 33448 atcttctttttctttctttt 33467
>gb|AC006995.5| Homo sapiens BAC clone RP11-396K3 from 7, complete sequence Length = 211531 Score = 40.1 bits (20), Expect = 4.6 Identities = 23/24 (95%) Strand = Plus / Plus Query: 43 ttctttttctttcttttgcgacag 66 |||||||||||||||||| ||||| Sbjct: 160401 ttctttttctttcttttgagacag 160424
>gb|AC153570.9| Mus musculus 10 BAC RP23-221F6 (Roswell Park Cancer Institute (C57BL/6J Female) Mouse BAC Library) complete sequence Length = 216030 Score = 40.1 bits (20), Expect = 4.6 Identities = 26/28 (92%) Strand = Plus / Minus Query: 46 tttttctttcttttgcgacaggatcatg 73 ||||||||||| ||| |||||||||||| Sbjct: 28022 tttttctttctattgagacaggatcatg 27995
>gb|CP000050.1| Xanthomonas campestris pv. campestris str. 8004, complete genome Length = 5148708 Score = 40.1 bits (20), Expect = 4.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 294 gccgctggcggcgccgccgt 313 |||||||||||||||||||| Sbjct: 2003389 gccgctggcggcgccgccgt 2003408
>dbj|AK042101.1| Mus musculus 3 days neonate thymus cDNA, RIKEN full-length enriched library, clone:A630058C13 product:unclassifiable, full insert sequence Length = 1583 Score = 40.1 bits (20), Expect = 4.6 Identities = 23/24 (95%) Strand = Plus / Plus Query: 47 ttttctttcttttgcgacaggatc 70 |||||||||||||| ||||||||| Sbjct: 463 ttttctttcttttgagacaggatc 486
>gb|AC160090.4| Mus musculus 6 BAC RP23-322E20 (Roswell Park Cancer Institute (C57BL/6J Female) Mouse BAC Library) complete sequence Length = 206093 Score = 40.1 bits (20), Expect = 4.6 Identities = 23/24 (95%) Strand = Plus / Plus Query: 47 ttttctttcttttgcgacaggatc 70 |||||||||||||| ||||||||| Sbjct: 40305 ttttctttcttttgagacaggatc 40328
>gb|AC154004.7| Mus musculus 6 BAC RP24-169F24 (Roswell Park Cancer Institute (C57BL/6J Male) Mouse BAC Library) complete sequence Length = 168376 Score = 40.1 bits (20), Expect = 4.6 Identities = 23/24 (95%) Strand = Plus / Plus Query: 47 ttttctttcttttgcgacaggatc 70 |||||||||||||| ||||||||| Sbjct: 137188 ttttctttcttttgagacaggatc 137211
>dbj|AK003943.1| Mus musculus 18-day embryo whole body cDNA, RIKEN full-length enriched library, clone:1110028F11 product:unclassifiable, full insert sequence Length = 1004 Score = 40.1 bits (20), Expect = 4.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 41 tcttctttttctttcttttg 60 |||||||||||||||||||| Sbjct: 678 tcttctttttctttcttttg 697
>dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, complete sequence Length = 29644043 Score = 40.1 bits (20), Expect = 4.6 Identities = 23/24 (95%) Strand = Plus / Plus Query: 31 tgctgcatgatcttctttttcttt 54 |||||||| ||||||||||||||| Sbjct: 24122965 tgctgcattatcttctttttcttt 24122988
>dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 5, complete sequence Length = 29737217 Score = 40.1 bits (20), Expect = 4.6 Identities = 26/28 (92%) Strand = Plus / Plus Query: 15 tatcatggttgccttttgctgcatgatc 42 ||||| |||| ||||||||||||||||| Sbjct: 19900753 tatcaaggttaccttttgctgcatgatc 19900780
>gb|AC097715.3| Homo sapiens BAC clone RP11-563A13 from 2, complete sequence Length = 143642 Score = 40.1 bits (20), Expect = 4.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 208 tatacttactacagtataca 227 |||||||||||||||||||| Sbjct: 142418 tatacttactacagtataca 142437
>gb|AC087564.6| Homo sapiens chromosome 16 clone RP11-437L7, complete sequence Length = 157233 Score = 40.1 bits (20), Expect = 4.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 40 atcttctttttctttctttt 59 |||||||||||||||||||| Sbjct: 29997 atcttctttttctttctttt 29978
