ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbastl18b12
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1gb|AC091078.7| Homo sapiens, clone RP11-164C12, complete sequence 40 0.74
2gb|AC110023.3| Homo sapiens chromosome 15, clone RP11-739G5, com... 40 0.74
3gb|AE006090.1| Pasteurella multocida subsp. multocida str. Pm70 ... 38 2.9
4gb|AC113059.7| Mus musculus chromosome 10, clone RP23-255F14, co... 38 2.9
5gb|AC021709.12| Mus musculus chromosome 10, clone RP23-194I3, co... 38 2.9
6gb|AC145418.5| Dasypus novemcinctus clone VMRC5-458M22, complete... 38 2.9
7emb|BX572633.7| Zebrafish DNA sequence from clone CH211-276P10 i... 38 2.9
8emb|AL590444.1|CNS07EGB chromosome IV of strain GB-M1 of Encepha... 38 2.9
9gb|AC005266.1|AC005266 Homo sapiens chromosome 19, cosmid F23465... 38 2.9
10gb|AC122870.4| Mus musculus BAC clone RP23-103D17 from 3, comple... 38 2.9
11dbj|D14044.1|CUCGLOX Cucurbita cv. Kurokawa Amakuri mRNA for gly... 38 2.9

>gb|AC091078.7| Homo sapiens, clone RP11-164C12, complete sequence
          Length = 182776

 Score = 40.1 bits (20), Expect = 0.74
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 39     aaatatgaaaaatctgaaga 58
              ||||||||||||||||||||
Sbjct: 179809 aaatatgaaaaatctgaaga 179790



to top

>gb|AC110023.3| Homo sapiens chromosome 15, clone RP11-739G5, complete sequence
          Length = 166975

 Score = 40.1 bits (20), Expect = 0.74
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 39    aaatatgaaaaatctgaaga 58
             ||||||||||||||||||||
Sbjct: 21122 aaatatgaaaaatctgaaga 21103



to top

>gb|AE006090.1| Pasteurella multocida subsp. multocida str. Pm70 section 57 of 204 of
            the complete genome
          Length = 9961

 Score = 38.2 bits (19), Expect = 2.9
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                               
Query: 43   atgaaaaatctgaagagcg 61
            |||||||||||||||||||
Sbjct: 7164 atgaaaaatctgaagagcg 7146



to top

>gb|AC113059.7| Mus musculus chromosome 10, clone RP23-255F14, complete sequence
          Length = 211296

 Score = 38.2 bits (19), Expect = 2.9
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 12    atttgtgctgggattcaaa 30
             |||||||||||||||||||
Sbjct: 68273 atttgtgctgggattcaaa 68291



to top

>gb|AC021709.12| Mus musculus chromosome 10, clone RP23-194I3, complete sequence
          Length = 319367

 Score = 38.2 bits (19), Expect = 2.9
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 12     atttgtgctgggattcaaa 30
              |||||||||||||||||||
Sbjct: 159481 atttgtgctgggattcaaa 159499



to top

>gb|AC145418.5| Dasypus novemcinctus clone VMRC5-458M22, complete sequence
          Length = 117130

 Score = 38.2 bits (19), Expect = 2.9
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 39    aaatatgaaaaatctgaag 57
             |||||||||||||||||||
Sbjct: 85701 aaatatgaaaaatctgaag 85719



to top

>emb|BX572633.7| Zebrafish DNA sequence from clone CH211-276P10 in linkage group 18,
             complete sequence
          Length = 184987

 Score = 38.2 bits (19), Expect = 2.9
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 36    cgcaaatatgaaaaatctg 54
             |||||||||||||||||||
Sbjct: 18384 cgcaaatatgaaaaatctg 18402



to top

>emb|AL590444.1|CNS07EGB chromosome IV of strain GB-M1 of Encephalitozoon cuniculi (Microspora)
          Length = 218329

 Score = 38.2 bits (19), Expect = 2.9
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 33    tcccgcaaatatgaaaaat 51
             |||||||||||||||||||
Sbjct: 80464 tcccgcaaatatgaaaaat 80446



to top

>gb|AC005266.1|AC005266 Homo sapiens chromosome 19, cosmid F23465, complete sequence
          Length = 40111

 Score = 38.2 bits (19), Expect = 2.9
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 40    aatatgaaaaatctgaaga 58
             |||||||||||||||||||
Sbjct: 22017 aatatgaaaaatctgaaga 21999



to top

>gb|AC122870.4| Mus musculus BAC clone RP23-103D17 from 3, complete sequence
          Length = 181063

 Score = 38.2 bits (19), Expect = 2.9
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 38    caaatatgaaaaatctgaa 56
             |||||||||||||||||||
Sbjct: 77740 caaatatgaaaaatctgaa 77758



to top

>dbj|D14044.1|CUCGLOX Cucurbita cv. Kurokawa Amakuri mRNA for glycolate oxidase, complete
           cds
          Length = 1381

 Score = 38.2 bits (19), Expect = 2.9
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                              
Query: 15  tgtgctgggattcaaaatt 33
           |||||||||||||||||||
Sbjct: 282 tgtgctgggattcaaaatt 300


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 1,753,741
Number of Sequences: 3902068
Number of extensions: 1753741
Number of successful extensions: 63204
Number of sequences better than 10.0: 11
Number of HSP's better than 10.0 without gapping: 11
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 63189
Number of HSP's gapped (non-prelim): 15
length of query: 73
length of database: 17,233,045,268
effective HSP length: 21
effective length of query: 52
effective length of database: 17,151,101,840
effective search space: 891857295680
effective search space used: 891857295680
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 19 (38.2 bits)
to top