>emb|AL772362.8| Zebrafish DNA sequence from clone CH211-173K16 in linkage group 13,
              complete sequence
          Length = 165993

 Score = 44.1 bits (22), Expect = 0.10
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                        
Query: 27     ttcatataagctctcgactgagtttc 52
              |||||||| |||||||||||||||||
Sbjct: 151331 ttcatatatgctctcgactgagtttc 151306

>emb|BX629357.1|CNS09SBV Tetraodon nigroviridis BAC sequence
          Length = 168910

 Score = 42.1 bits (21), Expect = 0.40
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 14     ttcttactaagttttcatata 34
              |||||||||||||||||||||
Sbjct: 141218 ttcttactaagttttcatata 141198

>gb|AC017081.8| Homo sapiens BAC clone RP11-470J24 from 2, complete sequence
          Length = 149462

 Score = 40.1 bits (20), Expect = 1.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 62    ccaaaactttcatatctaaa 81
             ||||||||||||||||||||
Sbjct: 29599 ccaaaactttcatatctaaa 29580

>gb|AC112484.8| Homo sapiens 3 BAC RP11-723O4 (Roswell Park Cancer Institute Human BAC
             Library) complete sequence
          Length = 185470

 Score = 40.1 bits (20), Expect = 1.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 58    gtgtccaaaactttcatatc 77
             ||||||||||||||||||||
Sbjct: 41312 gtgtccaaaactttcatatc 41293

>dbj|AP002428.3| Homo sapiens genomic DNA, chromosome 11q clone:RP11-99C10, complete
              sequences
          Length = 175110

 Score = 40.1 bits (20), Expect = 1.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 65     aaactttcatatctaaacca 84
              ||||||||||||||||||||
Sbjct: 139050 aaactttcatatctaaacca 139031

>dbj|AP000923.5| Homo sapiens genomic DNA, chromosome 11q, clone:RP11-752D5, complete
             sequences
          Length = 170973

 Score = 40.1 bits (20), Expect = 1.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 65    aaactttcatatctaaacca 84
             ||||||||||||||||||||
Sbjct: 31136 aaactttcatatctaaacca 31117

>gb|AC125083.3| Mus musculus chromosome 19 clone RP24-98I2, complete sequence
          Length = 172673

 Score = 38.2 bits (19), Expect = 6.3
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 70    ttcatatctaaaccatgac 88
             |||||||||||||||||||
Sbjct: 24616 ttcatatctaaaccatgac 24634

>gb|AC092562.4| Papio hamadryas BAC RP41-285I13 (Rosewell Park Cancer Institute BAC
             Library) complete sequence
          Length = 183586

 Score = 38.2 bits (19), Expect = 6.3
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 42    gactgagtttcgctcggtg 60
             |||||||||||||||||||
Sbjct: 54660 gactgagtttcgctcggtg 54642

>gb|AC008571.6| Homo sapiens chromosome 5 clone CTC-550M4, complete sequence
          Length = 214267

 Score = 38.2 bits (19), Expect = 6.3
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 7     tctctctttcttactaagt 25
             |||||||||||||||||||
Sbjct: 46893 tctctctttcttactaagt 46875


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 1,314,274
Number of Sequences: 3902068
Number of extensions: 1314274
Number of successful extensions: 69629
Number of sequences better than 10.0: 10
Number of HSP's better than 10.0 without gapping: 10
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 69613
Number of HSP's gapped (non-prelim): 16
length of query: 134
length of database: 17,233,045,268
effective HSP length: 21
effective length of query: 113
effective length of database: 17,151,101,840
effective search space: 1938074507920
effective search space used: 1938074507920
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 19 (38.2 bits)