>gb|AY834770.1|AH014526S06 Bos taurus calpastatin (CAST) gene, exons 3 through 8 Length = 13252 Score = 40.1 bits (20), Expect = 4.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 42 cttctttttctttcttttgc 61 |||||||||||||||||||| Sbjct: 4653 cttctttttctttcttttgc 4672
>gb|AC092469.10| Homo sapiens 12 BAC RP11-440E12 (Roswell Park Cancer Institute Human BAC Library) complete sequence Length = 104395 Score = 40.1 bits (20), Expect = 4.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 40 atcttctttttctttctttt 59 |||||||||||||||||||| Sbjct: 11483 atcttctttttctttctttt 11502
>gb|AC005080.2|AC005080 Homo sapiens BAC clone CTA-269P13 from 7q11.2, complete sequence Length = 124526 Score = 40.1 bits (20), Expect = 4.6 Identities = 23/24 (95%) Strand = Plus / Minus Query: 43 ttctttttctttcttttgcgacag 66 |||||||||||||||||| ||||| Sbjct: 1560 ttctttttctttcttttgagacag 1537
>gb|AC079296.5| Homo sapiens chromosome 11, clone RP11-467K18, complete sequence Length = 194686 Score = 40.1 bits (20), Expect = 4.6 Identities = 26/28 (92%) Strand = Plus / Plus Query: 43 ttctttttctttcttttgcgacaggatc 70 |||||||||||| ||||| ||||||||| Sbjct: 57704 ttctttttcttttttttgagacaggatc 57731
>gb|AC132220.10| Homo sapiens chromosome 15, clone RP11-1142D4, complete sequence Length = 162101 Score = 40.1 bits (20), Expect = 4.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 40 atcttctttttctttctttt 59 |||||||||||||||||||| Sbjct: 103056 atcttctttttctttctttt 103037
>gb|AC019159.8| Homo sapiens BAC clone RP11-56O18 from 2, complete sequence Length = 163085 Score = 40.1 bits (20), Expect = 4.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 208 tatacttactacagtataca 227 |||||||||||||||||||| Sbjct: 776 tatacttactacagtataca 795
>gb|AC022816.15|AC022816 Homo sapiens chromosome 17, clone RP11-626C5, complete sequence Length = 95546 Score = 40.1 bits (20), Expect = 4.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 41 tcttctttttctttcttttg 60 |||||||||||||||||||| Sbjct: 25721 tcttctttttctttcttttg 25702
>gb|AC099066.3| Homo sapiens chromosome 1 clone RP11-145A3, complete sequence Length = 149549 Score = 40.1 bits (20), Expect = 4.6 Identities = 26/28 (92%) Strand = Plus / Plus Query: 43 ttctttttctttcttttgcgacaggatc 70 |||||||||||| ||||| ||||||||| Sbjct: 4941 ttctttttcttttttttgagacaggatc 4968
>gb|AC167467.1| Mus musculus BAC clone RP23-158E17 from chromosome 9, complete sequence Length = 212426 Score = 40.1 bits (20), Expect = 4.6 Identities = 23/24 (95%) Strand = Plus / Plus Query: 46 tttttctttcttttgcgacaggat 69 ||||||||||||||| |||||||| Sbjct: 197729 tttttctttcttttgagacaggat 197752
>dbj|BA000019.2| Nostoc sp. PCC 7120 DNA, complete genome Length = 6413771 Score = 40.1 bits (20), Expect = 4.6 Identities = 23/24 (95%) Strand = Plus / Plus Query: 38 tgatcttctttttctttcttttgc 61 |||| ||||||||||||||||||| Sbjct: 5551277 tgatgttctttttctttcttttgc 5551300
>dbj|AP003846.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, BAC clone:OJ1710_H11 Length = 136107 Score = 40.1 bits (20), Expect = 4.6 Identities = 23/24 (95%) Strand = Plus / Plus Query: 31 tgctgcatgatcttctttttcttt 54 |||||||| ||||||||||||||| Sbjct: 56380 tgctgcattatcttctttttcttt 56403
>emb|BX088699.4| Zebrafish DNA sequence from clone CH211-192K19 in linkage group 9, complete sequence Length = 112979 Score = 40.1 bits (20), Expect = 4.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 39 gatcttctttttctttcttt 58 |||||||||||||||||||| Sbjct: 2732 gatcttctttttctttcttt 2751
