ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbastl18b01
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1ref|XM_626340.1| Cryptosporidium parvum Iowa II hypothetical pro... 46 0.054
2gb|AC136506.10| Medicago truncatula clone mth2-33c8, complete se... 42 0.85
3gb|AC171499.14| Medicago truncatula clone mth2-157b12, complete ... 40 3.4
4gb|AC159238.2| Mus musculus BAC clone RP24-477O8 from chromosome... 40 3.4
5gb|AC122887.2| Mus musculus BAC clone RP23-91L6 from 10, complet... 40 3.4
6gb|AC151740.21| Medicago truncatula clone mth2-82n16, complete s... 40 3.4
7gb|AC107626.2| Homo sapiens chromosome 3 clone RP11-1008M1, comp... 40 3.4
8dbj|AK157326.1| Mus musculus activated spleen cDNA, RIKEN full-l... 40 3.4
9gb|AE014299.1| Shewanella oneidensis MR-1, complete genome 40 3.4
10gb|AC153930.2| Mus musculus 10 BAC RP24-461H14 (Roswell Park Can... 40 3.4

>ref|XM_626340.1| Cryptosporidium parvum Iowa II hypothetical protein (cgd2_1130),
           partial mRNA
          Length = 2046

 Score = 46.1 bits (23), Expect = 0.054
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                      
Query: 81  agctaattatctcaaatacattacaac 107
           |||||||||||||||||||||| ||||
Sbjct: 923 agctaattatctcaaatacatttcaac 949



to top

>gb|AC136506.10| Medicago truncatula clone mth2-33c8, complete sequence
          Length = 135457

 Score = 42.1 bits (21), Expect = 0.85
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 6     gttgtgttcaaaataactaaa 26
             |||||||||||||||||||||
Sbjct: 92768 gttgtgttcaaaataactaaa 92788



to top

>gb|AC171499.14| Medicago truncatula clone mth2-157b12, complete sequence
          Length = 81116

 Score = 40.1 bits (20), Expect = 3.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 3     gatgttgtgttcaaaataac 22
             ||||||||||||||||||||
Sbjct: 75402 gatgttgtgttcaaaataac 75421



to top

>gb|AC159238.2| Mus musculus BAC clone RP24-477O8 from chromosome 12, complete sequence
          Length = 176407

 Score = 40.1 bits (20), Expect = 3.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 221    ttgatcatatatgctgactg 240
              ||||||||||||||||||||
Sbjct: 127799 ttgatcatatatgctgactg 127818



to top

>gb|AC122887.2| Mus musculus BAC clone RP23-91L6 from 10, complete sequence
          Length = 186103

 Score = 40.1 bits (20), Expect = 3.4
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 4     atgttgtgttcaaaataactaaag 27
             ||||| ||||||||||||||||||
Sbjct: 78671 atgttatgttcaaaataactaaag 78694



to top

>gb|AC151740.21| Medicago truncatula clone mth2-82n16, complete sequence
          Length = 131700

 Score = 40.1 bits (20), Expect = 3.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 64    caagttcatgtatgaacagc 83
             ||||||||||||||||||||
Sbjct: 72067 caagttcatgtatgaacagc 72086



to top

>gb|AC107626.2| Homo sapiens chromosome 3 clone RP11-1008M1, complete sequence
          Length = 179484

 Score = 40.1 bits (20), Expect = 3.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 66     agttcatgtatgaacagcta 85
              ||||||||||||||||||||
Sbjct: 161081 agttcatgtatgaacagcta 161100



to top

>dbj|AK157326.1| Mus musculus activated spleen cDNA, RIKEN full-length enriched
           library, clone:F830211E14 product:unclassifiable, full
           insert sequence
          Length = 1603

 Score = 40.1 bits (20), Expect = 3.4
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 4   atgttgtgttcaaaataactaaag 27
           ||||| ||||||||||||||||||
Sbjct: 745 atgttatgttcaaaataactaaag 722



to top

>gb|AE014299.1| Shewanella oneidensis MR-1, complete genome
          Length = 4969803

 Score = 40.1 bits (20), Expect = 3.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 15     aaaataactaaagcgatttt 34
              ||||||||||||||||||||
Sbjct: 343794 aaaataactaaagcgatttt 343813



to top

>gb|AC153930.2| Mus musculus 10 BAC RP24-461H14 (Roswell Park Cancer Institute
             (C57BL/6J Male) Mouse BAC Library) complete sequence
          Length = 186915

 Score = 40.1 bits (20), Expect = 3.4
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 4     atgttgtgttcaaaataactaaag 27
             ||||| ||||||||||||||||||
Sbjct: 17068 atgttatgttcaaaataactaaag 17045


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 2,126,823
Number of Sequences: 3902068
Number of extensions: 2126823
Number of successful extensions: 41944
Number of sequences better than 10.0: 10
Number of HSP's better than 10.0 without gapping: 10
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 41913
Number of HSP's gapped (non-prelim): 31
length of query: 259
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 237
effective length of database: 17,147,199,772
effective search space: 4063886345964
effective search space used: 4063886345964
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top