>emb|BX005073.7| Zebrafish DNA sequence from clone CH211-129N18, complete sequence Length = 185849 Score = 40.1 bits (20), Expect = 4.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 40 atcttctttttctttctttt 59 |||||||||||||||||||| Sbjct: 170537 atcttctttttctttctttt 170556
>dbj|BS000107.1| Pan troglodytes chromosome 22 clone:PTB-020H02, map 22, complete sequences Length = 145633 Score = 40.1 bits (20), Expect = 4.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 37 atgatcttctttttctttct 56 |||||||||||||||||||| Sbjct: 98340 atgatcttctttttctttct 98321
>dbj|AB023032.1| Arabidopsis thaliana genomic DNA, chromosome 5, TAC clone:K5J14 Length = 59762 Score = 40.1 bits (20), Expect = 4.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 40 atcttctttttctttctttt 59 |||||||||||||||||||| Sbjct: 30593 atcttctttttctttctttt 30574
>gb|AF165917.1|AF165917 Canis familiaris triadin isoform 3 mRNA, complete cds Length = 3649 Score = 40.1 bits (20), Expect = 4.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 40 atcttctttttctttctttt 59 |||||||||||||||||||| Sbjct: 1136 atcttctttttctttctttt 1117
>gb|AF165916.1|AF165916 Canis familiaris triadin mRNA, complete cds Length = 2349 Score = 40.1 bits (20), Expect = 4.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 40 atcttctttttctttctttt 59 |||||||||||||||||||| Sbjct: 1199 atcttctttttctttctttt 1180
>gb|U18985.1|HSU18985 Human triadin mRNA, complete cds Length = 2947 Score = 40.1 bits (20), Expect = 4.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 40 atcttctttttctttctttt 59 |||||||||||||||||||| Sbjct: 1024 atcttctttttctttctttt 1005
>gb|AF068845.1|AF068845 Mycobacteriophage TM4, complete genome Length = 52797 Score = 40.1 bits (20), Expect = 4.6 Identities = 26/28 (92%) Strand = Plus / Minus Query: 290 ccaagccgctggcggcgccgccgttgcc 317 |||| ||||| ||||||||||||||||| Sbjct: 33822 ccaaaccgctcgcggcgccgccgttgcc 33795
>emb|BX629358.1|CNS09SBU Tetraodon nigroviridis BAC sequence Length = 157345 Score = 40.1 bits (20), Expect = 4.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 323 tgtggatggagggcagctcg 342 |||||||||||||||||||| Sbjct: 44912 tgtggatggagggcagctcg 44893
>gb|AC118731.11| Mus musculus chromosome 1, clone RP24-169M20, complete sequence Length = 160688 Score = 40.1 bits (20), Expect = 4.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 40 atcttctttttctttctttt 59 |||||||||||||||||||| Sbjct: 106404 atcttctttttctttctttt 106385
>gb|AF019369.1|HSTHSMT7 Human thiopurine methyltransferase (TPMT) gene, exon 10 and complete cds Length = 3286 Score = 40.1 bits (20), Expect = 4.6 Identities = 23/24 (95%) Strand = Plus / Minus Query: 43 ttctttttctttcttttgcgacag 66 |||||||||||||||||| ||||| Sbjct: 2652 ttctttttctttcttttgagacag 2629
>gb|U30518.1|HSTPMT09 Human thiopurine methyltransferase (TPMT) gene, exon 10 and complete cds Length = 2958 Score = 40.1 bits (20), Expect = 4.6 Identities = 23/24 (95%) Strand = Plus / Minus Query: 43 ttctttttctttcttttgcgacag 66 |||||||||||||||||| ||||| Sbjct: 2115 ttctttttctttcttttgagacag 2092
>gb|U34201.1|OCU34201 Oryctolagus cuniculus cardiac triadin isoform 3 (CT3) mRNA, complete cds Length = 2033 Score = 40.1 bits (20), Expect = 4.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 40 atcttctttttctttctttt 59 |||||||||||||||||||| Sbjct: 1002 atcttctttttctttctttt 983
>gb|AC154001.5| Mus musculus 6 BAC RP24-419M4 (Roswell Park Cancer Institute (C57BL/6J Male) Mouse BAC Library) complete sequence Length = 183830 Score = 40.1 bits (20), Expect = 4.6 Identities = 23/24 (95%) Strand = Plus / Minus Query: 47 ttttctttcttttgcgacaggatc 70 |||||||||||||| ||||||||| Sbjct: 1308 ttttctttcttttgagacaggatc 1285
>gb|L77117.1| Methanocaldococcus jannaschii DSM 2661, complete genome Length = 1664970 Score = 40.1 bits (20), Expect = 4.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 40 atcttctttttctttctttt 59 |||||||||||||||||||| Sbjct: 1075229 atcttctttttctttctttt 1075248
>gb|AC005624.1|AC005624 Homo sapiens chromosome 19, cosmid R30017, complete sequence Length = 39594 Score = 40.1 bits (20), Expect = 4.6 Identities = 23/24 (95%) Strand = Plus / Plus Query: 43 ttctttttctttcttttgcgacag 66 |||||||||||||||||| ||||| Sbjct: 31170 ttctttttctttcttttgagacag 31193
>gb|AE017198.1| Lactobacillus johnsonii NCC 533, complete genome Length = 1992676 Score = 40.1 bits (20), Expect = 4.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 37 atgatcttctttttctttct 56 |||||||||||||||||||| Sbjct: 907632 atgatcttctttttctttct 907613
>gb|AC133169.3| Mus musculus BAC clone RP24-259I15 from 9, complete sequence Length = 163930 Score = 40.1 bits (20), Expect = 4.6 Identities = 23/24 (95%) Strand = Plus / Plus Query: 46 tttttctttcttttgcgacaggat 69 ||||||||||||||| |||||||| Sbjct: 566 tttttctttcttttgagacaggat 589
>gb|AC133599.3| Mus musculus BAC clone RP24-390N10 from 6, complete sequence Length = 185830 Score = 40.1 bits (20), Expect = 4.6 Identities = 23/24 (95%) Strand = Plus / Minus Query: 36 catgatcttctttttctttctttt 59 |||||| ||||||||||||||||| Sbjct: 117107 catgattttctttttctttctttt 117084
>dbj|AP006627.1| Bacillus clausii KSM-K16 DNA, complete genome Length = 4303871 Score = 40.1 bits (20), Expect = 4.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 42 cttctttttctttcttttgc 61 |||||||||||||||||||| Sbjct: 2820332 cttctttttctttcttttgc 2820351
>emb|AL844897.5| Mouse DNA sequence from clone RP23-284F8 on chromosome X, complete sequence Length = 53970 Score = 40.1 bits (20), Expect = 4.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 40 atcttctttttctttctttt 59 |||||||||||||||||||| Sbjct: 40011 atcttctttttctttctttt 39992
>gb|AC099701.4| Mus musculus chromosome 7, clone RP23-184F6, complete sequence Length = 226167 Score = 40.1 bits (20), Expect = 4.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 40 atcttctttttctttctttt 59 |||||||||||||||||||| Sbjct: 88551 atcttctttttctttctttt 88532
>gb|AC166160.3| Mus musculus BAC clone RP24-86O19 from chromosome 7, complete sequence Length = 221792 Score = 40.1 bits (20), Expect = 4.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 48 tttctttcttttgcgacagg 67 |||||||||||||||||||| Sbjct: 98719 tttctttcttttgcgacagg 98700
>dbj|AB045146.1| Homo sapiens TPMT gene for thiopurine S-methyltransferase, complete cds Length = 27870 Score = 40.1 bits (20), Expect = 4.6 Identities = 23/24 (95%) Strand = Plus / Minus Query: 43 ttctttttctttcttttgcgacag 66 |||||||||||||||||| ||||| Sbjct: 27236 ttctttttctttcttttgagacag 27213 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 4,896,350 Number of Sequences: 3902068 Number of extensions: 4896350 Number of successful extensions: 177254 Number of sequences better than 10.0: 106 Number of HSP's better than 10.0 without gapping: 106 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 176772 Number of HSP's gapped (non-prelim): 482 length of query: 344 length of database: 17,233,045,268 effective HSP length: 22 effective length of query: 322 effective length of database: 17,147,199,772 effective search space: 5521398326584 effective search space used: 5521398326584 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)
